This article was downloaded by: [Thammasat University Libraries] On: 09 October 2014, At: 13:18 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Environmental Technology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tent20
Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11°C a
a
b
c
Min Pan , Liam Garry Henry , Rui Liu , Xiaoming Huang & Xinmin Zhan
a
a
Civil Engineering, College of Engineering and Informatics, National University of Ireland, Galway, Ireland b
Zhejiang Provincial Key Laboratory of Water Science and Technology, Department of Environment in Yangtze Delta Region Institute of Tsinghua University, Zhejiang, Jiaxing 314006, People's Republic of China c
Water Resources and Environmental Institute, Xiamen University of Technology, Xiamen 361024, People's Republic of China Accepted author version posted online: 20 Aug 2013.Published online: 23 Sep 2013.
To cite this article: Min Pan, Liam Garry Henry, Rui Liu, Xiaoming Huang & Xinmin Zhan (2014) Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11°C, Environmental Technology, 35:4, 470-477, DOI: 10.1080/09593330.2013.832336 To link to this article: http://dx.doi.org/10.1080/09593330.2013.832336
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Environmental Technology, 2014 Vol. 35, No. 4, 470–477, http://dx.doi.org/10.1080/09593330.2013.832336
Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11◦ C Min Pana , Liam Garry Henrya , Rui Liub , Xiaoming Huangc and Xinmin Zhana∗ Engineering, College of Engineering and Informatics, National University of Ireland, Galway, Ireland; b Zhejiang Provincial Key Laboratory of Water Science and Technology, Department of Environment in Yangtze Delta Region Institute of Tsinghua University, Zhejiang, Jiaxing 314006, People’s Republic of China; c Water Resources and Environmental Institute, Xiamen University of Technology, Xiamen 361024, People’s Republic of China
a Civil
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
(Received 9 May 2013; accepted 30 July 2013 ) This study is aimed to examine the removal of nitrogen from high strength slaughterhouse wastewater at 11◦ C via partial nitrification followed by denitrification (PND), using the intermittently aerated sequencing batch reactor (IASBR) technology. The slaughterhouse wastewater contained chemical oxygen demand (COD) of 6068 mg/L, total nitrogen (TN) of 571 mg/L, total phosphorus (TP) of 51 mg/L and suspended solids of 1.8 g/L, on average. The laboratory-scale IASBR reactors had a working volume of 8 L and was operated at an average organic loading rate of 0.61 g COD/(L·d). At the cycle duration of 12 h, COD was efficiently removed under three aeration rates of 0.4, 0.6 and 0.8 L air/min. Among the three aeration rates, the optimum aeration rate was 0.6 L air/min with removals of COD, TN, and TP of 98%, 98%, and 96%, respectively. The treated wastewater met the Irish emission standards. The microbial community analysis by fluorescence in situ hybridization shows 12 ± 0.4% of ammonium oxidizing bacteria, and 7.2 ± 0.4% of nitrite oxidizing bacteria in the general bacteria (EUB) in the activated sludge at the aeration rate of 0.6 L air/min, leading to efficient partial nitrification. PND effectively removed nitrogen from slaughterhouse wastewater at 11◦ C, but PND efficiency was dependent on the aeration rate applied. PND efficiencies were up to 75.8%, 70.1% and only 25.4% at the aeration rates of 0.4, 0.6, and 0.8 L air/min. Keywords: aeration rate; intermittent aeration; slaughterhouse wastewater; partial nitrification–denitrification; nitrite
Introduction A large amount of slaughterhouse wastewater is generated in meat product manufacturing due to the cleaning process. It contains high concentrations of organic matter, oil and grease, and nitrogenous compounds (proteins and amino acids).[1] Hence, its treatment before discharge is necessary for protection of the water environment. Slaughterhouses often discharge wastewater into municipal sewers after primary pretreatment, such as coagulation, flocculation, and air flotation, which is not sufficient, causing the municipal wastewater treatment plants (WWTPs) overloaded.[2] Given the high biodegradability of slaughterhouse wastewater, biological processes are considered to be suitable for organic matter removal from this type of wastewater. A typical biological nitrogen removal (BNR) process comprises autotrophic nitrification and heterotrophic denitrification. In the nitrification process, ammonium − (NH+ 4 − N) is firstly oxidized to nitrite (NO2 − N) by ammonia oxidizing bacteria (AOB), which is called nitri− tation, and then NO− 2 − N is oxidized to nitrate (NO3 − N) by nitrite oxidizing bacteria (NOB), which is called nitratation. During the denitrification process, NO− 3 − N is
∗ Corresponding
author. Email: [email protected]
© 2013 Taylor & Francis
reduced to nitrogen gas by denitrifiers. Based on the fact that NO− 2 − N is an intermediate product in both nitrification and denitrification, a shortcut nitrogen removal via nitrite, like partial nitrification followed by denitrification (PND), has been previously considered to be a technically feasible and economically favourable BNR process.[3] In comparison with conventional nitrification and denitrification, several considerable advantages of PND have been reported: (1) reduction of the aeration consumption in the nitrification stage by 25%; (2) saving of the carbon substrate requirement in the denitrification stage by 40%; (3) a higher denitrification rate; (4) a lower wasted sludge production; and (5) reduction of the CO2 emission by 20%.[4] The key point of achieving nitrogen removal through PND via NO− 2 − N is to achieve efficient partial nitrification during autotrophic metabolism. The production rate of NO− 2 − N by AOB needs to be higher than the production − rate of NO− 3 − N by NOB so NO2 − N accumulation can be achieved. Thus, great efforts are required to encourage the activity of AOB and suppress the activity of NOB, which would be done by assuring favourable conditions for AOB development.[5] It is well known that the activity of AOB is
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Environmental Technology strongly influenced by the nature of nitrifying cultures and a variety of environmental factors, including substrate concentration, dissolved oxygen (DO), temperature, pH, sludge retention time (SRT), aeration pattern, and inhibitors.[6,7] Low DO, high temperature, high pH, high free ammonia, high nitrous acid and short SRT all likely contribute, to various degrees, to the inhibition or elimination of NOB and the accumulation of nitrite.[8] Due to the fact that the DO half-saturation coefficient of AOB is 0.2–0.4 mg/L while of NOB is 1. 2–1.5 mg/L, low oxygen level is more restrictive for the growth of NOB than AOB.[9] Tokutomi [10] observed that when the nitrifying reactor was operated at a DO concentration below 1.0 mg/L, the growth rate of AOB was 2.6 times faster than NOB. AOB have superior growth rates than NOB at high temperatures over 30◦ C, which is the idea behind the single reactor high activity ammonium removal over nitrite (SHARON) process. Generally, AOB only accounts for a very low fraction of the total bacteria population in the sludge;[11] however, in partial nitrification processes, AOB gradually outcompetes NOB, and can be the dominant population. Sinha and Annachhatre [12] observed that only 2–3% of nitrifiers existed in seed sludge, while there were 48–53% of AOB and 6–8% of NOB in the partial nitrification reactor. The intermittent aeration pattern has been proved to achieve PND via nitrite, resulting in reduced oxygen demand for ammonia removal and reduced organic substrate for denitrification.[13] By repeating suitable aeration and non-aeration periods over a certain time, nitrogen removal can be enhanced.[14] Due to maintenance energy demand and starvation recovery dynamics, it takes NOB a longer time to recover activity than AOB after switching the anaerobic/anoxic condition to the aerobic condition so nitrite can be accumulated.[15] Li et al. [6] found that in a long-term stable partial nitrification system based on the intermittent aeration concept AOB population and NOB population were up to 34% and 4.5% of EUB in the biomass. Temperature has a dramatic effect on the growth and activity of nitrifiers. When the temperature is over 25◦ C, AOB grow significantly faster than the NOBNitrobacter.[16] Thus, in the SHARON process, AOB grows faster than NOB with an unlimited substrate supply at high temperatures of 30–40◦ C. The annual average temperature in Ireland is 11◦ C, which is considered to inhibit nitrification and partial nitrification,[16] and as a consequence, PND would be not achievable. This has been observed by Norton et al. when using an intermittent aeration sequencing batch reactor (IASBR) technology to treat slaughterhouse wastewater on site at low temperatures (8–13◦ C).[17] Therefore, the aim of this study was to investigate the PND efficiencies of IASBR technology in treating slaughterhouse wastewater at 11◦ C and to build the relationship between the aeration conditions and PND efficiencies. Two cycle durations (8 and 12 h) and three aeration rates (0.4, 0.6, and 0.8 L air/min) were examined so as to obtain the optimal operation condition.
