Original Article
Noninvasive Imaging of Acute Renal Allograft Rejection by Ultrasound Detection of Microbubbles Targeted to T-lymphocytes in Rats Ultraschall-basierte Diagnostik der akuten Nierentransplantatrejektion mittels Antikörper-markierter Microbubbles und humaner T-Lymphozyten im Rattenmodell Authors
A. Grabner1*, D. Kentrup1*, M. Mühlmeister1, H. Pawelski1, C. Biermann1, T. Bettinger2, H. Pavenstädt1, E. Schlatter1, K. Tiemann3*, S. Reuter1*
Affiliations
1
3
Department of Medicine D, Experimental Nephrology, University Hospital Münster, Germany Bracco Suisse SA, Bracco Suisse SA, Geneva, Italy Department of Nuclear Medicine, Technical University Munich, Germany
Key words
Abstract
Zusammenfassung
"
!
!
Purpose: We propose CD3-antibody-mediated contrast-enhanced ultrasonography using human T-lymphocytes for image-based diagnosis of acute allograft rejection (AR) established in a rat renal transplantation model. Materials and Methods: 15 minutes after tail vein injection of 30 × 106 human T-lymphocytes, contrast media/microbubbles conjugated with an anti-human CD3 antibody was applied to uni-nephrectomized 10-week-old allogeneically transplanted male rats (Lewis-Brown Norway (LBN) to Lewis, aTX) and ultrasound was performed to investigate the transplanted kidney as well as the native kidney. In vivo results were confirmed via immunohistochemical stainings of CD3 after post mortem dissection. Syngeneically transplanted rats (LBN to LBN, sTX), rats with ischemia/reperfusion injury (IRI, 45 min. warm ischemia), and rats subjected to acute cyclosporin A toxicity (CSA) (cyclosporine 50 mg/kg BW for 2 days i. p.) served as controls. Results: Accumulation of human T-lymphocytes was clearly detected by antibody-mediated sonography und was significantly increased in allografts undergoing AR (5.41 ± 1.32 A. U.) when compared to native control kidneys (0.70 ± 0.08 A. U.). CD3 signal intensity was low in native kidneys, sTX (0.99 ± 0.30 A. U.), CSA (0.10 ± 0.02 A. U.) and kidneys with IRI (0.46 ± 0.29 A. U.). Quantification of the ultrasound signal correlated significantly with the T-cell numbers obtained by immunohistochemical analysis (R2 = 0.57). Conclusion: Contrast-enhanced sonography using CD3-antibodies is an option for quick and highly specific assessment of AR in a rat model of renal transplantation.
Ziel: Evaluation des Kontrastmittel-gestützten Ultraschalls unter Verwendung humaner T-Lymphozyten und anti-CD3-markierter Microbubbles zur Detektion und Differentialdiagnostik der akuten renalen Abstoßung im Transplantationsmodell der Ratte. Material und Methoden: 30 × 106 humane T-Zellen wurden uninephrektomierten, allogen nierentransplantierten Ratten (LBN auf Lewis) am 4. postoperativen Tag (POD4) injiziert. 15 min später erfolgte die i. v. Gabe humanspezifischer anti-CD3 Antikörpermarkierter Microbubbles. Die Akkumulation humaner T-Zellen und gebundener Microbubbles wurde mittels Kleintierultraschall im Nierentransplantat und der Kontrollniere festgestellt und quantifiziert. Als Differentialdiagnose dienten syngen transplantierte Nieren (LBN auf LBN), Nieren mit warmem Ischämie/Reperfusionsschaden und Nieren mit akuter Calcineurin-inhibitortoxizität. Die Signalstärke der Ultraschallmessung wurde mit der Nierenhistologie (Banff Score, CD3 Färbung) korreliert. Ergebnisse: Ratten mit akuter Abstoßung zeigten am POD4 eine signifikante Akkumulation humaner T-Zellen und Microbubbles in der allogenen Transplantatniere (5,41 ± 1,32 A. U., p < 0,05, n = 4 – 10 in allen Gruppen) im Vergleich zur gesunden Eigenniere (0,70 ± 0,08 A. U.). Syngen transplantierte Nieren ohne Rejektion (0,99 ± 0,30 A. U.), Nieren mit akuter Cyclosporin A Toxizität (0,10 ± 0,02 A. U.), bzw. akutem Ischämie/Reperfusionsschaden (0,46 ± 0,29 A. U.) wiesen keine erhöhte Anhäufung auf. Die Signalstärke des kontrastmittelgestützten Ultraschalls korrelierte in allen Nierenschädigungsmodellen signifikant mit der histologischen Quantifizierung des inflammatorischen Infiltrates. Schlussfolgerungen: Mithilfe von T-Zellen und Antikörper-markierter Microbubbles ermöglicht die Kontrastmittel-gestützte Sonographie eine frühe und spezifische Diagnose der akuten Nierentransplantatabstoßung.
