Acta Histochemica 116 (2014) 1119–1124
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
NLRP3 inflammasome is required for apoptosis of Aggregatibacter actinomycetemcomitans-infected human osteoblastic MG63 cells Panyu Zhao a , Junchao Liu b , Chunling Pan b , Yaping Pan b,∗ a b
Department of Pediatric Dentistry, School of Stomatology, China Medical University, Shenyang 110001, People’s Republic of China Department of Oral Biology and Periodontics, School of Stomatology, China Medical University, Shenyang 110001, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 11 March 2014 Received in revised form 25 May 2014 Accepted 26 May 2014 Keywords: NLRP3 Inflammasome Aggregatibacter actinomycetemcomitans Apoptosis Osteoblasts
a b s t r a c t Aggregatibacter actinomycetemcomitans (A. actinomycetemcomitans) is a Gram-negative bacterium which is implicated in the pathogenesis of human periodontal disease and in particular aggressive periodontitis. Virulence factors from A. actinomycetemcomitans have been shown to induce apoptosis of osteoblasts, however, the underlying mechanisms of the induction of apoptosis are poorly understood. In the present study, the infection of A. actinomycetemcomitans in human osteoblastic MG63 cells was established. Accordingly, A. actinomycetemcomitans infection enhanced significant apoptosis of MG63 cells. We found that both expression levels of NLRP3 and ASC were increased dramatically after MG63 cell cultures exposed to A. actinomycetemcomitans. Moreover, the secretion of mature interleukin-1 (IL-1) and IL18 were extensively induced in A. actinomycetemcomitans-infected cells as compared with non-invasion group of MG63 cell cultures, indicating the activation of the NLRP3 inflammasome during infection. Finally, we found that the knockdown expression of NLRP3 by specific small interfering RNA (siRNA) attenuated apoptosis of A. actinomycetemcomitans-infected MG63 cells. Our data suggest that A. actinomycetemcomitans promotes apoptosis of human osteoblasts at least partially through the NLRP3 inflammasome. © 2014 Elsevier GmbH. All rights reserved.
Introduction Aggregatibacter actinomycetemcomitans (A. actinomycetemcomitans), a Gram-negative bacterium, has been implicated in the pathogenesis of aggressive periodontitis (Schacher et al., 2007; Tomita et al., 2013). This form of periodontal disease is characterized by severe periodontal destruction and alveolar bone loss (Pihlstrom et al., 2005). The inflammatory response triggered by A. actinomycetemcomitans infection results in tissue damage as well as alveolar bone loss (Kang et al., 2012). The extracts or products of A. actinomycetemcomitans have been demonstrated to induce apoptotic cell death in osteoblasts, such as human osteoblastic MG63 cells (Morimoto et al., 1999) and mouse osteoblastic MC3T3-E1 cells (Yamamoto et al., 1999). However, the molecular mechanisms underlying the induction of apoptosis in A. actinomycetemcomitansinfected osteoblasts remain elusive.
∗ Corresponding author at: Department of Oral Biology and Periodontics, School of Stomatology, China Medical University, 117 North Nanjing Street, Shenyang 110001, People’s Republic of China. E-mail address: [email protected] (Y. Pan). http://dx.doi.org/10.1016/j.acthis.2014.05.008 0065-1281/© 2014 Elsevier GmbH. All rights reserved.
The NLRP3 (NOD-like receptor protein 3) inflammasome is a multiprotein complex composed of NLRP3 (also known as NALP3), ASC (apoptosis-associated speck-like protein containing a CARD), Cardinal and caspase-1 (Cassel et al., 2009; Schroder and Tschopp, 2010). This type of inflammasome activates caspase-1 which, in turn, cleaves the precursors of IL-1 and IL-18, and eventually leads to the secretion of mature inflammatory factors (Franchi and Nunez, 2008; van de Veerdonk et al., 2011). It has been demonstrated that the NLRP3 inflammasome plays a crucial role in inflammatory periodontal disease and in the induction of cell death in response to viral infection (Gumucio et al., 2002; Mariathasan et al., 2006). McCall et al. (2008) showed that the functional expression of NLRP3 is required for apoptotic cell death of osteoblasts after challenge with Salmonella (McCall et al., 2008). Moreover, A. actinomycetemcomitans infection enhances NLRP3 inflammasome expression and increases the levels of IL-1 and IL-18 (Belibasakis and Johansson, 2012). Based on these observations, we hypothesized that apoptosis in A. actinomycetemcomitans-infected human osteoblastic MG63 cells is induced by the activation of NLRP3 inflammasome. To test this, we first established the infection of A. actinomycetemcomitans in MG63 cells. The induction of apoptosis after exposure to A. actinomycetemcomitans was accessed by Hoechst staining and
1120
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
flow cytometry. Our results showed that A. actinomycetemcomitans infection promotes apoptosis and enhances NLRP3 inflammasome expression in MG63 cells. Furthermore, down-regulation of NLRP3 by small interfering RNA (siRNA) inhibited the induction of apoptosis in A. actinomycetemcomitans-infected MG63 cells.
(Bioneer, Daejeon, Korea). Primers are CTGTTCTATATCCACTGTCGG and CGGTCCTATGTGCTCGTCAA for NLRP3, and CTTAGTTGCGTTACACCCTTTCTTG and CTGTCACCTTCACCGTTCCAGTTT for -actin. The results were analyzed through the comparative threshold cycle (CT) method. The Access No. for NLRP3 gene is NM 183395.2.
Materials and methods
Western blot assay
Cell culture
Cultured cells were collected and lysed with NP40 lysis buffer (Beyotime Institute of Biotechnology). Proteins were separated on 11% SDS-PAGE followed by electro-transferring onto PVDF membranes. Primary anti-NLRP3 (1:1000), anti-ASC (1:2000) and anti-cleaved caspase-1 p10 (1:1000) antibodies (WanLei Life Sciences, Shenyang, China) were added after membranes were blocked by Tris-buffered saline Tween 20 (TBST) solution containing 5% non-fat milk. After washing with TBST, the membranes were incubated with horseradish peroxidase (HRP) conjugated goat antirabbit IgG (1:5000; Beyotime Institute of Biotechnology). Mouse anti--actin-HRP antibody was used to detected -actin (1:10,000; KangChen Bio-tech, Shanghai, China) in these samples. The bands were developed by the enhanced chemiluminescence (ECL) detection system (Qihai Biotechnology, Shanghai, China).