471
Materials and methods Slaughterhouse wastewater Raw slaughterhouse wastewater was collected from the WWTP of a local slaughterhouse in western Ireland and stored in the laboratory at 11◦ C for experiment use. The characteristics of the slaughterhouse wastewater are given in Table 1. Laboratory-scale IASBR systems Three identical IASBR reactors were set up in a laboratory where the temperature was controlled at 11◦ C. The three reactors were made from 12 L transparent Plexiglas columns with a diameter of 194 mm and a working volume of 8.0 L each. Two peristaltic pumps (323S, WalsonMarlow, UK) with two swivels were used, one feeding the wastewater into the three reactors and the other withdrawing the treated wastewater. Three mechanical stirrers with a rectangular paddle (100 × 80 mm) each were installed to mix the liquid in the reactors. The reactors were constantly stirred during the fill, non-aeration and aeration periods, while in the aeration periods air was supplied by air diffusers located at the bottom of the reactors. The sequential operation of the IASBR systems was controlled by a programmable logic controller (S7-CPU-224, Siemens, Germany). Operation of the IASBR systems This study lasted 150 days. The experiment consisted of two stages: in the first stage (Stage 1, Days 1–73), the duration of a SBR operational cycle was 8 h; in the second stage (Stage 2, Days 74–150), the duration of a SBR operation cycle was 12 h. In Stage 1, there were three cycles per day and each cycle comprised: fill (10 min), four alternating non-aeration (50 min)/aeration (50 min), settle (70 min), and draw/idle Table 1.
Characteristics of slaughterhouse wastewater. Stage 1
pH 7.8 ± 0.1 5032 ± 418 Alkalinity (CaCO3 ), mg/L SS, mg/L 1987 ± 205 Volatile suspended solids (VSS), 1717 ± 221 mg/L COD, mg/L 6193 ± 238 4214 ± 274 5-day biological oxygen demand (BOD5 ), mg/L Total organic carbon (TOC), 1434.6 ± 43 mg/L TN, mg/L 547 ± 22 TP, mg/L 47 ± 1 531 ± 15 Ammonium–nitrogen + ((NH+ 4 −N)NH4 − N), mg/L 31 ± 0.4 Phosphate–phosphorus (PO3− − P), mg/L 4
Stage 2 7.8 ± 0.1 5025 ± 425 1843 ± 280 1570 ± 208 6057 ± 173 4240 ± 271 1436 ± 43 576 ± 15 52 ± 3 565 ± 17 36 ± 1.3
472
M. Pan et al. Table 2. Probe
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
EUB338 NSO1225 NIT3 PAO651
Probes used in FISH analysis.[19] Sequence
Specificity
% formamide
GCTGCCTCCCGTAGGAGT CGCCATTGTATTACGTGTGA CCTGTGCTCCATGCTCCG CCCTCTGCCAAACTCCAG
General bacteria AOB (Beta-proteobacteria) NOB (Nitrobacter sp.) Rhodocyclus-related PAOs
20 35 40 35
(10 min) phases. In Stage 2, there were two cycles per day, each cycle comprising: fill (10 min), four alternating nonaeration (60 min)/aeration (100 min), settle (70 min), and draw/idle (10 min) phases. The IASBR reactors were seeded with 8.0 L return sludge taken from a local municipal WWTP. The initial mixed liquor suspended solids concentrations in the three reactors after seeding were 4.2 g/L. Three aeration rates of 0.4, 0.6, and 0.8 L air/min were employed in the aeration periods in the three IASBR reactors, one corresponding to each reactor. During Stage 1, in each cycle, 400 mL slaughterhouse wastewater was fed into the reactors. Everyday 1.2 L of slaughterhouse wastewater was treated, resulting in a hydraulic retention time (HRT) of 6.7 days. 400 mL of mixed liquor was withdrawn from each reactor every day just before the settle phase, keeping an SRT of about 20 days (if without consideration of solid loss due to the effluent withdrawal). The average influent chemical oxygen demand (COD) concentration was 6193 mg/L, giving an average organic loading rate of 0.93 g COD/(L d), while the average concentration of TN was 547 mg/L, giving an average TN loading rate of 82 mg TN/(L d). In Stage 2, 0.8 L of slaughterhouse wastewater was treated every day resulting in an HRT of 10 days. The SRT was kept about 20 days. The average organic loading rate and TN loading rate were 0.61 g COD/(L d) and 58 mg TN/(L d), respectively, which were close to COD and TN loading rates applied in the local slaughterhouse WWTP.
Analytical procedures − − 3− NH+ 4 − N, NO2 − N, NO3 − N, and PO4 − P were determined with a nutrient analyser (Konelab 20, Thermo Clinical Labsystems, USA). Total organic carbon (TOC), total nitrogen (TN), and total phosphorus (TP) were measured with a TOC TN TP Analyser (Biotector, Ireland). COD, BOD5 , suspended solids (SS), and VSS were examined following the standard APHA methods.[18] The DO concentration in the reactors was monitored by a multiple probe (HI9828, HANNA, Italy). The procedure of fluorescence in situ hybridization (FISH) analysis of activated sludge was adopted from that used by Wu et al.[19] CY3- or fluorescein-labelled oligonucleotide probes were used to specifically stain AOB, NOB and phosphate accumulating organisms (PAOs) as well as general bacteria (EUB) (Table 2). After Hybridization the
samples were observed on a Nikon epifluorescence microscope equipped with suitable filters and a digital imaging system (Nikon, Japan). The biomass fractions of AOB, NOB, and PAOs to general bacteria in sludge samples were evaluated by quantifying the area fraction of cells hybridized with the respective probes on at least 20 randomly distributed microscope images of each sample taken at 1000× magnification. Results and discussion Overall performance of IASBRs In Stage 1(Days 1–73), TN concentrations in effluent were 313.8 ± 2.7, 304.1 ± 2.0, and 296.2 ± 3.4 mg/L with average TN removal efficiencies of 42.7%, 44.4%, and 45.9% at the three aeration rates of 0.4, 0.6, and 0.8 L air/min, respectively (Figure 1(a)). The effluent NH+ 4 − N concentrations were up to 305.9 ± 2.2, 297.1 ± 2.4, and 285.6 ± 3.2 mg/L, respectively. The highest TP removal was observed at the aeration rate of 0.4 L air/min with an average removal efficiency of 42.8% (Figure 1(b)). TP removal was reduced when the aeration rate was increased. The COD concentrations in effluent were 906.7 ± 21.7, 893.1 ± 17.2, and 838.7 ± 20.4 mg/L at the three aeration rates with COD removals of 85.4%, 85.6%, and 86.5%, respectively (Figure 1(c)). High effluent COD concentrations suggested a longer aeration duration be required. In Stage 2 (Days 74–150), the SBR cycle duration was extended to 12 h and in a cycle each aeration period was extended to 100 min, leading to lower organic and TN loading rates in comparison with Stage 1. Table 3 displays the performance of IASBRs during pseudo-steady state in Stage 2. COD removal efficiencies were similar under the three aeration rates, and effluent COD concentrations met emission standards required by Irish EPA.[20] TN removal efficiencies were all over 92%, while effluent TN concentrations at the 0.4 L air/min aeration rate were above emission standards. At the aeration rate of 0.4 L air/min, effluent NH+ 4 − N concentrations varied a lot and were in the range of 14–87.5 mg/L (average 91.3% removal) during Days 108–113 and Days 120–135 because influent NH+ 4 − N concentrations were sharply increased to more than 670.0 mg/L. As a consequence, effluent TN concentrations varied in the range of 20.5–95.2 mg/L (Figure 1(a)). Unstable NH+ 4 − N and TN removals revealed that the system was sensitive to shock loadings at the aeration rate of 0.4 L air/min. TP was effectively removed at the aeration
Environmental Technology
473
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
of 0.4 L air/min, low TP removals at the aeration rate of 0.8 L air/min, and efficient nutrients removals maintained at the aeration rate of 0.6 L air/min, reveals that the aeration rate of 0.6 L air/min would be regarded as the optimal aeration rate for slaughterhouse wastewater treatment at 11◦ C.