● diagnostic radiology ● ultrasound ● molecular imaging ● microbubbles ● transplantation " " " "
received accepted
4.3.2014 8.11.2014
Bibliography DOI http://dx.doi.org/ 10.1055/s-0034-1385796 Published online: 2015 Ultraschall in Med © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0172-4614 Correspondence Dr. Alexander Grabner Department of Medicine D, Experimental Nephrology, University Hospital Münster Albert-Schweitzer Campus 1, A14 48149 Münster Germany Tel.: ++ 49/2 51/8 35 81 30 alexander.grabner@ ukmuenster.de
* Contributed equally
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
2
Introduction !
At present, patients with impaired renal allograft function (characterized e. g. by elevated serum creatinine and/or blood urea nitrogen, proteinuria and/or changes in diuresis) typically undergo biopsy for the diagnosis of acute transplant rejection (AR) [1 – 3]. Nevertheless, more than 50 % of all rejection episodes occur subclinically without impairment of renal function, but mostly with histological changes equivalent to patients with a decreased glomerular filtration rate [4, 5]. Therefore, protocol biopsies at a defined time course after transplantation, independent of graft function, are suggested by some authors to diagnose AR [6, 7]. However, core needle biopsy as an invasive method bares several disadvantages like the risk of significant graft injury. Moreover, it is not feasible in patients under anticoagulation therapy and the inherent small sampling site might miss AR, especially if rejection is focal or patchy [8 – 10]. Thus, noninvasive methods based on the detection of specific biomarkers would be preferable. Although this can be achieved by measuring serum or urine samples (e. g. FOXP3 mRNA or CD3ε mRNA) [11 – 13], entirely image-based methods stand out by enabling visualization of the whole organ. In this regard ultrasonography is an easily accessible, reproducible and inexpensive tool for the diagnostic investigation of the renal transplant [14, 15]. Several efforts have been made to specifically diagnose AR, e. g. by calculating the resistance index [16 – 18] or by the usage of contrast-enhanced ultrasonography (CEUS) [19 – 21]. Nevertheless, at present biopsy is still required to differentiate AR from its main differential diagnoses of acute tubular necrosis (ATN) and calcineurin inhibitor toxicity (CSA) [15]. AR is a complex mechanism comprising the recipient’s immune system and foreign antigens (alloantigens), mostly major histocompatibility complex (MHC) molecules. Acute cellular rejection is mainly mediated by both CD4+ and CD8+ T-lymphocytes, whereas B-cells, the innate immune system consisting of monocytes/macrophages, the complement system, neutrophils and dendritic cells also contribute[22]. After recognition of alloantigens T-cells become activated, proliferate and migrate to the allograft. Thereby several chemokines, e. g. CXCL9, play a distinct role in the chemotaxis of activated T-cells [23]. Finally, effector T-lymphocytes infiltrate the interstitial department causing local destruction [24]. Since infiltration of T-cells appears before allograft dysfunction occurs, imaging employing lymphocytes is a promising tool for sensitive and early detection of AR. Thus, we recently established positron emission tomography (PET) using 18F-FDGlabeled human T-lymphocytes in a rat renal transplant model [1]. However, the main limitations of this approach are exposure to radiation, availability of PET and high expenses. Therefore, sonography-based molecular imaging of AR might be a better alternative [25]. Nevertheless, specific targeting of graft infiltrating T-lymphocytes with CEUS has never been tested before. Hence, we aimed to clarify whether CD3-mediated ultrasound is able to detect renal AR, to differentiate it from ATN and CSA, and to assess the degree of inflammation.