Human osteoblastic MG63 cells (ATCC, Manassas, VA, USA) were cultured in ␣-Modified Eagle’s Medium (␣-MEM) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA), penicillin (100 U/ml), and streptomycin (100 mg/ml) at 37 ◦ C in a humidified 5% CO2 incubator. Exposure of cultured MG63 cells to A. actinomycetemcomitans The A. actinomycetemcomitans strain ATCC 29523 was used in this study. Exposure of cultured osteoblasts to A. actinomycetemcomitans was performed as previously described with minor modifications (Marriott et al., 2005). Strain ATCC 29523 was cultured in brain heart infusion (BHI) medium supplemented with 5% defibrinated sheep blood, hemin (5 g/mL) and vitamin K1 (10 g/mL) at 37 ◦ C. The bacteria were collected by centrifugation and washed with phosphate buffered saline (PBS). The bacteria were resuspended in PBS and labeled with carboxyfluorescein succinimidyl ester (CFSE; Sigma–Aldrich, St. Louis, MO, USA). MG63 cells were cultured to confluence and exposed to A. actinomycetemcomitans at the multiplicity of infection (m.o.i.) of 500, 1000 and 2500 bacteria per cell, respectively. The mixtures were kept at 37 ◦ C, 5% CO2 for 2 h. Then, the infected cells were washed with PBS and cultured in growth medium with 300 g/ml gentamicin to kill remaining extracellular bacteria. After incubation for an additional 22 h, the cell cultures were subjected to further analysis. Hoechst staining A commercially available Hoechst Staining Kit was used to determine the apoptosis of A. actinomycetemcomitans-infected MG63 cells following the manufacturer’s instructions (Beyotime Institute of Biotechnology, Haimen, China). The staining was observed under an Olympus fluorescence microscope (Tokyo, Japan). Flow cytometry assay To establish the infection of A. actinomycetemcomitans, the bacteria were labeled with CFSE and mixed with cultured MG63 cells as described above. After incubation, the infected MG63 cells were subjected to flow cytometric analysis. The Annexin V-FITC Apoptosis Detection Kit was employed to determine apoptosis according to the recommended protocol (KeyGEN Biotech, Nanjing, China). MG63 cells were stained with Annexin V/propidium iodide (AV/PI) and then subjected to flow cytometry with a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
Measurement of secreted IL-1ˇ and IL-18 in A. actinomycetemcomitans-infected human osteoblastic MG63 cells The cultured MG63 cells were exposed to various A. actinomycetemcomitans as described above. After incubation, the cells were removed by centrifugation and the cell culture supernatants were retained. The secretion of IL-1 and IL-18 in A. actinomycetemcomitans-infected MG63 cells was measured by ELISA kits (Multisciences, Hangzhou, China) according to the recommended procedures. Downregulation of NLRP3 expression by small interfering RNA in human osteoblastic MG63 cells Down-regulation of the expression level of NLRP3 was achieved by co-transfecting MG63 cells with a combination of three small interfering RNAs (siRNAs) targeting a different locus of this gene. MG63 cells were incubated with siRNAs using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). siRNAs targeting the sequences 5 CAACAGGAGAGACCUUUAU-3 ; 5 -GCUGCUGAAAUGGAUUGAA-3 ; 5 -GUGCGUUAGAAACACUUCA-3 were selected. A siRNA targeting an irrelevant sequence 5 -UUCUCCGAACGUGUCACGU-3 was used as negative control. Twenty-four hours after transfection, these cells were subjected to qPCR and Western blot analysis, respectively. Statistical analysis The results are indicated as means ± SD. ANOVA followed by Bonferroni test was used to determine the differences among groups. A P-value less than 0.05 was regarded as statistically significant. The analysis was carried out by GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA).
Real-time qPCR analysis
Results
RNA simple Total RNA Kit (Tiangen Biotechnology Co., Ltd., Beijing, China) was used to extract total RNA from MG63 cells following the recommended procedures. One microgram purified RNA was employed to synthesis the complementary DNA (cDNA). Real-time qPCR was performed in a 20 L reaction system and run on an ExicyclerTM 96 real-time quantitative thermal block
Characterization of the invasion of A. actinomycetemcomitans in human osteoblastic MG63 cells Human osteoblastic MG63 cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and then mixed with MEM medium or various amounts of A. actinomycetemcomitans as
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
1121
Fig. 1. Identification of the infection by A. actinomycetemcomitans. Human osteoblastic MG63 cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and then incubated with MEM medium (A) or A. actinomycetemcomitans at the m.o.i. of 500 (B), 1000 (C) and 2500 (D) bacteria per cell. After incubation, these MG63 cells were subjected to flow cytometry. m.o.i., multiplicity of infection.
described in the ‘Materials and methods’ section. After 24 h incubation, the mixtures were subjected to flow cytometry analysis. The results showed that weak signal was detected in osteoblastic MG63 cells mixed with MEM medium alone (Fig. 1A). A relatively strong signal was observed when these cells were exposed to A. actinomycetemcomitans at the multiplicity of infection (m.o.i.) of 500 bacteria per cell (Fig. 1B). Very intense fluorescence signals were detected when cells were incubated with increased amounts of A. actinomycetemcomitans (Fig. 1C and D). These data demonstrated the successful infection of A. actinomycetemcomitans in human osteoblastic MG63 cells. Invasion of A. actinomycetemcomitans induces apoptosis in human osteoblastic MG63 cells To determine the effects of A. actinomycetemcomitans infection on apoptosis, Hoechst staining of osteoblastic MG63 cells was carried out in the presence or absence of A. actinomycetemcomitans. As shown in Fig. 2A, no apoptosis was observed when A. actinomycetemcomitans was not added to the osteoblastic MG63 cells.
In contrast, nuclear chromatin condensation and fragmentation stained by Hoechst 33258 was detected when MG63 cells were incubated with A. actinomycetemcomitans, particularly in a high dose of infection (Fig. 2A). Moreover, the osteoblastic MG63 cells were stained with AV/PI followed by flow cytometry to investigate the effect of A. actinomycetemcomitans infection on apoptosis. We found that invasion of A. actinomycetemcomitans resulted in significant apoptosis of osteoblastic MG63 cells (Fig. 2B). In the absence of A. actinomycetemcomitans, the percentage of early apoptotic MG63 cells was 6.82%. However, this number increased to 30.95% when cells were exposed to A. actinomycetemcomitans at the m.o.i. of 1000 bacteria per cell. These results indicated that the infection of A. actinomycetemcomitans enhanced apoptosis in osteoblastic MG63 cells. Invasion of A. actinomycetemcomitans activates NLRP3/ASC inflammasome in human osteoblastic MG63 cells A previous study has shown that A. actinomycetemcomitans induces NLRP3 inflammasome expression during infection in
Fig. 2. Infection of A. actinomycetemcomitans induces apoptosis of human osteoblastic MG63 cells. Hoechst 33258 staining of MG63 cells infected by A. actinomycetemcomitans (A). Flow cytometry analysis was used to determine the apoptosis of MG63 cells incubated with or without A. actinomycetemcomitans (B). m.o.i., multiplicity of infection. Scale bars = 20 m.