Figure 1. Profile of TN (a), TP (b) and COD (c) in the effluent (, 0.4 L air/min; , 0.6 L air/min; , 0.8 L air/min).
rates of 0.4 and 0.6 L air/min, while effluent TP concentrations at the aeration rates of 0.8 L air/min did not meet the emission standards. This implies that lower aeration rates favoured TP removal. Among the three aeration rates, though COD was efficiently removed at the three aeration rates in Stage 2, unstable NH+ 4 − N and TN removals at the aeration rate
Microbial community analysis In this study, activated sludge samples were taken from reactors in the period of Days 115–148 in Stage 2 for FISH analysis. The results are illustrated in Figure 2(a). NSO1225 and NIT3 were used to stain Beta-proteobacteria sp. AOB and Nitrobacter sp. NOB, respectively (Table 2); both are widely found in wastewater treatment systems.[19] In Figure 2, AOB/EUB ratios changed slightly at the three aeration rates; AOB/EUB ratios of 12 ± 0.4% were detected at the aeration rate of 0.6 L air/min, which was close to the ratios of 8.5 ± 1.4% measured by Guo et al. [21] and 10 ± 5% observed by Xue et al.[22] This clearly shows that the intermittent aeration strategy was successful in enrichment of AOB at 11◦ C. The NOB/EUB ratios were increased with the increase in the aeration rate and the percentages of Nitrobacter sp. NOB in EUB were more than doubled at the aeration rate of 0.8 L air/min in comparison with those at the aeration rates of 0.4 and 0.6 L air/min. Higher DO concentrations encouraged NOB growth, and consequently increased nitrite conversion to nitrate. Higher enrichment of PAOs (PAOs/EUB of 9.2 ± 0.4% and 8.9 ± 0.5%, respectively) occurred at the aeration rates of 0.4 and 0.6 L air/min and only 2 ± 0.3% of PAOs/EUB was detected at the aeration rate of 0.8 L air/min. This can explain low phosphorus removals from slaughterhouse wastewater at 0.8 L air/min. High DO at high aeration rates disadvantaged PAOs enrichment, leading to depressed P removal through the enhanced biological phosphorus removal (EBPR) process.[23] One of significant advantages of intermittently aeration, comparing with continuous aeration, is gradient DO level during each aeration period, which seriously affects AOB and NOB quantity. Figure 3 illustrates typical profiles of DO at different aeration rates. At the aeration rate of 0.4 L air/min, average DO concentrations in the four aeration periods were 0.34, 0.52, 0.53, and 0.56 mg/L, respectively. When aeration rates were increased to 0.6 and 0.8 L air/min, average DO concentrations in the aeration periods were increased (Figure 3). Average DO concentrations in the four aeration periods were 0.38, 0.76, 1.46, and 2.4 mg/L at the aeration rate of 0.6 L air/min, respectively; while average DO concentrations in the four aeration periods were 0.89, 1.85, 4.86, and 5.71 mg/L at the aeration rate of 0.8 L air/min, respectively. This caused a slight change of the AOB population in the three aeration rates in this study. Figure 2(b) illustrates a negative linear correlation between the ratio of AOB/NOB in biomass, r, and aeration rates, A: r = −3.48A + 3.51
(R2 = 0.92).
(1)
474
M. Pan et al. Table 3.
Characteristics of IASBRs effluent at the three aeration rates in Stage 2. Discharge standarda
0.4 L air/min
0.6 L air/min
0.8 L air/min
SS COD
60 125–250 or >75% removal
Total NH+ 4 −N
10
TN
15–40 or >80% removal
TP
2–5 or >80% removal
21.3 ± 4.1b 133.8 ± 3.3 (97.8%)c 37.9 ± 7.1 (93.3%) 45.6 ± 5.1 (92.1%) 1.2 ± 0.1 (97.7%)
27.2 ± 5.5 115.2 ± 1.6 (98.1%) 1.2 ± 0.2 (99.8%) 13.3 ± 0.7 (97.7%) 1.3 ± 0.1 (97.5%)
21.9 ± 4.5 110.3 ± 1.6 (98.2%) 1.1 ± 0.2 (99.8%) 17 ± 2.1 (97.0%) 13 ± 0.7 (75.0%)
Parameter (mg/L)
a Discharge
standard.[20]
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
b Standard deviation. c Percentage removal.
(a)
(b)
Figure 3. Profiles of DO at different aeration rates during typical operation cycles (, 0.4 L air/min; ◦, 0.6 L air/min; , 0.8 L air/min).
favoured AOB growth and suppressed NOB. In addition, a low AOB growth rate at low temperature was overcome by using the intermittently aeration strategy.
Figure 2. Proportions of AOB, NOB, and PAOs to total bacteria (EUB) during Days 40–73(a), and correlation between the aeration rate and the ratio of AOB/NOB in biomass (b) (A: R1, 0.4 L air/min; R2, 0.6 L air/min; R3, 0.8 L air/min; , AOB/EUB; , NOB/EUB; , PAOs/EUB).
This indicates that a lower aeration rate favoured AOB enrichment, which agreed that a low oxygen level is more restrictive for the growth of NOB than AOB.[16] Thus, AOB enrichment can be achieved by applying the intermittent aeration strategy in this study; and a lower aeration rate
Cycle performance study A phase study of a typical operational cycle at the three aeration rates is showed in Figure 4. At the aeration of 0.4 L air/min, NH+ 4 − N was significantly reduced from the second aeration period and completely removed at the end of the fourth aeration period (Figure 4(a)). The NH+ 4 − N utilization rates (AUR) calculated were 0.35, 1.72, 1.29, and 1.05 mg NH+ 4 − N/g VSS·h in the four aera− N and NO− tion periods. NO− 2 3 − N concentrations were increased from the second aeration period and NO− 2 −N was the main nitrogen component in total oxidized nitrogen − (TON; NO− 2 − N + NO3 − N) over the operation cycle. At the aeration rate of 0.6 L air/min, a significant and rapid NH+ 4 − N oxidation took place in the third aeration period (Figure 4(b)), which was equal to 46% of the influent NH+ 4 − N concentration. The AUR values were 0.56, 1.15,
Environmental Technology
475
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
DO levels (Figure 4(c)) and NH+ 4 − N was completely removed at the beginning of the third aeration period. The AUR values were 2.08, 2.84, 0.35, and 0.05 mg NH+ 4 − N/g VSS·h in the four aeration periods, respectively. NO− 2 −N was completely converted to NO− 3 − N in the system and NO− 3 − N was the main nitrogen component in the effluent. According to FISH results, the high AOB populations were responsible for high ammonia removal in the three aeration rates. This indicates that ammonia oxidization was successfully achieved at 11◦ C. However, unstable NH+ 4 − N and TN removals in overall performance revealed the system at the aeration rate of 0.4 L air/min was sensitive to shock loadings, even though high ammonia oxidization rates were observed. Significant increase in NOB populations was observed with increasing the aeration rate, which resulted in increased DO levels in the three IASBRs. As a consequence, reduced nitrite accumulation occurred in the three IASBRs (Figure 4). Thus, higher AOB/NOB ratios in biomass at the aeration rates of 0.4 and 0.6 L air/min contributed to higher PN efficiencies than at the aeration rate of 0.8 L air/min. Nitrite accumulated in the aeration periods was reduced in the following non-aeration periods. The PND efficiency during non-aeration periods, describing denitrification via nitrite, can be calculated using Equation (2): 5 η = 5 i=1
− − Figure 4. Profiles of NH+ 4 − N, NO2 − N, NO3 − N, and 3− PO4 − P, during a typical operational cycle at the aeration rate of 0.4 L air/min (a), 0.6 L air/min (b), and 0.8 L air/min (c) (, − − 3− NH+ 4 − N; ◦, NO2 − N; , NO3 − N; ∇, PO4 − P;).
2.24, and 0.46 mg NH+ 4 − N/g VSS·h in the four aeration periods, respectively. NO− 2 − N was the main nitrogen component in TON over this cycle. At the aeration rate of 0.8 L air/min, efficient nitrification was achieved at high
i=1
SNO−2 −N
(SN2− −N + SN3− −N )
× 100%,
(2)
where η is PND efficiency, %; i represents each non-aeration period (including settle period) in a complete SBR operation cycle, in this study i = 1, 2, 3, 4, 5; SNO−2 −N was the amount of NO− 2 − N reduction during each non-aeration period; SNO−3 −N was the amount of NO− 3 − N reduction in each nonaeration period. At the aeration rate of 0.4 L air/min, in the five non-aeration periods, totally 99.1 mg TON was reduced by means of heterotrophic denitrification, calculated from − reduction of NO− 2 − N and NO3 − N, among which 75.8% − was due to NO2 − N reduction, indicating η was 75.8%. A higher AOB biomass in the activated sludge than NOB biomass (11 ± 0.5% of AOB/EUB and only 5.5 ± 0.4% of NOB/EUB) was responsible for NO− 2 − N accumulation in the system. At the aeration rate of 0.6 L air/min, 158.4 mg TON was reduced, and 70.0% of NO− 2 − N reduction in the five non-aeration periods (including settle), i.e. η = 70.0%; while at the aeration rate of 0.8 L air/min, 153.3 mg TON was reduced and η was only 25.4%. It indicated that PND effectively removed nitrogen at the aeration rates of 0.4 and 0.6 L air/min from slaughterhouse wastewater at 11◦ C. Meanwhile, all AOB genomes reported as far harbour the genes for denitrification.[24] Thus, the difference inactivity of AOB and NOB not only influenced the nitrite accumulation in IASBRs, but also influenced the PND efficiency. The PND efficiency, η, is observed to be dependent on the
476
M. Pan et al. Conclusion In this study, the intermittently aerated sequencing batch reactor (IASBR) technology was applied to treat high strength slaughterhouse wastewater at 11◦ C. Three aeration rates were investigated. Results obtained in this study are as follows:
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Figure 5. Correlation between the ratio of AOB/NOB in biomass and PND efficiency.
ratio of AOB/NOB, r (Figure 5): η = 37.8r + 4.0
(R2 = 0.96).