ard rat chow (Altromin, Lage, Germany) and tap water were used for all experiments (4 – 6 animals per group). Experiments were approved by a governmental committee on animal welfare and were performed in accordance with national animal protection guidelines. Surgeries were performed under anesthesia via intraperitoneal (i. p.) administration of ketamine 100 mg/kg body weight and xylazine 5 mg/kg BW (Xylazin, Ketamin, CEVA Tiergesundheit, Düsseldorf, Germany). Further doses of ketamine were injected as needed. For imaging experiments anesthesia was maintained by continuous application of medical air/isoflurane 2 % (Abbott, Wiesbaden, Germany). Transplantation was simultaneously performed by two investigators as described previously[1, 26] and recently published in detail elsewhere [27]. In short, the left kidney including urethra, renal artery, pieces of aorta and renal vein was transplanted into a uni-nephrectomized age- and weight-matched recipient (LBN to LEW, aTX). The chosen aTX model leads to histological and functional changes typical for acute rejection [26, 28, 29]. Syngeneically transplanted rats (LBN to LBN, sTX), healthy control rats as well as rats (LEW) with two common differential diagnoses of AR, i. e. ATN after IRI induced by ligation of the left renal artery for 45 minutes and rats with acute CSA nephropathy occurring after application of 50 mg/kg CSA (Sandimmun, Novartis, Nuremberg, Germany) i. p. for two days, served as controls (protocols analogous to [26]).
T-Cell Isolation There are several reasons for choosing human T-cells. Besides being easily accessible, the applied T-cells can be specifically detected within the graft for ex vivo verification of in vivo signals. The concept that the T-cell milieu of AR strongly attracts further T-cells which do not essentially need allograft specificity has been proven before[1]. In short, the applied T-cells follow a chemokine gradient and adhere to the luminal side of the grafts vessels. There, still exposed to the bloodstream, they can be used for specific visualization of a T-cell milieu (“signal amplifier”) by circulating microbubbles. Extravascular targets however, like secreted chemokines or T-cells which have already passed the vascular wall and reside inside the grafts tissue, cannot be directly detected by the latter. Buffy coats from human healthy donors mainly consisting of white blood cells, red blood cells and platelets were purchased at the German Red Cross (DRK) Münster, Germany. T-lymphocytes were isolated by negative antibody selection using the RosetteSep® method according to the manufacturer’s protocol (Stemcell, Cologne, Germany) as described previously[1].
Labeling of Microbubbles 3 × 108 microbubbles (BG6438, Bracco Suisse SA, Geneva, Switzerland) functionalized with streptavidin were labeled with 7.5 µg biotinylated anti-human anti-CD3-antibodies (ab28 071, Abcam, Cambridge, United Kingdom) by incubation for 30 minutes at room temperature (see details for microbubble preparation in [4]). Unlabeled microbubbles and IgM isotype control labeled microbubbles served as controls (20 µg of biotinylated rat IgM Isotype control (RTK2118 (clone) Fisher Scientific Waltham MA USA).
Materials and Methods !
Image Acquisition
Animal Models
Image acquisition using an HDI-5000 ultrasound system (Philips Healthcare, Best, The Netherlands) was performed 1 – 4 days after transplantation under general anesthesia delivered through a nose mask while heart rate and body temperature were maintained.