1122
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
Fig. 4. Invasion of A. actinomycetemcomitans induces the expression level of inflammation factor. The levels of IL-1 (A) and IL-18 (B) in human osteoblastic MG63 cells infected with or without A. actinomycetemcomitans were measured by ELISA kits. ** P < 0.01, and *** P < 0.001 vs. MG63 group. m.o.i., multiplicity of infection.
Fig. 3. Effect of A. actinomycetemcomitans infection on the expression level of NLRP3/ASC inflammasome in human osteoblastic MG63 cells. Real-time qPCR analysis of the mRNA level of NLRP3 in MG63 cells treated with or without A. actinomycetemcomitans (A). Western blot (B) and the corresponding densitometric analysis (C) of MG63 cells infected with or without A. actinomycetemcomitans. * P < 0.05, ** P < 0.01, and *** P < 0.001 vs. MG63 group. m.o.i., multiplicity of infection.
human mononuclear leukocytes (Belibasakis and Johansson, 2012). In line with these findings, we found that both the mRNA and protein levels of NLRP3 were significantly elevated after the osteoblastic MG63 cells were exposed to A. actinomycetemcomitans (Fig. 3A and B). In addition, a dramatic increase of the expression level of ASC was observed in MG63 cells after A. actinomycetemcomitans infection (Fig. 3B and C). Accordingly, the production of the mature subunit p10 of caspase-1 was significantly induced when these cell were infected with A. actinomycetemcomitans, particularly at high multiplicity of infection (Fig. 3B and C, *** P < 0.001). To confirm further the effects of A. actinomycetemcomitans infection on the activation of NLRP3/ASC inflammasome, we investigated the expression of downstream inflammation factors after the osteoblastic MG63 cells were exposed to A. actinomycetemcomitans. The secretion of IL-1 and IL-18 was determined by ELISA. As shown in Fig. 4, the levels of IL-1 and IL-18 were increased extensively in A. actinomycetemcomitans treated MG63 cells as compared with non-treated cells (Fig. 4A and B, ** P < 0.01 for m.o.i. of 1000 bacteria per cell). Our findings suggested that the invasion of A. actinomycetemcomitans induced the activation of NLRP3/ASC inflammasome in MG63 cells.
NLRP3 is required for A. actinomycetemcomitans to induce apoptosis in human osteoblastic MG63 cells NLRP3 has been shown to be implicated in Salmonella infectioninduced apoptosis of human osteoblasts (McCall et al., 2008). To investigate whether NLRP3 is involved in A. actinomycetemcomitans induced apoptotic cell death of human osteoblastic MG63 cells, we downregulated the expression of NLRP3 in MG63 cells using RNA interference. Real-time qPCR and Western blot analysis showed that both mRNA and protein levels of NLRP3 in cells transfected with specific sequence targeting to NLRP3 were remarkably reduced as compared to non-transfected cells or cells transfected with non-specific siRNA (Fig. 3A–C, *** P < 0.001). Next, we performed AV/PI staining followed by flow cytometry to explore the role of NLRP3 in A. actinomycetemcomitans invasion induced apoptosis. As shown in Fig. 5D, the infection of A. actinomycetemcomitans resulted in significant apoptosis in nontransfected MG63 cells. The percentage of early apoptotic MG63 cells was 30.1%. However, this number dropped to 14.62% when NLRP3 was downregulated, indicating the inhibition of apoptosis in cells transfected with siRNA targeting to NLRP3 (Fig. 5D). No obvious effect on apoptosis was detected when cells were transfected with non-specific siRNA construct (Fig. 5D). Discussion A. actinomycetemcomitans is a Gram-negative bacterium, which has been shown to cause aggressive periodontitis. In the present study, we established the infection of A. actinomycetemcomitans in human osteoblastic MG63 cells. Our results showed that
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
1123
Fig. 5. NLRP3 is required for A. actinomycetemcomitans to induce apoptosis in human osteoblastic MG63 cells. Downregulation of NLRP3 mRNA was established by real-time qPCR (A). Western blot (B) and densitometric analysis (C) of non-transfected MG63 cells, and cells transfected with control-siRNA or NLRP3-siRNA. Non-transfected or transfected MG63 cells were incubated with A. actinomycetemcomitans at the m.o.i. of 1000 bacteria per cell. After incubation, cells were subjected to the flow cytometry analysis (D). *** P < 0.001 vs. non-transfected MG63 cells. m.o.i., multiplicity of infection.
the invasion of A. actinomycetemcomitans enhanced apoptosis of MG63 cells. Furthermore, NLRP3 inflammasome was activated and the secretion of inflammatory factors was increased in A. actinomycetemcomitans-infected MG63 cells. Finally, the induction of apoptosis by A. actinomycetemcomitans infection was inhibited when NLRP3 expression was downregulated by RNA interference, indicating the indispensable function of NLRP3 during this process. Previous studies have demonstrated that extracts of A. actinomycetemcomitans or anti-proliferative capsular-like polysaccharide antigen from the bacteria induce apoptotic cell death in osteoblasts (Morimoto et al., 1999; Yamamoto et al., 1999). To investigate the molecular mechanisms underlying this activity, we established the invasion of A. actinomycetemcomitans on MG63 cells. Flow cytometry analysis showed that the cultured cells were infected by A. actinomycetemcomitans at the indicated m.o.i. It should be noted that the intensity of detected signals was similar between m.o.i. of 1000 and of 2500 bacteria per cell. Hoechst staining and AV/PI staining followed by flow cytometry were employed to determine the effect on apoptosis of A. actinomycetemcomitans-infected MG63 cells. Our data suggested that the infection of A. actinomycetemcomitans resulted in significant apoptosis of MG63 cells. This finding was consistent with prior reports which found that A. actinomycetemcomitans infection causes apoptosis in human monocytic THP-1 cells (Kato et al., 2005, 2013). In addition, Kang et al. (2012) revealed that A. actinomycetemcomitans infection enhances apoptosis in gingival epithelium of diabetic rats (Kang et al., 2012). NLRP3 inflammasome has been implicated in the induction of cell death in response to cell stresses, including bacterial and viral infections (Ogura et al., 2006; Craven et al., 2009; Gross et al., 2009). Moreover, it plays a pivotal role in inflammatory periodontal disease (Bostanci et al., 2009). A study performed by McCall et al. (2008) revealed that a reduction in the expression of NLRP3 attenuates Salmonella-induced apoptosis, indicating the necessity
of this molecule during the induction of apoptotic cell death of human osteoblasts after challenge with bacteria (McCall et al., 2008). Additionally, the expression level of NLRP3 was upregulated, while NLRP6 was downregulated, when human mononuclear cells were infected by A. actinomycetemcomitans (Belibasakis and Johansson, 2012). These findings lead us to expect a key role of NLRP3 in the apoptosis of A. actinomycetemcomitans-infected human osteoblasts. In the present study, we found that the expression levels of NLRP3 and its adaptor, ASC, were increased after human osteoblastic MG63 cells were exposed to A. actinomycetemcomitans. In line with prior studies, the secretion of IL-1 and IL-18 was extensively enhanced when MG63 cell cultures were challenged with the bacteria (Kelk et al., 2011; Belibasakis and Johansson, 2012). The excessive pro-inflammatory response triggered by A. actinomycetemcomitans contributes significantly to alveolar bone loss in periodontitis (Izawa et al., 2014). The observations that NLRP3 inflammasome was activated during A. actinomycetemcomitans infection suggested a possible involvement of NLRP3 in apoptosis of MG63 cells infected by this type of bacteria. To test this, we first established a transfected MG63 cell line in which the expression level of NLRP3 was downregulated by specific siRNAs. Real-time qPCR and Western blot analysis confirmed the knockdown of NLRP3 in MG63 cells transfected with specific siRNA targeted to this molecule. Cells were stained with AV/PI followed by flow cytometry. The data demonstrated that knockdown of NLRP3 expression inhibited apoptosis of MG63 cells after challenge with A. actinomycetemcomitans. Similar to this finding, the reduction of NLRP3 expression level attenuates apoptosis when human osteoblasts are exposed to Salmonella (McCall et al., 2008). These observations shed new light on the molecular mechanisms underlying apoptosis of osteoblasts induced by bacterial pathogens. The induction of apoptosis may contribute significantly to bone loss during the pathogenic processes of periodontitis.