(3)
A positive linear relationship (R2 = 1) indicates that a higher ratio of AOB/NOB in biomass benefited denitrification via nitrite. The quantity of AOB population and NOB population controlled the end-point of ammonia oxidization, which is also seriously affected by the oxygen level. According to Equation (1), there was a negative correlation between the aeration rate and the ratio of AOB/NOB in biomass. Therefore, efficient PND can be achieved by designing the optimal aeration rate in engineering practice. Obvious phosphate release was observed in the first and second non-aeration periods at the aeration rate of 0.4 L air/min with about 27 mg P/L released in the first non-aeration period, and P uptake occurred in the second aeration period, indicating efficient P removal via EBPR (Figure 4(a)). The specific P release rates were 7.64 and 0.88 mg P release/g VSS·h in the first and second nonaeration periods, which can be explained by high PAOs contents in biomass (PAOs/EUB) of 9.2 ± 0.4%. However, phosphate release only happened in the first non-aeration period with PO3− 4 − P concentration rising from 0 to 15 mg/L at the aeration rate of 0.6 L air/min (Figure 4(b)). Phosphorous uptake took place in the first aeration period and was completed in the third aeration period. 8.9 ± 0.5% PAOs/EUB was responsible for the specific P release rate of 5.0 mg P release/g VSS·h in the first non-aeration period. Meanwhile, at the aeration rate of 0.8 L air/min, low levels of PAOs (PAOs/EUB = 2.4 ± 0.3%) were accumulated, resulting in poor EBPR performance. 14.5 mg/L of phosphorus was found in the effluent and the P removal efficiency was only 59.7% (Figure 4(c)). Thus, high PAOs enrichment was capable of efficient P removal through EBPR from strength slaughterhouse wastewater at the aeration rates of 0.4 and 0.6 L air/min, while EBPR was depressed at the aeration rate of 0.8 L air/min.
(1) Efficient AOB enrichment and NOB washout were achieved at lower aeration rates. The aeration rate affected the ratio of AOB/NOB in biomass adversely. (2) Comparing IASBR performance at the three aeration rates (0.4, 0.6 and 0.8 L air/min), the optimal aeration rate was 0.6 L air/min with efficient COD and nutrient removals. Removal efficiencies of COD, TN, and TP were up to 98.2%, 97.7%, and 96.4%, respectively. Long-term PND occurred at the aeration rates of 0.6 L air/min at 11◦ C. (3) Efficient EBPR was achieved at the aeration rates of 0.4 and 0.6 L air/min with high amounts of PAOs enriched. EBPR was depressed at the aeration rate of 0.8 L air/min. Funding The authors thank the financial support provided by the China Scholarship Council (CSC), the Department of Civil Engineering, NUI Galway, National High Technology Research and Development Program of China [grant number 2012AA06A304], and Science and Technology Project of Fujian Educational Department (B) [grant number JB11177].
References [1] Bayar S, Yildiz YS, Yilmaz AE, Irdemez S. The effect of stirring speed and current density on removal efficiency of poultry slaughterhouse wastewater by electocoagulation method. Desalination. 2011;280:103–107. [2] Lopez-Lopez A, Vallejo-Rodriguez R, Mendez-Romero DC. Evaluation of a combined anaerobic and aerobic system for the treatment of slaughterhouse wastewater. Environ Technol. 2010;31:319–326. [3] Yang Q, Peng Y, Liu X, Zeng W, Mino T, Satoh H. Nitrogen removal via nitrite from municipal wastewater at low temperature using real-time control to optimize nitrifying communities. Environ Sci Technol. 2007;41:8159–8164. [4] Kornaros M, Dokianakis SN, Lyberatos G. Partial nitrification/denitrification can be attributed to the slow response of nitrite oxidizing bacteria to periodic anoxic disturbances. Environ Sci Technol. 2010;44:7245–7253. [5] Ruiz G, Jeison D, Chamy R. Nitrification with high nitrite accumulation for the treatment of wastewater with high ammonia concentration. Water Res. 2003;37:1371–1377. [6] Li J, Elliott D, Nielsen M, Healy MG, Zhan X. Long-term partial nitrification in an intermittently aerated sequencing batch reactor (SBR) treating ammonium-rich wastewater under controlled oxygen-limited conditions. Biochem Eng J. 2011;55:215–222. [7] Yan J, Hu YY. Partial nitrification to nitrite for treating ammonium-rich organic wastewater by immobilized biomass system. Bioresour Technol. 2009;100:2341–2347.
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Environmental Technology [8] Lemaire R, Marcelino M, Yuan Z. Achieving the nitrite pathway using aeration phase length control and step-feed in an SBR removing nutrients from abattoir wastewater. Biotechnol Bioeng. 2008;100:1228– 1236. [9] Peng Y, Zhu G. Biological nitrogen removal with nitrification and denitrification via nitrite pathway. Appl Microbiol Biotechnol. 2006;73:15–26. [10] Tokutomi T. Operation of a nitrite-type airlift reactor at low DO concentration. Water Sci Technol. 2004;49: 81–88. [11] Rowan AK, Snape JR, Fearnside D, Barer MR, Curtis TP, Head IM. Composition and diversity of ammonia-oxidising bacterial communities in wastewater treatment reactors of different design treating identical wastewater. FEMS Microbiol Ecol. 2003;43:195–206. [12] Sinha B, Annachhatre AP. Assessment of partial nitrification reactor performance through microbial population shift using quinine profile, FISH and SEM. Bioresour Technol. 2007;98:3602–3610. [13] Mota C, Head MA, Ridenour JA, Cheng JJ, de los Reyes FL III. Effect of aeration cycles on nitrifying bacterial populations and nitrogen removal in intermittently aerated reactors. Appl Environ Microbiol. 2005;71:8565– 8572. [14] Kimochi Y, Inamori Y, Mizuochi M, Xu K, Matsumura M. Nitrogen removal and N2 O emission in a full-scale domestic wastewater treatment plant with intermittent aeration. J Ferment Bioeng. 1998;86:202–206. [15] Dytczak MA, Londry KL, Oleszkiewicz JA. Activated sludge operational regime has significant impact on the type of nitrifying community and its nitrification rates. Water Res. 2008;42:2320–2328.
477
[16] Philips S, Laanbroek HJ, Verstraete W. Origin, causes and effects of increased nitrite concentrations in aquatic environments. Rev Environ Sci Bio/Technol. 2002;1:115–141. [17] Norton D, Healy MG, Li J, Zhan X. Nitrogen removal from slaughterhouse wastewater using a pilot-scale sequencing batch reactor. 2nd IWA Specialized Conference Nutrient Management in Wastewater Treatment Processes; 2009; Krokow, Poland. [18] American Pubilc Health Association (APHA). Standard methods for the examination of water and wastewater. Washington, DC: APHA; 1995. [19] Wu G, Rodgers M, Zhan X. Nitrification in sequencing batch reactors with and without glucose addition at 11◦ C. Biochem Eng J. 2008;40:373–378. [20] Irish EPA. Draft BAT guidance note on best available techniques for slaughtering sector. Wexford: Irish EPA; 2006. [21] Guo JH, Peng YZ, Wang SY, Zheng YN, Huang HJ, Ge SJ. Effective and robust partial nitrification to nitrite by realtime aeration duration control in an SBR treating domestic wastewater. Process Biochem. 2009;44:979–985. [22] Xue Y, Yang F, Liu S, Fu Z. The influence of controlling factors on the start-up and operation for partial nitrification in membrane bioreactor. Bioresour Technology. 2009;100:1055–1060. [23] Bassin JP, Kleerebezem R, Dezotti M, van Loosdrecht MCM. Simultaneous nitrogen and phosphate removal in aerobic granular sludge reactors operated at different temperatures. Water Res. 2012;46:3805–3816. [24] Kim S, Miyahara M, Fushinobu S, Wakagi T, Shuoun H. Nitrous oxide emission from nitrifying activated sludge dependent on denitrification by ammonia oxidizing bacteria. Bioresour Technol. 2010;101:3958–3963.