Male Lewis–Brown-Norway (LBN) and Lewis (LEW) rats (200 – 270 g body weight (BW), Janvier, Le Genest Saint Isle Saint, France and Charles River, Sulzfeld, Germany) with free access to stand-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Original Article
Abb. 1 Beispielultraschallbilder von aTX und sTX Ratten, Ratten mit IRI oder akuter CSA Toxizität sowie einer gesunden Kontrollratte. Gezeigt werden Transversalschnitte vom Tag 4 nach Operation, 15 min nach Infusion von 30 × 106 T-Lymphozyten in eine Schwanzvene vor (pre CM) und 2 min nach (post CM) Gabe von anti-CD3-markierten Kontrastmittelbläschen. POD: postoperativer Tag, CM: Kontrastmittel, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Imaging was performed using a high frequency 15 MHz linear array transducer at an MI of 1.1 in destructive intermittent imaging mode (0.5 Hz). The transplanted kidney and control kidney were simultaneously imaged. Gain settings at baseline were adjusted to be close to the noise floor to allow optimal use of the dynamic range (50 dB) for microbubble imaging. 15 minutes after tail vein injection of 30 × 106 human T-lymphocytes, a baseline image of both kidneys was recorded followed by the bolus application of
9 × 107 anti-CD3 labeled microbubbles while the ultrasound system was paused. The ultrasound transducer was kept in a stable position and after a waiting period, when microbubbles were cleared from the blood stream (5 – 7 minutes), contrast images were acquired. In order to avoid contamination of image analysis by circulating bubbles, clearance of contrast bubbles was confirmed by means of imaging of the heart chamber using an additional transducer. A short imaging sequence was obtained for de-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Fig. 1 Examples of ultrasound kidney images of aTX and sTX rats, rat with IRI, rat with acute CSA toxicity, and native controls. Shown are transverse images on POD4 15 minutes after tail vein injection of 30 × 106 T-lymphocytes before (pre-CM) and 2 minutes after (post-CM) application of anti-CD3-labeled microbubbles. For visualization of post-CM images, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. POD: postoperative day, CM: contrast media, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A (toxicity).
Fig. 2 T-lymphocyte accumulation was assessed in all groups of kidneys. As early as on POD2 aTX kidneys showed a significantly increased ultrasound signal, when compared to native controls (P < 0.0001). Control kidneys including syngeneically transplanted kidneys, kidneys with IRI and kidneys with acute CSA toxicity did not show any significant difference when compared to native controls. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity. Abb. 2 Die T-Lymphozyten Akkumulation in den Nieren wurde in allen Gruppen gemessen. Bereits 2 Tage nach allogener Nierentransplantation zeigten die Transplantatnieren signifikant stärkere Ultraschallsignale als gesunde Eigennieren (P < 0.0001). Kontrollnieren inklusive syngen transplantierter Nieren, Nieren mit IRI oder akuter CSA Toxizität unterschieden sich dagegen hinsichtlich der Signalintensität nicht von gesunden Eigennieren. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: IschämieReperfusionsschaden, CSA: Cyclosporin A (Toxizität).
structive contrast imaging, and imaging was stopped when bubble signals disappeared (5 – 8 frames). Animals were immediately sacrificed and kidneys were isolated and prepared for histological analysis.
Image Quantification Images were stored as raw data prior to scan conversion (Rθdata) and analyzed off-line by means of a calibrated software package as previously published[6]. Briefly, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. Image analysis was performed in an image frame created of background subtracted images displaying maximal signal intensity by drawing regions of interest (ROI) to cover the parenchyma of the transplanted or control kidney. Linearized Rθ-data was expressed as acoustical units.
Histology and Immunohistochemistry Portions of kidneys were snap-frozen and fixed using 4 % formaldehyde in PBS. Paraffin embedded tissue was stained using Periodic-acid-Schiff (PAS) and histological changes were evaluated by light microscopy. In addition, graft infiltration was quantified " Table 1) using the ti-score (total interstitial inflammation score,● according to Solez et al.[8]. For evaluation of T-lymphocyte infil-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Fig. 3 Examples of ultrasound kidney images of an aTX rat. Shown are transverse images on POD4 15 minutes after tail vein injection of 30 × 106 T-lymphocytes before (pre-CM) and 2 minutes after (post-CM) application of microbubbles alone or microbubbles labeled with an isotype control antibody. For the visualization of post-CM images, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. POD: postoperative day, CM: contrast media, aTX: allogeneically transplanted, MB: microbubbles Abb. 3 Beispielultraschallbilder einer aTX Ratte. Gezeigt werden Transversalschnitte vom Tag 4 nach Operation vor (pre CM) und 2 Min. nach (post CM) i. v. Applikation von nicht gelabelten, (MB only) und IgG Kontrollantikörper gelabelten Kontrastmittelbläschen (IgG control). CM: Kontrastmittel, aTX: allogen transplantiert, MB: Kontrastmittelbläschen.