1124
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
References Belibasakis GN, Johansson A. Aggregatibacter actinomycetemcomitans targets NLRP3 and NLRP6 inflammasome expression in human mononuclear leukocytes. Cytokine 2012;59:124–30. Bostanci N, Emingil G, Saygan B, Turkoglu O, Atilla G, Curtis MA, et al. Expression and regulation of the NALP3 inflammasome complex in periodontal diseases. Clin Exp Immunol 2009;157:415–22. Cassel SL, Joly S, Sutterwala FS. The NLRP3 inflammasome: a sensor of immune danger signals. Semin Immunol 2009;21:194–8. Craven RR, Gao X, Allen IC, Gris D, Bubeck Wardenburg J, McElvania-Tekippe E, et al. Staphylococcus aureus alphahemolysin activates the NLRP3-inflammasome in human and mouse monocytic cells. PLoS ONE 2009;4:e7446. Franchi L, Nunez G. The Nlrp3 inflammasome is critical for aluminium hydroxide-mediated IL-1beta secretion but dispensable for adjuvant activity. Eur J Immunol 2008;38:2085–9. Gross O, Poeck H, Bscheider M, Dostert C, Hannesschlager N, Endres S, et al. Syk kinase signalling couples to the Nlrp3 inflammasome for anti-fungal host defence. Nature 2009;459:433–6. Gumucio DL, Diaz A, Schaner P, Richards N, Babcock C, Schaller M, et al. Fire and ICE: the role of pyrin domain-containing proteins in inflammation and apoptosis. Clin Exp Rheumatol 2002;20:S45–53. Izawa A, Ishihara Y, Mizutani H, Kobayashi S, Goto H, Okabe E, et al. Inflammatory bone loss in experimental periodontitis induced by Aggregatibacter actinomycetemcomitans in IL-1Ra knockout mice. Infect Immun 2014;82:1904–13. Kang J, de Brito Bezerra B, Pacios S, Andriankaja O, Li Y, Tsiagbe V, et al. Aggregatibacter actinomycetemcomitans infection enhances apoptosis in vivo through a caspase-3-dependent mechanism in experimental periodontitis. Infect Immun 2012;80:2247–56. Kato S, Nakashima K, Nagasawa T, Abiko Y, Furuichi Y. Involvement of Toll-like receptor 2 in apoptosis of Aggregatibacter actinomycetemcomitans-infected THP-1 cells. J Microbiol Immunol Infect 2013;46:164–70. Kato S, Sugimura N, Nakashima K, Nishihara T, Kowashi Y. Actinobacillus actinomycetemcomitans induces apoptosis in human monocytic THP-1 cells. J Med Microbiol 2005;54:293–8. Kelk P, Abd H, Claesson R, Sandstrom G, Sjostedt A, Johansson A. Cellular and molecular response of human macrophages exposed to
Aggregatibacter actinomycetemcomitans leukotoxin. Cell Death Dis 2011;2:e126. Mariathasan S, Weiss DS, Newton K, McBride J, O’Rourke K, Roose-Girma M, et al. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006;440:228–32. Marriott I, Rati DM, McCall SH, Tranguch SL. Induction of Nod1 and Nod2 intracellular pattern recognition receptors in murine osteoblasts following bacterial challenge. Infect Immun 2005;73:2967–73. McCall SH, Sahraei M, Young AB, Worley CS, Duncan JA, Ting JP, et al. Osteoblasts express NLRP3, a nucleotide-binding domain and leucine-rich repeat region containing receptor implicated in bacterially induced cell death. J Bone Miner Res 2008;23: 30–40. Morimoto Y, Morimoto H, Murata T, Kobayashi S, Ohba T, Haneji T. Extracts of Actinobacillus actinomycetemcomitans induce apoptotic cell death in human osteoblastic MG63 cells. J Dent Res 1999;78:735–42. Ogura Y, Sutterwala FS, Flavell RA. The inflammasome: first line of the immune response to cell stress. Cell 2006;126:659–62. Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet 2005;366:1809–20. Schacher B, Baron F, Rossberg M, Wohlfeil M, Arndt R, Eickholz P. Aggregatibacter actinomycetemcomitans as indicator for aggressive periodontitis by two analysing strategies. J Clin Periodontol 2007;34:566–73. Schroder K, Tschopp J. The inflammasomes. Cell 2010;140:821– 32. Tomita S, Komiya-Ito A, Imamura K, Kita D, Ota K, Takayama S, et al. Prevalence of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis and Tannerella forsythia in Japanese patients with generalized chronic and aggressive periodontitis. Microb Pathog 2013;61–62:11–5. van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LA. Inflammasome activation and IL-1beta and IL-18 processing during infection. Trends Immunol 2011;32:110–6. Yamamoto S, Mogi M, Kinpara K, Ishihara Y, Ueda N, Amano K, et al. Anti-proliferative capsular-like polysaccharide antigen from Actinobacillus actinomycetemcomitans induces apoptotic cell death in mouse osteoblastic MC3T3-E1 cells. J Dent Res 1999;78:1230–7.