Environmental Technology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tent20
Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11°C a
a
b
c
Min Pan , Liam Garry Henry , Rui Liu , Xiaoming Huang & Xinmin Zhan
a
a
Civil Engineering, College of Engineering and Informatics, National University of Ireland, Galway, Ireland b
Zhejiang Provincial Key Laboratory of Water Science and Technology, Department of Environment in Yangtze Delta Region Institute of Tsinghua University, Zhejiang, Jiaxing 314006, People's Republic of China c
Water Resources and Environmental Institute, Xiamen University of Technology, Xiamen 361024, People's Republic of China Accepted author version posted online: 20 Aug 2013.Published online: 23 Sep 2013.
To cite this article: Min Pan, Liam Garry Henry, Rui Liu, Xiaoming Huang & Xinmin Zhan (2014) Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11°C, Environmental Technology, 35:4, 470-477, DOI: 10.1080/09593330.2013.832336 To link to this article: http://dx.doi.org/10.1080/09593330.2013.832336
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Environmental Technology, 2014 Vol. 35, No. 4, 470–477, http://dx.doi.org/10.1080/09593330.2013.832336
Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11◦ C Min Pana , Liam Garry Henrya , Rui Liub , Xiaoming Huangc and Xinmin Zhana∗ Engineering, College of Engineering and Informatics, National University of Ireland, Galway, Ireland; b Zhejiang Provincial Key Laboratory of Water Science and Technology, Department of Environment in Yangtze Delta Region Institute of Tsinghua University, Zhejiang, Jiaxing 314006, People’s Republic of China; c Water Resources and Environmental Institute, Xiamen University of Technology, Xiamen 361024, People’s Republic of China
a Civil
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
(Received 9 May 2013; accepted 30 July 2013 ) This study is aimed to examine the removal of nitrogen from high strength slaughterhouse wastewater at 11◦ C via partial nitrification followed by denitrification (PND), using the intermittently aerated sequencing batch reactor (IASBR) technology. The slaughterhouse wastewater contained chemical oxygen demand (COD) of 6068 mg/L, total nitrogen (TN) of 571 mg/L, total phosphorus (TP) of 51 mg/L and suspended solids of 1.8 g/L, on average. The laboratory-scale IASBR reactors had a working volume of 8 L and was operated at an average organic loading rate of 0.61 g COD/(L·d). At the cycle duration of 12 h, COD was efficiently removed under three aeration rates of 0.4, 0.6 and 0.8 L air/min. Among the three aeration rates, the optimum aeration rate was 0.6 L air/min with removals of COD, TN, and TP of 98%, 98%, and 96%, respectively. The treated wastewater met the Irish emission standards. The microbial community analysis by fluorescence in situ hybridization shows 12 ± 0.4% of ammonium oxidizing bacteria, and 7.2 ± 0.4% of nitrite oxidizing bacteria in the general bacteria (EUB) in the activated sludge at the aeration rate of 0.6 L air/min, leading to efficient partial nitrification. PND effectively removed nitrogen from slaughterhouse wastewater at 11◦ C, but PND efficiency was dependent on the aeration rate applied. PND efficiencies were up to 75.8%, 70.1% and only 25.4% at the aeration rates of 0.4, 0.6, and 0.8 L air/min. Keywords: aeration rate; intermittent aeration; slaughterhouse wastewater; partial nitrification–denitrification; nitrite
Introduction A large amount of slaughterhouse wastewater is generated in meat product manufacturing due to the cleaning process. It contains high concentrations of organic matter, oil and grease, and nitrogenous compounds (proteins and amino acids).[1] Hence, its treatment before discharge is necessary for protection of the water environment. Slaughterhouses often discharge wastewater into municipal sewers after primary pretreatment, such as coagulation, flocculation, and air flotation, which is not sufficient, causing the municipal wastewater treatment plants (WWTPs) overloaded.[2] Given the high biodegradability of slaughterhouse wastewater, biological processes are considered to be suitable for organic matter removal from this type of wastewater. A typical biological nitrogen removal (BNR) process comprises autotrophic nitrification and heterotrophic denitrification. In the nitrification process, ammonium − (NH+ 4 − N) is firstly oxidized to nitrite (NO2 − N) by ammonia oxidizing bacteria (AOB), which is called nitri− tation, and then NO− 2 − N is oxidized to nitrate (NO3 − N) by nitrite oxidizing bacteria (NOB), which is called nitratation. During the denitrification process, NO− 3 − N is
∗ Corresponding
author. Email: [email protected]
© 2013 Taylor & Francis
reduced to nitrogen gas by denitrifiers. Based on the fact that NO− 2 − N is an intermediate product in both nitrification and denitrification, a shortcut nitrogen removal via nitrite, like partial nitrification followed by denitrification (PND), has been previously considered to be a technically feasible and economically favourable BNR process.[3] In comparison with conventional nitrification and denitrification, several considerable advantages of PND have been reported: (1) reduction of the aeration consumption in the nitrification stage by 25%; (2) saving of the carbon substrate requirement in the denitrification stage by 40%; (3) a higher denitrification rate; (4) a lower wasted sludge production; and (5) reduction of the CO2 emission by 20%.[4] The key point of achieving nitrogen removal through PND via NO− 2 − N is to achieve efficient partial nitrification during autotrophic metabolism. The production rate of NO− 2 − N by AOB needs to be higher than the production − rate of NO− 3 − N by NOB so NO2 − N accumulation can be achieved. Thus, great efforts are required to encourage the activity of AOB and suppress the activity of NOB, which would be done by assuring favourable conditions for AOB development.[5] It is well known that the activity of AOB is
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Environmental Technology strongly influenced by the nature of nitrifying cultures and a variety of environmental factors, including substrate concentration, dissolved oxygen (DO), temperature, pH, sludge retention time (SRT), aeration pattern, and inhibitors.[6,7] Low DO, high temperature, high pH, high free ammonia, high nitrous acid and short SRT all likely contribute, to various degrees, to the inhibition or elimination of NOB and the accumulation of nitrite.[8] Due to the fact that the DO half-saturation coefficient of AOB is 0.2–0.4 mg/L while of NOB is 1. 2–1.5 mg/L, low oxygen level is more restrictive for the growth of NOB than AOB.[9] Tokutomi [10] observed that when the nitrifying reactor was operated at a DO concentration below 1.0 mg/L, the growth rate of AOB was 2.6 times faster than NOB. AOB have superior growth rates than NOB at high temperatures over 30◦ C, which is the idea behind the single reactor high activity ammonium removal over nitrite (SHARON) process. Generally, AOB only accounts for a very low fraction of the total bacteria population in the sludge;[11] however, in partial nitrification processes, AOB gradually outcompetes NOB, and can be the dominant population. Sinha and Annachhatre [12] observed that only 2–3% of nitrifiers existed in seed sludge, while there were 48–53% of AOB and 6–8% of NOB in the partial nitrification reactor. The intermittent aeration pattern has been proved to achieve PND via nitrite, resulting in reduced oxygen demand for ammonia removal and reduced organic substrate for denitrification.[13] By repeating suitable aeration and non-aeration periods over a certain time, nitrogen removal can be enhanced.[14] Due to maintenance energy demand and starvation recovery dynamics, it takes NOB a longer time to recover activity than AOB after switching the anaerobic/anoxic condition to the aerobic condition so nitrite can be accumulated.[15] Li et al. [6] found that in a long-term stable partial nitrification system based on the intermittent aeration concept AOB population and NOB population were up to 34% and 4.5% of EUB in the biomass. Temperature has a dramatic effect on the growth and activity of nitrifiers. When the temperature is over 25◦ C, AOB grow significantly faster than the NOBNitrobacter.[16] Thus, in the SHARON process, AOB grows faster than NOB with an unlimited substrate supply at high temperatures of 30–40◦ C. The annual average temperature in Ireland is 11◦ C, which is considered to inhibit nitrification and partial nitrification,[16] and as a consequence, PND would be not achievable. This has been observed by Norton et al. when using an intermittent aeration sequencing batch reactor (IASBR) technology to treat slaughterhouse wastewater on site at low temperatures (8–13◦ C).[17] Therefore, the aim of this study was to investigate the PND efficiencies of IASBR technology in treating slaughterhouse wastewater at 11◦ C and to build the relationship between the aeration conditions and PND efficiencies. Two cycle durations (8 and 12 h) and three aeration rates (0.4, 0.6, and 0.8 L air/min) were examined so as to obtain the optimal operation condition.