Table 1 grafts.
ti-score of control kidneys (CTR, sTX, IRI, CSA) and allogeneic
Group
ti-
Quantitative criteria for cellular
score
interstitial inflammation
CTR (31), sTX (4), IRI (1), CSA (10), aTX POD 1 (5)
ti0
no or trivial interstitial inflammation (< 10 % of parenchyma)
IRI (3), aTX POD 1 (2), 2 (4), 3 (2)
ti1
10 – 25 % of parenchyma inflamed
aTX POD 2 (2), 3 (2)
ti2
26 – 50 % of parenchyma inflamed
aTX POD 3 (1), 4 (5)
ti3
> 50 % of parenchyma inflamed
POD: postoperative day; number of samples in brackets, ti-score according to [8].
tration, kidney slices with a thickness of 3 µm were blocked with BSA 10 %, immunostained with antibodies against CD3 epsilon (RM-9107-S1, Thermo Fisher Scientific, Dreieich, Germany) and against human-specific CD3 epsilon (ab52 959, Abcam, Cambridge, United Kingdom) using the alkaline phosphatase method and counterstained with Haemalaun. Stainings without primary antibody served as controls. Image acquisition was performed using an Axio Zeiss microscope (Axiovert 100, Carl Zeiss AG, Oberkochen, Germany) equipped with a digital camera (AxiocamMRc, Carl Zeiss AG) using the AxionVisonLE Release 4.7.1 software (Carl Zeiss AG). Quantification of CD3-positive cells was accomplished in a semi-automated manner in 12 fields of view (FOV, 350 × 250 µm each) using ImageJPixFRET software (downloadable at http://rsb.info.nih.gov/ij/)[11].
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 4 Periodic-acid-Schiff staining revealed typical histological signs of AR namely glomerulitis, tubulitis and endothelialitis in aTX kidneys, which are absent in all controls (native contralateral control kidney, sTX, IRI and CSA) A. Consistently, a significant infiltration pattern with CD3-positive T-lymphocytes was found only in renal allografts, gradually increasing over time from POD1 to POD4 B. POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Abb. 4 Eine Periodic-acid-Schiff Färbung verdeutlicht typische histologische Zeichen der akuten Rejektion wie beispielsweise Glomerulitis, Tubulitis oder Endothelialitis in allogenen Transplantatnieren, wohingegen sich diese Zeichen in den Kontrollgruppen (kontralaterale Eigennieren, sTX, IRI und CSA) A nicht nachweisen ließen. Dazu passend fand sich eine signifikante Infiltration von CD3-positiven T-Lymphozyten nur in allogenen Transplantatnieren, wobei der Schweregrad der Infiltration von Tag 1 – 4 (POD1 – 4) kontinuierlich zunahm B. POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Original Article
Statistics Data was compared by ANOVA with a Scheffé multiple comparisons test. Data is presented as median ± range (n = number of rats, samples, or experiments). Significance was inferred at a level of P < 0.05.
Results !
Fig. 5 Semiautomated quantification of CD3-positive cells revealed a significant infiltration in allografts undergoing AR when compared to all other control groups. Of note, infiltration of T-lymphocytes increased over time after transplantation. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/ reperfusion injury, CSA: cyclosporine A toxicity. Abb. 5 Die halbautomatische Quantifizierung CD3-positiver Zellen zeigte eine im Vergleich zu den Kontrollgruppen signifikant erhöhte Lymphozyteninfiltration in allogenen Transplantaten mit laufender Abstoßung an. Es sei darauf hingewiesen, dass die Infiltratmenge mit zunehmendem Abstand vom Zeitpunkt der Transplantation zunimmt. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Quantitative Real-Time (RT) Polymerase Chain Reaction (PCR) Expression of the T-lymphocyte chemoattractant CXCL 9 was quantified by RT-PCR using CYBR Green PCR Master Mix on an ABI Prism 7700 Sequence Detection System. All instruments and reagents were purchased by Applied Biosystems. A list of specific primer pairs is shown in table 2. Relative gene expression was evaluated using the 2-ΔΔCt method with GAPDH as housekeeping gene.