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
NLRP3 inflammasome is required for apoptosis of Aggregatibacter actinomycetemcomitans-infected human osteoblastic MG63 cells Panyu Zhao a , Junchao Liu b , Chunling Pan b , Yaping Pan b,∗ a b
Department of Pediatric Dentistry, School of Stomatology, China Medical University, Shenyang 110001, People’s Republic of China Department of Oral Biology and Periodontics, School of Stomatology, China Medical University, Shenyang 110001, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 11 March 2014 Received in revised form 25 May 2014 Accepted 26 May 2014 Keywords: NLRP3 Inflammasome Aggregatibacter actinomycetemcomitans Apoptosis Osteoblasts
a b s t r a c t Aggregatibacter actinomycetemcomitans (A. actinomycetemcomitans) is a Gram-negative bacterium which is implicated in the pathogenesis of human periodontal disease and in particular aggressive periodontitis. Virulence factors from A. actinomycetemcomitans have been shown to induce apoptosis of osteoblasts, however, the underlying mechanisms of the induction of apoptosis are poorly understood. In the present study, the infection of A. actinomycetemcomitans in human osteoblastic MG63 cells was established. Accordingly, A. actinomycetemcomitans infection enhanced significant apoptosis of MG63 cells. We found that both expression levels of NLRP3 and ASC were increased dramatically after MG63 cell cultures exposed to A. actinomycetemcomitans. Moreover, the secretion of mature interleukin-1 (IL-1) and IL18 were extensively induced in A. actinomycetemcomitans-infected cells as compared with non-invasion group of MG63 cell cultures, indicating the activation of the NLRP3 inflammasome during infection. Finally, we found that the knockdown expression of NLRP3 by specific small interfering RNA (siRNA) attenuated apoptosis of A. actinomycetemcomitans-infected MG63 cells. Our data suggest that A. actinomycetemcomitans promotes apoptosis of human osteoblasts at least partially through the NLRP3 inflammasome. © 2014 Elsevier GmbH. All rights reserved.
Introduction Aggregatibacter actinomycetemcomitans (A. actinomycetemcomitans), a Gram-negative bacterium, has been implicated in the pathogenesis of aggressive periodontitis (Schacher et al., 2007; Tomita et al., 2013). This form of periodontal disease is characterized by severe periodontal destruction and alveolar bone loss (Pihlstrom et al., 2005). The inflammatory response triggered by A. actinomycetemcomitans infection results in tissue damage as well as alveolar bone loss (Kang et al., 2012). The extracts or products of A. actinomycetemcomitans have been demonstrated to induce apoptotic cell death in osteoblasts, such as human osteoblastic MG63 cells (Morimoto et al., 1999) and mouse osteoblastic MC3T3-E1 cells (Yamamoto et al., 1999). However, the molecular mechanisms underlying the induction of apoptosis in A. actinomycetemcomitansinfected osteoblasts remain elusive.
∗ Corresponding author at: Department of Oral Biology and Periodontics, School of Stomatology, China Medical University, 117 North Nanjing Street, Shenyang 110001, People’s Republic of China. E-mail address: [email protected] (Y. Pan). http://dx.doi.org/10.1016/j.acthis.2014.05.008 0065-1281/© 2014 Elsevier GmbH. All rights reserved.
The NLRP3 (NOD-like receptor protein 3) inflammasome is a multiprotein complex composed of NLRP3 (also known as NALP3), ASC (apoptosis-associated speck-like protein containing a CARD), Cardinal and caspase-1 (Cassel et al., 2009; Schroder and Tschopp, 2010). This type of inflammasome activates caspase-1 which, in turn, cleaves the precursors of IL-1 and IL-18, and eventually leads to the secretion of mature inflammatory factors (Franchi and Nunez, 2008; van de Veerdonk et al., 2011). It has been demonstrated that the NLRP3 inflammasome plays a crucial role in inflammatory periodontal disease and in the induction of cell death in response to viral infection (Gumucio et al., 2002; Mariathasan et al., 2006). McCall et al. (2008) showed that the functional expression of NLRP3 is required for apoptotic cell death of osteoblasts after challenge with Salmonella (McCall et al., 2008). Moreover, A. actinomycetemcomitans infection enhances NLRP3 inflammasome expression and increases the levels of IL-1 and IL-18 (Belibasakis and Johansson, 2012). Based on these observations, we hypothesized that apoptosis in A. actinomycetemcomitans-infected human osteoblastic MG63 cells is induced by the activation of NLRP3 inflammasome. To test this, we first established the infection of A. actinomycetemcomitans in MG63 cells. The induction of apoptosis after exposure to A. actinomycetemcomitans was accessed by Hoechst staining and
1120
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
flow cytometry. Our results showed that A. actinomycetemcomitans infection promotes apoptosis and enhances NLRP3 inflammasome expression in MG63 cells. Furthermore, down-regulation of NLRP3 by small interfering RNA (siRNA) inhibited the induction of apoptosis in A. actinomycetemcomitans-infected MG63 cells.
(Bioneer, Daejeon, Korea). Primers are CTGTTCTATATCCACTGTCGG and CGGTCCTATGTGCTCGTCAA for NLRP3, and CTTAGTTGCGTTACACCCTTTCTTG and CTGTCACCTTCACCGTTCCAGTTT for -actin. The results were analyzed through the comparative threshold cycle (CT) method. The Access No. for NLRP3 gene is NM 183395.2.
Materials and methods
Western blot assay
Cell culture
Cultured cells were collected and lysed with NP40 lysis buffer (Beyotime Institute of Biotechnology). Proteins were separated on 11% SDS-PAGE followed by electro-transferring onto PVDF membranes. Primary anti-NLRP3 (1:1000), anti-ASC (1:2000) and anti-cleaved caspase-1 p10 (1:1000) antibodies (WanLei Life Sciences, Shenyang, China) were added after membranes were blocked by Tris-buffered saline Tween 20 (TBST) solution containing 5% non-fat milk. After washing with TBST, the membranes were incubated with horseradish peroxidase (HRP) conjugated goat antirabbit IgG (1:5000; Beyotime Institute of Biotechnology). Mouse anti--actin-HRP antibody was used to detected -actin (1:10,000; KangChen Bio-tech, Shanghai, China) in these samples. The bands were developed by the enhanced chemiluminescence (ECL) detection system (Qihai Biotechnology, Shanghai, China).