471
Materials and methods Slaughterhouse wastewater Raw slaughterhouse wastewater was collected from the WWTP of a local slaughterhouse in western Ireland and stored in the laboratory at 11◦ C for experiment use. The characteristics of the slaughterhouse wastewater are given in Table 1. Laboratory-scale IASBR systems Three identical IASBR reactors were set up in a laboratory where the temperature was controlled at 11◦ C. The three reactors were made from 12 L transparent Plexiglas columns with a diameter of 194 mm and a working volume of 8.0 L each. Two peristaltic pumps (323S, WalsonMarlow, UK) with two swivels were used, one feeding the wastewater into the three reactors and the other withdrawing the treated wastewater. Three mechanical stirrers with a rectangular paddle (100 × 80 mm) each were installed to mix the liquid in the reactors. The reactors were constantly stirred during the fill, non-aeration and aeration periods, while in the aeration periods air was supplied by air diffusers located at the bottom of the reactors. The sequential operation of the IASBR systems was controlled by a programmable logic controller (S7-CPU-224, Siemens, Germany). Operation of the IASBR systems This study lasted 150 days. The experiment consisted of two stages: in the first stage (Stage 1, Days 1–73), the duration of a SBR operational cycle was 8 h; in the second stage (Stage 2, Days 74–150), the duration of a SBR operation cycle was 12 h. In Stage 1, there were three cycles per day and each cycle comprised: fill (10 min), four alternating non-aeration (50 min)/aeration (50 min), settle (70 min), and draw/idle Table 1.
Characteristics of slaughterhouse wastewater. Stage 1
pH 7.8 ± 0.1 5032 ± 418 Alkalinity (CaCO3 ), mg/L SS, mg/L 1987 ± 205 Volatile suspended solids (VSS), 1717 ± 221 mg/L COD, mg/L 6193 ± 238 4214 ± 274 5-day biological oxygen demand (BOD5 ), mg/L Total organic carbon (TOC), 1434.6 ± 43 mg/L TN, mg/L 547 ± 22 TP, mg/L 47 ± 1 531 ± 15 Ammonium–nitrogen + ((NH+ 4 −N)NH4 − N), mg/L 31 ± 0.4 Phosphate–phosphorus (PO3− − P), mg/L 4
Stage 2 7.8 ± 0.1 5025 ± 425 1843 ± 280 1570 ± 208 6057 ± 173 4240 ± 271 1436 ± 43 576 ± 15 52 ± 3 565 ± 17 36 ± 1.3
472
M. Pan et al. Table 2. Probe
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
EUB338 NSO1225 NIT3 PAO651
Probes used in FISH analysis.[19] Sequence
Specificity
% formamide
GCTGCCTCCCGTAGGAGT CGCCATTGTATTACGTGTGA CCTGTGCTCCATGCTCCG CCCTCTGCCAAACTCCAG
General bacteria AOB (Beta-proteobacteria) NOB (Nitrobacter sp.) Rhodocyclus-related PAOs
20 35 40 35
(10 min) phases. In Stage 2, there were two cycles per day, each cycle comprising: fill (10 min), four alternating nonaeration (60 min)/aeration (100 min), settle (70 min), and draw/idle (10 min) phases. The IASBR reactors were seeded with 8.0 L return sludge taken from a local municipal WWTP. The initial mixed liquor suspended solids concentrations in the three reactors after seeding were 4.2 g/L. Three aeration rates of 0.4, 0.6, and 0.8 L air/min were employed in the aeration periods in the three IASBR reactors, one corresponding to each reactor. During Stage 1, in each cycle, 400 mL slaughterhouse wastewater was fed into the reactors. Everyday 1.2 L of slaughterhouse wastewater was treated, resulting in a hydraulic retention time (HRT) of 6.7 days. 400 mL of mixed liquor was withdrawn from each reactor every day just before the settle phase, keeping an SRT of about 20 days (if without consideration of solid loss due to the effluent withdrawal). The average influent chemical oxygen demand (COD) concentration was 6193 mg/L, giving an average organic loading rate of 0.93 g COD/(L d), while the average concentration of TN was 547 mg/L, giving an average TN loading rate of 82 mg TN/(L d). In Stage 2, 0.8 L of slaughterhouse wastewater was treated every day resulting in an HRT of 10 days. The SRT was kept about 20 days. The average organic loading rate and TN loading rate were 0.61 g COD/(L d) and 58 mg TN/(L d), respectively, which were close to COD and TN loading rates applied in the local slaughterhouse WWTP.
Analytical procedures − − 3− NH+ 4 − N, NO2 − N, NO3 − N, and PO4 − P were determined with a nutrient analyser (Konelab 20, Thermo Clinical Labsystems, USA). Total organic carbon (TOC), total nitrogen (TN), and total phosphorus (TP) were measured with a TOC TN TP Analyser (Biotector, Ireland). COD, BOD5 , suspended solids (SS), and VSS were examined following the standard APHA methods.[18] The DO concentration in the reactors was monitored by a multiple probe (HI9828, HANNA, Italy). The procedure of fluorescence in situ hybridization (FISH) analysis of activated sludge was adopted from that used by Wu et al.[19] CY3- or fluorescein-labelled oligonucleotide probes were used to specifically stain AOB, NOB and phosphate accumulating organisms (PAOs) as well as general bacteria (EUB) (Table 2). After Hybridization the
samples were observed on a Nikon epifluorescence microscope equipped with suitable filters and a digital imaging system (Nikon, Japan). The biomass fractions of AOB, NOB, and PAOs to general bacteria in sludge samples were evaluated by quantifying the area fraction of cells hybridized with the respective probes on at least 20 randomly distributed microscope images of each sample taken at 1000× magnification. Results and discussion Overall performance of IASBRs In Stage 1(Days 1–73), TN concentrations in effluent were 313.8 ± 2.7, 304.1 ± 2.0, and 296.2 ± 3.4 mg/L with average TN removal efficiencies of 42.7%, 44.4%, and 45.9% at the three aeration rates of 0.4, 0.6, and 0.8 L air/min, respectively (Figure 1(a)). The effluent NH+ 4 − N concentrations were up to 305.9 ± 2.2, 297.1 ± 2.4, and 285.6 ± 3.2 mg/L, respectively. The highest TP removal was observed at the aeration rate of 0.4 L air/min with an average removal efficiency of 42.8% (Figure 1(b)). TP removal was reduced when the aeration rate was increased. The COD concentrations in effluent were 906.7 ± 21.7, 893.1 ± 17.2, and 838.7 ± 20.4 mg/L at the three aeration rates with COD removals of 85.4%, 85.6%, and 86.5%, respectively (Figure 1(c)). High effluent COD concentrations suggested a longer aeration duration be required. In Stage 2 (Days 74–150), the SBR cycle duration was extended to 12 h and in a cycle each aeration period was extended to 100 min, leading to lower organic and TN loading rates in comparison with Stage 1. Table 3 displays the performance of IASBRs during pseudo-steady state in Stage 2. COD removal efficiencies were similar under the three aeration rates, and effluent COD concentrations met emission standards required by Irish EPA.[20] TN removal efficiencies were all over 92%, while effluent TN concentrations at the 0.4 L air/min aeration rate were above emission standards. At the aeration rate of 0.4 L air/min, effluent NH+ 4 − N concentrations varied a lot and were in the range of 14–87.5 mg/L (average 91.3% removal) during Days 108–113 and Days 120–135 because influent NH+ 4 − N concentrations were sharply increased to more than 670.0 mg/L. As a consequence, effluent TN concentrations varied in the range of 20.5–95.2 mg/L (Figure 1(a)). Unstable NH+ 4 − N and TN removals revealed that the system was sensitive to shock loadings at the aeration rate of 0.4 L air/min. TP was effectively removed at the aeration
Environmental Technology
473
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
of 0.4 L air/min, low TP removals at the aeration rate of 0.8 L air/min, and efficient nutrients removals maintained at the aeration rate of 0.6 L air/min, reveals that the aeration rate of 0.6 L air/min would be regarded as the optimal aeration rate for slaughterhouse wastewater treatment at 11◦ C.
Figure 1. Profile of TN (a), TP (b) and COD (c) in the effluent (, 0.4 L air/min; , 0.6 L air/min; , 0.8 L air/min).
rates of 0.4 and 0.6 L air/min, while effluent TP concentrations at the aeration rates of 0.8 L air/min did not meet the emission standards. This implies that lower aeration rates favoured TP removal. Among the three aeration rates, though COD was efficiently removed at the three aeration rates in Stage 2, unstable NH+ 4 − N and TN removals at the aeration rate
Microbial community analysis In this study, activated sludge samples were taken from reactors in the period of Days 115–148 in Stage 2 for FISH analysis. The results are illustrated in Figure 2(a). NSO1225 and NIT3 were used to stain Beta-proteobacteria sp. AOB and Nitrobacter sp. NOB, respectively (Table 2); both are widely found in wastewater treatment systems.[19] In Figure 2, AOB/EUB ratios changed slightly at the three aeration rates; AOB/EUB ratios of 12 ± 0.4% were detected at the aeration rate of 0.6 L air/min, which was close to the ratios of 8.5 ± 1.4% measured by Guo et al. [21] and 10 ± 5% observed by Xue et al.[22] This clearly shows that the intermittent aeration strategy was successful in enrichment of AOB at 11◦ C. The NOB/EUB ratios were increased with the increase in the aeration rate and the percentages of Nitrobacter sp. NOB in EUB were more than doubled at the aeration rate of 0.8 L air/min in comparison with those at the aeration rates of 0.4 and 0.6 L air/min. Higher DO concentrations encouraged NOB growth, and consequently increased nitrite conversion to nitrate. Higher enrichment of PAOs (PAOs/EUB of 9.2 ± 0.4% and 8.9 ± 0.5%, respectively) occurred at the aeration rates of 0.4 and 0.6 L air/min and only 2 ± 0.3% of PAOs/EUB was detected at the aeration rate of 0.8 L air/min. This can explain low phosphorus removals from slaughterhouse wastewater at 0.8 L air/min. High DO at high aeration rates disadvantaged PAOs enrichment, leading to depressed P removal through the enhanced biological phosphorus removal (EBPR) process.[23] One of significant advantages of intermittently aeration, comparing with continuous aeration, is gradient DO level during each aeration period, which seriously affects AOB and NOB quantity. Figure 3 illustrates typical profiles of DO at different aeration rates. At the aeration rate of 0.4 L air/min, average DO concentrations in the four aeration periods were 0.34, 0.52, 0.53, and 0.56 mg/L, respectively. When aeration rates were increased to 0.6 and 0.8 L air/min, average DO concentrations in the aeration periods were increased (Figure 3). Average DO concentrations in the four aeration periods were 0.38, 0.76, 1.46, and 2.4 mg/L at the aeration rate of 0.6 L air/min, respectively; while average DO concentrations in the four aeration periods were 0.89, 1.85, 4.86, and 5.71 mg/L at the aeration rate of 0.8 L air/min, respectively. This caused a slight change of the AOB population in the three aeration rates in this study. Figure 2(b) illustrates a negative linear correlation between the ratio of AOB/NOB in biomass, r, and aeration rates, A: r = −3.48A + 3.51
(R2 = 0.92).
(1)
474
M. Pan et al. Table 3.
Characteristics of IASBRs effluent at the three aeration rates in Stage 2. Discharge standarda
0.4 L air/min
0.6 L air/min
0.8 L air/min
SS COD
60 125–250 or >75% removal
Total NH+ 4 −N
10
TN
15–40 or >80% removal
TP
2–5 or >80% removal
21.3 ± 4.1b 133.8 ± 3.3 (97.8%)c 37.9 ± 7.1 (93.3%) 45.6 ± 5.1 (92.1%) 1.2 ± 0.1 (97.7%)
27.2 ± 5.5 115.2 ± 1.6 (98.1%) 1.2 ± 0.2 (99.8%) 13.3 ± 0.7 (97.7%) 1.3 ± 0.1 (97.5%)
21.9 ± 4.5 110.3 ± 1.6 (98.2%) 1.1 ± 0.2 (99.8%) 17 ± 2.1 (97.0%) 13 ± 0.7 (75.0%)
Parameter (mg/L)
a Discharge
standard.[20]
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
b Standard deviation. c Percentage removal.
(a)
(b)
Figure 3. Profiles of DO at different aeration rates during typical operation cycles (, 0.4 L air/min; ◦, 0.6 L air/min; , 0.8 L air/min).
favoured AOB growth and suppressed NOB. In addition, a low AOB growth rate at low temperature was overcome by using the intermittently aeration strategy.
Figure 2. Proportions of AOB, NOB, and PAOs to total bacteria (EUB) during Days 40–73(a), and correlation between the aeration rate and the ratio of AOB/NOB in biomass (b) (A: R1, 0.4 L air/min; R2, 0.6 L air/min; R3, 0.8 L air/min; , AOB/EUB; , NOB/EUB; , PAOs/EUB).
This indicates that a lower aeration rate favoured AOB enrichment, which agreed that a low oxygen level is more restrictive for the growth of NOB than AOB.[16] Thus, AOB enrichment can be achieved by applying the intermittent aeration strategy in this study; and a lower aeration rate
Cycle performance study A phase study of a typical operational cycle at the three aeration rates is showed in Figure 4. At the aeration of 0.4 L air/min, NH+ 4 − N was significantly reduced from the second aeration period and completely removed at the end of the fourth aeration period (Figure 4(a)). The NH+ 4 − N utilization rates (AUR) calculated were 0.35, 1.72, 1.29, and 1.05 mg NH+ 4 − N/g VSS·h in the four aera− N and NO− tion periods. NO− 2 3 − N concentrations were increased from the second aeration period and NO− 2 −N was the main nitrogen component in total oxidized nitrogen − (TON; NO− 2 − N + NO3 − N) over the operation cycle. At the aeration rate of 0.6 L air/min, a significant and rapid NH+ 4 − N oxidation took place in the third aeration period (Figure 4(b)), which was equal to 46% of the influent NH+ 4 − N concentration. The AUR values were 0.56, 1.15,
Environmental Technology
475
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
DO levels (Figure 4(c)) and NH+ 4 − N was completely removed at the beginning of the third aeration period. The AUR values were 2.08, 2.84, 0.35, and 0.05 mg NH+ 4 − N/g VSS·h in the four aeration periods, respectively. NO− 2 −N was completely converted to NO− 3 − N in the system and NO− 3 − N was the main nitrogen component in the effluent. According to FISH results, the high AOB populations were responsible for high ammonia removal in the three aeration rates. This indicates that ammonia oxidization was successfully achieved at 11◦ C. However, unstable NH+ 4 − N and TN removals in overall performance revealed the system at the aeration rate of 0.4 L air/min was sensitive to shock loadings, even though high ammonia oxidization rates were observed. Significant increase in NOB populations was observed with increasing the aeration rate, which resulted in increased DO levels in the three IASBRs. As a consequence, reduced nitrite accumulation occurred in the three IASBRs (Figure 4). Thus, higher AOB/NOB ratios in biomass at the aeration rates of 0.4 and 0.6 L air/min contributed to higher PN efficiencies than at the aeration rate of 0.8 L air/min. Nitrite accumulated in the aeration periods was reduced in the following non-aeration periods. The PND efficiency during non-aeration periods, describing denitrification via nitrite, can be calculated using Equation (2): 5 η = 5 i=1
− − Figure 4. Profiles of NH+ 4 − N, NO2 − N, NO3 − N, and 3− PO4 − P, during a typical operational cycle at the aeration rate of 0.4 L air/min (a), 0.6 L air/min (b), and 0.8 L air/min (c) (, − − 3− NH+ 4 − N; ◦, NO2 − N; , NO3 − N; ∇, PO4 − P;).
2.24, and 0.46 mg NH+ 4 − N/g VSS·h in the four aeration periods, respectively. NO− 2 − N was the main nitrogen component in TON over this cycle. At the aeration rate of 0.8 L air/min, efficient nitrification was achieved at high
i=1
SNO−2 −N
(SN2− −N + SN3− −N )
× 100%,
(2)
where η is PND efficiency, %; i represents each non-aeration period (including settle period) in a complete SBR operation cycle, in this study i = 1, 2, 3, 4, 5; SNO−2 −N was the amount of NO− 2 − N reduction during each non-aeration period; SNO−3 −N was the amount of NO− 3 − N reduction in each nonaeration period. At the aeration rate of 0.4 L air/min, in the five non-aeration periods, totally 99.1 mg TON was reduced by means of heterotrophic denitrification, calculated from − reduction of NO− 2 − N and NO3 − N, among which 75.8% − was due to NO2 − N reduction, indicating η was 75.8%. A higher AOB biomass in the activated sludge than NOB biomass (11 ± 0.5% of AOB/EUB and only 5.5 ± 0.4% of NOB/EUB) was responsible for NO− 2 − N accumulation in the system. At the aeration rate of 0.6 L air/min, 158.4 mg TON was reduced, and 70.0% of NO− 2 − N reduction in the five non-aeration periods (including settle), i.e. η = 70.0%; while at the aeration rate of 0.8 L air/min, 153.3 mg TON was reduced and η was only 25.4%. It indicated that PND effectively removed nitrogen at the aeration rates of 0.4 and 0.6 L air/min from slaughterhouse wastewater at 11◦ C. Meanwhile, all AOB genomes reported as far harbour the genes for denitrification.[24] Thus, the difference inactivity of AOB and NOB not only influenced the nitrite accumulation in IASBRs, but also influenced the PND efficiency. The PND efficiency, η, is observed to be dependent on the
476
M. Pan et al. Conclusion In this study, the intermittently aerated sequencing batch reactor (IASBR) technology was applied to treat high strength slaughterhouse wastewater at 11◦ C. Three aeration rates were investigated. Results obtained in this study are as follows:
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Figure 5. Correlation between the ratio of AOB/NOB in biomass and PND efficiency.
ratio of AOB/NOB, r (Figure 5): η = 37.8r + 4.0
(R2 = 0.96).