Human osteoblastic MG63 cells (ATCC, Manassas, VA, USA) were cultured in ␣-Modified Eagle’s Medium (␣-MEM) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA), penicillin (100 U/ml), and streptomycin (100 mg/ml) at 37 ◦ C in a humidified 5% CO2 incubator. Exposure of cultured MG63 cells to A. actinomycetemcomitans The A. actinomycetemcomitans strain ATCC 29523 was used in this study. Exposure of cultured osteoblasts to A. actinomycetemcomitans was performed as previously described with minor modifications (Marriott et al., 2005). Strain ATCC 29523 was cultured in brain heart infusion (BHI) medium supplemented with 5% defibrinated sheep blood, hemin (5 g/mL) and vitamin K1 (10 g/mL) at 37 ◦ C. The bacteria were collected by centrifugation and washed with phosphate buffered saline (PBS). The bacteria were resuspended in PBS and labeled with carboxyfluorescein succinimidyl ester (CFSE; Sigma–Aldrich, St. Louis, MO, USA). MG63 cells were cultured to confluence and exposed to A. actinomycetemcomitans at the multiplicity of infection (m.o.i.) of 500, 1000 and 2500 bacteria per cell, respectively. The mixtures were kept at 37 ◦ C, 5% CO2 for 2 h. Then, the infected cells were washed with PBS and cultured in growth medium with 300 g/ml gentamicin to kill remaining extracellular bacteria. After incubation for an additional 22 h, the cell cultures were subjected to further analysis. Hoechst staining A commercially available Hoechst Staining Kit was used to determine the apoptosis of A. actinomycetemcomitans-infected MG63 cells following the manufacturer’s instructions (Beyotime Institute of Biotechnology, Haimen, China). The staining was observed under an Olympus fluorescence microscope (Tokyo, Japan). Flow cytometry assay To establish the infection of A. actinomycetemcomitans, the bacteria were labeled with CFSE and mixed with cultured MG63 cells as described above. After incubation, the infected MG63 cells were subjected to flow cytometric analysis. The Annexin V-FITC Apoptosis Detection Kit was employed to determine apoptosis according to the recommended protocol (KeyGEN Biotech, Nanjing, China). MG63 cells were stained with Annexin V/propidium iodide (AV/PI) and then subjected to flow cytometry with a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
Measurement of secreted IL-1ˇ and IL-18 in A. actinomycetemcomitans-infected human osteoblastic MG63 cells The cultured MG63 cells were exposed to various A. actinomycetemcomitans as described above. After incubation, the cells were removed by centrifugation and the cell culture supernatants were retained. The secretion of IL-1 and IL-18 in A. actinomycetemcomitans-infected MG63 cells was measured by ELISA kits (Multisciences, Hangzhou, China) according to the recommended procedures. Downregulation of NLRP3 expression by small interfering RNA in human osteoblastic MG63 cells Down-regulation of the expression level of NLRP3 was achieved by co-transfecting MG63 cells with a combination of three small interfering RNAs (siRNAs) targeting a different locus of this gene. MG63 cells were incubated with siRNAs using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). siRNAs targeting the sequences 5 CAACAGGAGAGACCUUUAU-3 ; 5 -GCUGCUGAAAUGGAUUGAA-3 ; 5 -GUGCGUUAGAAACACUUCA-3 were selected. A siRNA targeting an irrelevant sequence 5 -UUCUCCGAACGUGUCACGU-3 was used as negative control. Twenty-four hours after transfection, these cells were subjected to qPCR and Western blot analysis, respectively. Statistical analysis The results are indicated as means ± SD. ANOVA followed by Bonferroni test was used to determine the differences among groups. A P-value less than 0.05 was regarded as statistically significant. The analysis was carried out by GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA).
Real-time qPCR analysis
Results
RNA simple Total RNA Kit (Tiangen Biotechnology Co., Ltd., Beijing, China) was used to extract total RNA from MG63 cells following the recommended procedures. One microgram purified RNA was employed to synthesis the complementary DNA (cDNA). Real-time qPCR was performed in a 20 L reaction system and run on an ExicyclerTM 96 real-time quantitative thermal block
Characterization of the invasion of A. actinomycetemcomitans in human osteoblastic MG63 cells Human osteoblastic MG63 cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and then mixed with MEM medium or various amounts of A. actinomycetemcomitans as
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
1121
Fig. 1. Identification of the infection by A. actinomycetemcomitans. Human osteoblastic MG63 cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and then incubated with MEM medium (A) or A. actinomycetemcomitans at the m.o.i. of 500 (B), 1000 (C) and 2500 (D) bacteria per cell. After incubation, these MG63 cells were subjected to flow cytometry. m.o.i., multiplicity of infection.
described in the ‘Materials and methods’ section. After 24 h incubation, the mixtures were subjected to flow cytometry analysis. The results showed that weak signal was detected in osteoblastic MG63 cells mixed with MEM medium alone (Fig. 1A). A relatively strong signal was observed when these cells were exposed to A. actinomycetemcomitans at the multiplicity of infection (m.o.i.) of 500 bacteria per cell (Fig. 1B). Very intense fluorescence signals were detected when cells were incubated with increased amounts of A. actinomycetemcomitans (Fig. 1C and D). These data demonstrated the successful infection of A. actinomycetemcomitans in human osteoblastic MG63 cells. Invasion of A. actinomycetemcomitans induces apoptosis in human osteoblastic MG63 cells To determine the effects of A. actinomycetemcomitans infection on apoptosis, Hoechst staining of osteoblastic MG63 cells was carried out in the presence or absence of A. actinomycetemcomitans. As shown in Fig. 2A, no apoptosis was observed when A. actinomycetemcomitans was not added to the osteoblastic MG63 cells.
In contrast, nuclear chromatin condensation and fragmentation stained by Hoechst 33258 was detected when MG63 cells were incubated with A. actinomycetemcomitans, particularly in a high dose of infection (Fig. 2A). Moreover, the osteoblastic MG63 cells were stained with AV/PI followed by flow cytometry to investigate the effect of A. actinomycetemcomitans infection on apoptosis. We found that invasion of A. actinomycetemcomitans resulted in significant apoptosis of osteoblastic MG63 cells (Fig. 2B). In the absence of A. actinomycetemcomitans, the percentage of early apoptotic MG63 cells was 6.82%. However, this number increased to 30.95% when cells were exposed to A. actinomycetemcomitans at the m.o.i. of 1000 bacteria per cell. These results indicated that the infection of A. actinomycetemcomitans enhanced apoptosis in osteoblastic MG63 cells. Invasion of A. actinomycetemcomitans activates NLRP3/ASC inflammasome in human osteoblastic MG63 cells A previous study has shown that A. actinomycetemcomitans induces NLRP3 inflammasome expression during infection in
Fig. 2. Infection of A. actinomycetemcomitans induces apoptosis of human osteoblastic MG63 cells. Hoechst 33258 staining of MG63 cells infected by A. actinomycetemcomitans (A). Flow cytometry analysis was used to determine the apoptosis of MG63 cells incubated with or without A. actinomycetemcomitans (B). m.o.i., multiplicity of infection. Scale bars = 20 m.
1122
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
Fig. 4. Invasion of A. actinomycetemcomitans induces the expression level of inflammation factor. The levels of IL-1 (A) and IL-18 (B) in human osteoblastic MG63 cells infected with or without A. actinomycetemcomitans were measured by ELISA kits. ** P < 0.01, and *** P < 0.001 vs. MG63 group. m.o.i., multiplicity of infection.
Fig. 3. Effect of A. actinomycetemcomitans infection on the expression level of NLRP3/ASC inflammasome in human osteoblastic MG63 cells. Real-time qPCR analysis of the mRNA level of NLRP3 in MG63 cells treated with or without A. actinomycetemcomitans (A). Western blot (B) and the corresponding densitometric analysis (C) of MG63 cells infected with or without A. actinomycetemcomitans. * P < 0.05, ** P < 0.01, and *** P < 0.001 vs. MG63 group. m.o.i., multiplicity of infection.
human mononuclear leukocytes (Belibasakis and Johansson, 2012). In line with these findings, we found that both the mRNA and protein levels of NLRP3 were significantly elevated after the osteoblastic MG63 cells were exposed to A. actinomycetemcomitans (Fig. 3A and B). In addition, a dramatic increase of the expression level of ASC was observed in MG63 cells after A. actinomycetemcomitans infection (Fig. 3B and C). Accordingly, the production of the mature subunit p10 of caspase-1 was significantly induced when these cell were infected with A. actinomycetemcomitans, particularly at high multiplicity of infection (Fig. 3B and C, *** P < 0.001). To confirm further the effects of A. actinomycetemcomitans infection on the activation of NLRP3/ASC inflammasome, we investigated the expression of downstream inflammation factors after the osteoblastic MG63 cells were exposed to A. actinomycetemcomitans. The secretion of IL-1 and IL-18 was determined by ELISA. As shown in Fig. 4, the levels of IL-1 and IL-18 were increased extensively in A. actinomycetemcomitans treated MG63 cells as compared with non-treated cells (Fig. 4A and B, ** P < 0.01 for m.o.i. of 1000 bacteria per cell). Our findings suggested that the invasion of A. actinomycetemcomitans induced the activation of NLRP3/ASC inflammasome in MG63 cells.
NLRP3 is required for A. actinomycetemcomitans to induce apoptosis in human osteoblastic MG63 cells NLRP3 has been shown to be implicated in Salmonella infectioninduced apoptosis of human osteoblasts (McCall et al., 2008). To investigate whether NLRP3 is involved in A. actinomycetemcomitans induced apoptotic cell death of human osteoblastic MG63 cells, we downregulated the expression of NLRP3 in MG63 cells using RNA interference. Real-time qPCR and Western blot analysis showed that both mRNA and protein levels of NLRP3 in cells transfected with specific sequence targeting to NLRP3 were remarkably reduced as compared to non-transfected cells or cells transfected with non-specific siRNA (Fig. 3A–C, *** P < 0.001). Next, we performed AV/PI staining followed by flow cytometry to explore the role of NLRP3 in A. actinomycetemcomitans invasion induced apoptosis. As shown in Fig. 5D, the infection of A. actinomycetemcomitans resulted in significant apoptosis in nontransfected MG63 cells. The percentage of early apoptotic MG63 cells was 30.1%. However, this number dropped to 14.62% when NLRP3 was downregulated, indicating the inhibition of apoptosis in cells transfected with siRNA targeting to NLRP3 (Fig. 5D). No obvious effect on apoptosis was detected when cells were transfected with non-specific siRNA construct (Fig. 5D). Discussion A. actinomycetemcomitans is a Gram-negative bacterium, which has been shown to cause aggressive periodontitis. In the present study, we established the infection of A. actinomycetemcomitans in human osteoblastic MG63 cells. Our results showed that
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
1123
Fig. 5. NLRP3 is required for A. actinomycetemcomitans to induce apoptosis in human osteoblastic MG63 cells. Downregulation of NLRP3 mRNA was established by real-time qPCR (A). Western blot (B) and densitometric analysis (C) of non-transfected MG63 cells, and cells transfected with control-siRNA or NLRP3-siRNA. Non-transfected or transfected MG63 cells were incubated with A. actinomycetemcomitans at the m.o.i. of 1000 bacteria per cell. After incubation, cells were subjected to the flow cytometry analysis (D). *** P < 0.001 vs. non-transfected MG63 cells. m.o.i., multiplicity of infection.
the invasion of A. actinomycetemcomitans enhanced apoptosis of MG63 cells. Furthermore, NLRP3 inflammasome was activated and the secretion of inflammatory factors was increased in A. actinomycetemcomitans-infected MG63 cells. Finally, the induction of apoptosis by A. actinomycetemcomitans infection was inhibited when NLRP3 expression was downregulated by RNA interference, indicating the indispensable function of NLRP3 during this process. Previous studies have demonstrated that extracts of A. actinomycetemcomitans or anti-proliferative capsular-like polysaccharide antigen from the bacteria induce apoptotic cell death in osteoblasts (Morimoto et al., 1999; Yamamoto et al., 1999). To investigate the molecular mechanisms underlying this activity, we established the invasion of A. actinomycetemcomitans on MG63 cells. Flow cytometry analysis showed that the cultured cells were infected by A. actinomycetemcomitans at the indicated m.o.i. It should be noted that the intensity of detected signals was similar between m.o.i. of 1000 and of 2500 bacteria per cell. Hoechst staining and AV/PI staining followed by flow cytometry were employed to determine the effect on apoptosis of A. actinomycetemcomitans-infected MG63 cells. Our data suggested that the infection of A. actinomycetemcomitans resulted in significant apoptosis of MG63 cells. This finding was consistent with prior reports which found that A. actinomycetemcomitans infection causes apoptosis in human monocytic THP-1 cells (Kato et al., 2005, 2013). In addition, Kang et al. (2012) revealed that A. actinomycetemcomitans infection enhances apoptosis in gingival epithelium of diabetic rats (Kang et al., 2012). NLRP3 inflammasome has been implicated in the induction of cell death in response to cell stresses, including bacterial and viral infections (Ogura et al., 2006; Craven et al., 2009; Gross et al., 2009). Moreover, it plays a pivotal role in inflammatory periodontal disease (Bostanci et al., 2009). A study performed by McCall et al. (2008) revealed that a reduction in the expression of NLRP3 attenuates Salmonella-induced apoptosis, indicating the necessity
of this molecule during the induction of apoptotic cell death of human osteoblasts after challenge with bacteria (McCall et al., 2008). Additionally, the expression level of NLRP3 was upregulated, while NLRP6 was downregulated, when human mononuclear cells were infected by A. actinomycetemcomitans (Belibasakis and Johansson, 2012). These findings lead us to expect a key role of NLRP3 in the apoptosis of A. actinomycetemcomitans-infected human osteoblasts. In the present study, we found that the expression levels of NLRP3 and its adaptor, ASC, were increased after human osteoblastic MG63 cells were exposed to A. actinomycetemcomitans. In line with prior studies, the secretion of IL-1 and IL-18 was extensively enhanced when MG63 cell cultures were challenged with the bacteria (Kelk et al., 2011; Belibasakis and Johansson, 2012). The excessive pro-inflammatory response triggered by A. actinomycetemcomitans contributes significantly to alveolar bone loss in periodontitis (Izawa et al., 2014). The observations that NLRP3 inflammasome was activated during A. actinomycetemcomitans infection suggested a possible involvement of NLRP3 in apoptosis of MG63 cells infected by this type of bacteria. To test this, we first established a transfected MG63 cell line in which the expression level of NLRP3 was downregulated by specific siRNAs. Real-time qPCR and Western blot analysis confirmed the knockdown of NLRP3 in MG63 cells transfected with specific siRNA targeted to this molecule. Cells were stained with AV/PI followed by flow cytometry. The data demonstrated that knockdown of NLRP3 expression inhibited apoptosis of MG63 cells after challenge with A. actinomycetemcomitans. Similar to this finding, the reduction of NLRP3 expression level attenuates apoptosis when human osteoblasts are exposed to Salmonella (McCall et al., 2008). These observations shed new light on the molecular mechanisms underlying apoptosis of osteoblasts induced by bacterial pathogens. The induction of apoptosis may contribute significantly to bone loss during the pathogenic processes of periodontitis.