(3)
A positive linear relationship (R2 = 1) indicates that a higher ratio of AOB/NOB in biomass benefited denitrification via nitrite. The quantity of AOB population and NOB population controlled the end-point of ammonia oxidization, which is also seriously affected by the oxygen level. According to Equation (1), there was a negative correlation between the aeration rate and the ratio of AOB/NOB in biomass. Therefore, efficient PND can be achieved by designing the optimal aeration rate in engineering practice. Obvious phosphate release was observed in the first and second non-aeration periods at the aeration rate of 0.4 L air/min with about 27 mg P/L released in the first non-aeration period, and P uptake occurred in the second aeration period, indicating efficient P removal via EBPR (Figure 4(a)). The specific P release rates were 7.64 and 0.88 mg P release/g VSS·h in the first and second nonaeration periods, which can be explained by high PAOs contents in biomass (PAOs/EUB) of 9.2 ± 0.4%. However, phosphate release only happened in the first non-aeration period with PO3− 4 − P concentration rising from 0 to 15 mg/L at the aeration rate of 0.6 L air/min (Figure 4(b)). Phosphorous uptake took place in the first aeration period and was completed in the third aeration period. 8.9 ± 0.5% PAOs/EUB was responsible for the specific P release rate of 5.0 mg P release/g VSS·h in the first non-aeration period. Meanwhile, at the aeration rate of 0.8 L air/min, low levels of PAOs (PAOs/EUB = 2.4 ± 0.3%) were accumulated, resulting in poor EBPR performance. 14.5 mg/L of phosphorus was found in the effluent and the P removal efficiency was only 59.7% (Figure 4(c)). Thus, high PAOs enrichment was capable of efficient P removal through EBPR from strength slaughterhouse wastewater at the aeration rates of 0.4 and 0.6 L air/min, while EBPR was depressed at the aeration rate of 0.8 L air/min.
(1) Efficient AOB enrichment and NOB washout were achieved at lower aeration rates. The aeration rate affected the ratio of AOB/NOB in biomass adversely. (2) Comparing IASBR performance at the three aeration rates (0.4, 0.6 and 0.8 L air/min), the optimal aeration rate was 0.6 L air/min with efficient COD and nutrient removals. Removal efficiencies of COD, TN, and TP were up to 98.2%, 97.7%, and 96.4%, respectively. Long-term PND occurred at the aeration rates of 0.6 L air/min at 11◦ C. (3) Efficient EBPR was achieved at the aeration rates of 0.4 and 0.6 L air/min with high amounts of PAOs enriched. EBPR was depressed at the aeration rate of 0.8 L air/min. Funding The authors thank the financial support provided by the China Scholarship Council (CSC), the Department of Civil Engineering, NUI Galway, National High Technology Research and Development Program of China [grant number 2012AA06A304], and Science and Technology Project of Fujian Educational Department (B) [grant number JB11177].
References [1] Bayar S, Yildiz YS, Yilmaz AE, Irdemez S. The effect of stirring speed and current density on removal efficiency of poultry slaughterhouse wastewater by electocoagulation method. Desalination. 2011;280:103–107. [2] Lopez-Lopez A, Vallejo-Rodriguez R, Mendez-Romero DC. Evaluation of a combined anaerobic and aerobic system for the treatment of slaughterhouse wastewater. Environ Technol. 2010;31:319–326. [3] Yang Q, Peng Y, Liu X, Zeng W, Mino T, Satoh H. Nitrogen removal via nitrite from municipal wastewater at low temperature using real-time control to optimize nitrifying communities. Environ Sci Technol. 2007;41:8159–8164. [4] Kornaros M, Dokianakis SN, Lyberatos G. Partial nitrification/denitrification can be attributed to the slow response of nitrite oxidizing bacteria to periodic anoxic disturbances. Environ Sci Technol. 2010;44:7245–7253. [5] Ruiz G, Jeison D, Chamy R. Nitrification with high nitrite accumulation for the treatment of wastewater with high ammonia concentration. Water Res. 2003;37:1371–1377. [6] Li J, Elliott D, Nielsen M, Healy MG, Zhan X. Long-term partial nitrification in an intermittently aerated sequencing batch reactor (SBR) treating ammonium-rich wastewater under controlled oxygen-limited conditions. Biochem Eng J. 2011;55:215–222. [7] Yan J, Hu YY. Partial nitrification to nitrite for treating ammonium-rich organic wastewater by immobilized biomass system. Bioresour Technol. 2009;100:2341–2347.
Downloaded by [Thammasat University Libraries] at 13:18 09 October 2014
Environmental Technology [8] Lemaire R, Marcelino M, Yuan Z. Achieving the nitrite pathway using aeration phase length control and step-feed in an SBR removing nutrients from abattoir wastewater. Biotechnol Bioeng. 2008;100:1228– 1236. [9] Peng Y, Zhu G. Biological nitrogen removal with nitrification and denitrification via nitrite pathway. Appl Microbiol Biotechnol. 2006;73:15–26. [10] Tokutomi T. Operation of a nitrite-type airlift reactor at low DO concentration. Water Sci Technol. 2004;49: 81–88. [11] Rowan AK, Snape JR, Fearnside D, Barer MR, Curtis TP, Head IM. Composition and diversity of ammonia-oxidising bacterial communities in wastewater treatment reactors of different design treating identical wastewater. FEMS Microbiol Ecol. 2003;43:195–206. [12] Sinha B, Annachhatre AP. Assessment of partial nitrification reactor performance through microbial population shift using quinine profile, FISH and SEM. Bioresour Technol. 2007;98:3602–3610. [13] Mota C, Head MA, Ridenour JA, Cheng JJ, de los Reyes FL III. Effect of aeration cycles on nitrifying bacterial populations and nitrogen removal in intermittently aerated reactors. Appl Environ Microbiol. 2005;71:8565– 8572. [14] Kimochi Y, Inamori Y, Mizuochi M, Xu K, Matsumura M. Nitrogen removal and N2 O emission in a full-scale domestic wastewater treatment plant with intermittent aeration. J Ferment Bioeng. 1998;86:202–206. [15] Dytczak MA, Londry KL, Oleszkiewicz JA. Activated sludge operational regime has significant impact on the type of nitrifying community and its nitrification rates. Water Res. 2008;42:2320–2328.
477
[16] Philips S, Laanbroek HJ, Verstraete W. Origin, causes and effects of increased nitrite concentrations in aquatic environments. Rev Environ Sci Bio/Technol. 2002;1:115–141. [17] Norton D, Healy MG, Li J, Zhan X. Nitrogen removal from slaughterhouse wastewater using a pilot-scale sequencing batch reactor. 2nd IWA Specialized Conference Nutrient Management in Wastewater Treatment Processes; 2009; Krokow, Poland. [18] American Pubilc Health Association (APHA). Standard methods for the examination of water and wastewater. Washington, DC: APHA; 1995. [19] Wu G, Rodgers M, Zhan X. Nitrification in sequencing batch reactors with and without glucose addition at 11◦ C. Biochem Eng J. 2008;40:373–378. [20] Irish EPA. Draft BAT guidance note on best available techniques for slaughtering sector. Wexford: Irish EPA; 2006. [21] Guo JH, Peng YZ, Wang SY, Zheng YN, Huang HJ, Ge SJ. Effective and robust partial nitrification to nitrite by realtime aeration duration control in an SBR treating domestic wastewater. Process Biochem. 2009;44:979–985. [22] Xue Y, Yang F, Liu S, Fu Z. The influence of controlling factors on the start-up and operation for partial nitrification in membrane bioreactor. Bioresour Technology. 2009;100:1055–1060. [23] Bassin JP, Kleerebezem R, Dezotti M, van Loosdrecht MCM. Simultaneous nitrogen and phosphate removal in aerobic granular sludge reactors operated at different temperatures. Water Res. 2012;46:3805–3816. [24] Kim S, Miyahara M, Fushinobu S, Wakagi T, Shuoun H. Nitrous oxide emission from nitrifying activated sludge dependent on denitrification by ammonia oxidizing bacteria. Bioresour Technol. 2010;101:3958–3963.