1124
P. Zhao et al. / Acta Histochemica 116 (2014) 1119–1124
References Belibasakis GN, Johansson A. Aggregatibacter actinomycetemcomitans targets NLRP3 and NLRP6 inflammasome expression in human mononuclear leukocytes. Cytokine 2012;59:124–30. Bostanci N, Emingil G, Saygan B, Turkoglu O, Atilla G, Curtis MA, et al. Expression and regulation of the NALP3 inflammasome complex in periodontal diseases. Clin Exp Immunol 2009;157:415–22. Cassel SL, Joly S, Sutterwala FS. The NLRP3 inflammasome: a sensor of immune danger signals. Semin Immunol 2009;21:194–8. Craven RR, Gao X, Allen IC, Gris D, Bubeck Wardenburg J, McElvania-Tekippe E, et al. Staphylococcus aureus alphahemolysin activates the NLRP3-inflammasome in human and mouse monocytic cells. PLoS ONE 2009;4:e7446. Franchi L, Nunez G. The Nlrp3 inflammasome is critical for aluminium hydroxide-mediated IL-1beta secretion but dispensable for adjuvant activity. Eur J Immunol 2008;38:2085–9. Gross O, Poeck H, Bscheider M, Dostert C, Hannesschlager N, Endres S, et al. Syk kinase signalling couples to the Nlrp3 inflammasome for anti-fungal host defence. Nature 2009;459:433–6. Gumucio DL, Diaz A, Schaner P, Richards N, Babcock C, Schaller M, et al. Fire and ICE: the role of pyrin domain-containing proteins in inflammation and apoptosis. Clin Exp Rheumatol 2002;20:S45–53. Izawa A, Ishihara Y, Mizutani H, Kobayashi S, Goto H, Okabe E, et al. Inflammatory bone loss in experimental periodontitis induced by Aggregatibacter actinomycetemcomitans in IL-1Ra knockout mice. Infect Immun 2014;82:1904–13. Kang J, de Brito Bezerra B, Pacios S, Andriankaja O, Li Y, Tsiagbe V, et al. Aggregatibacter actinomycetemcomitans infection enhances apoptosis in vivo through a caspase-3-dependent mechanism in experimental periodontitis. Infect Immun 2012;80:2247–56. Kato S, Nakashima K, Nagasawa T, Abiko Y, Furuichi Y. Involvement of Toll-like receptor 2 in apoptosis of Aggregatibacter actinomycetemcomitans-infected THP-1 cells. J Microbiol Immunol Infect 2013;46:164–70. Kato S, Sugimura N, Nakashima K, Nishihara T, Kowashi Y. Actinobacillus actinomycetemcomitans induces apoptosis in human monocytic THP-1 cells. J Med Microbiol 2005;54:293–8. Kelk P, Abd H, Claesson R, Sandstrom G, Sjostedt A, Johansson A. Cellular and molecular response of human macrophages exposed to
Aggregatibacter actinomycetemcomitans leukotoxin. Cell Death Dis 2011;2:e126. Mariathasan S, Weiss DS, Newton K, McBride J, O’Rourke K, Roose-Girma M, et al. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006;440:228–32. Marriott I, Rati DM, McCall SH, Tranguch SL. Induction of Nod1 and Nod2 intracellular pattern recognition receptors in murine osteoblasts following bacterial challenge. Infect Immun 2005;73:2967–73. McCall SH, Sahraei M, Young AB, Worley CS, Duncan JA, Ting JP, et al. Osteoblasts express NLRP3, a nucleotide-binding domain and leucine-rich repeat region containing receptor implicated in bacterially induced cell death. J Bone Miner Res 2008;23: 30–40. Morimoto Y, Morimoto H, Murata T, Kobayashi S, Ohba T, Haneji T. Extracts of Actinobacillus actinomycetemcomitans induce apoptotic cell death in human osteoblastic MG63 cells. J Dent Res 1999;78:735–42. Ogura Y, Sutterwala FS, Flavell RA. The inflammasome: first line of the immune response to cell stress. Cell 2006;126:659–62. Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet 2005;366:1809–20. Schacher B, Baron F, Rossberg M, Wohlfeil M, Arndt R, Eickholz P. Aggregatibacter actinomycetemcomitans as indicator for aggressive periodontitis by two analysing strategies. J Clin Periodontol 2007;34:566–73. Schroder K, Tschopp J. The inflammasomes. Cell 2010;140:821– 32. Tomita S, Komiya-Ito A, Imamura K, Kita D, Ota K, Takayama S, et al. Prevalence of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis and Tannerella forsythia in Japanese patients with generalized chronic and aggressive periodontitis. Microb Pathog 2013;61–62:11–5. van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LA. Inflammasome activation and IL-1beta and IL-18 processing during infection. Trends Immunol 2011;32:110–6. Yamamoto S, Mogi M, Kinpara K, Ishihara Y, Ueda N, Amano K, et al. Anti-proliferative capsular-like polysaccharide antigen from Actinobacillus actinomycetemcomitans induces apoptotic cell death in mouse osteoblastic MC3T3-E1 cells. J Dent Res 1999;78:1230–7.