Method Rats (Lewis, male, Charles River, Sulzfeld, Germany) were injected intravenously with 300 μl saline solution containing 1.5 μg biotinylated monoclonal mouse anti-rat CD3 antibody (ab95 508, Abcam, Cambridge, United Kingdom). Whole blood samples were collected in heparin blood collection tubes before and after (24 h) antibody infusion. Samples were stained with biotinylated anti-CD3 (ab95 508, Abcam, Cambridge, United Kingdom) followed by Streptavidin FITC (554 060, BD, Franklin Lakes, USA), anti-CD4 APC (ab25 617, Abcam, Cambridge, United Kingdom) and anti-CD8 PE (ab95 526, Abcam, Cambridge, United Kingdom) staining. Erythrocytes were lysed with BD Pharm Lyse (555 899, BD, Franklin Lakes, USA) according to the manufacturer and flow cytometric analyses were performed with BD FACSCalibur.
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Already one day after transplantation (postoperative day 1, POD1) a clearly increased T-lymphocyte signal was detected by CEUS in renal allografts (1.17 ± 0.23 A. U.), with a further increase from " Fig. 1, 2). Assessment of microbubble accumulaPOD2 to POD4 (● tion revealed a significant increase in renal allografts only, reaching significance on POD2 (4.30 ± 0.45 A. U.), when compared to native control kidneys (0.70 ± 0.08 A. U.). The intensity of the ultrasound signal peaked on POD4 (5.41 ± 1.32 A. U.). No significant differences in signal intensities were found between native controls and sTX (0.99 ± 0.30 A. U.), CSA (0.10 ± 0.02 A. U.) and kidneys " Fig. 2). Control microbubbles and with IRI (0.46 ± 0.29 A. U.) (● BR1 labeled microbubbles were tested in pilot studies and did not result in a significant increase in signal intensity in the aTX group " Fig. 3). or in any other group (●
Histology Histological evaluation of allografts showed typical signs of acute rejection namely marked glomerulitis, tubulitis, endothelialitis " Fig. 4A, " Table 1). For validation of and interstitial infiltration (● ● our data obtained by sonography, we estimated the degree of AR by quantifying the number of CD3-positive infiltrating T-lymphocytes. Allografts undergoing AR showed increased ti-scores (aTX " Table 1) POD1 (ti0 – 1), POD2 (ti1 – 2), POD3 (ti1 – 3), POD4 (ti3), ● as well as distinct infiltration with T-cells, already reaching signif" Fig. 4B, " Table 1; icance on POD1, when compared to controls (● ● ti-scores of CTR (ti0), sTx (ti0), IRI (ti0 – 1), CSA (ti0)). This infiltration pattern clearly increased over time reaching a maximum on " Fig. 5). Histological characteristics of AR as well as signiPOD4 (● ficant T-cell infiltration were completely absent in all other control " Fig. 5). Nevertheless, signs of significant renal damage groups (● like tubulitis, detachment of cells into the tubular lumen (ATN) or hyaline arteriolar thickening (CSA) were observed in distinct con" Fig. 4). trols confirming the presence of ATN or CSA (● To validate the origin of the obtained ultrasound signal, the applied human T-lymphocytes were detected by histological staining of rat kidneys using a human-specific antibody against the CD3 epsilon subunit. Although all kidneys had been perfused with physiological saline before further analysis, at least some human CD3-positive cells were found in allografts undergoing AR (aTX), whereas all other control groups (sTX, CSA, IRI) did not " Fig. 6). contain any relevant amount of human cells at all (●
Correlation of Sonography and Histology To verify our hypothesis that sonographic detection of infiltrating T-cells not only ascertains AR but also represents the degree of inflammation, we correlated our results obtained by ultrasound with the number of CD3-positive cells/FOV of each group. This correlation was found significant through all groups of kidneys " Fig. 7A). (R2 = 0.57) (●
Downloaded by: University of Pittsburgh. Copyrighted material.
CEUS
Fig. 6 Human T-lymphocytes could be detected by immunohistochemistry in renal allografts only (arrows: POD3, POD4) and were completely absent in all other control groups. POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Quantitative RT-PCR Using quantitative real-time PCR, we evaluated mRNA expression of chemokine (C-X-C motif) ligand 9 (CXCL9). Renal allografts only (aTXPOD4) exhibited a significant upregulation of CXCL9 when compared to control animals (Lewis CTR) (p < 0.0001). Concordantly isografts (sTX), kidneys with IRI and acute CSA toxicity did not show significant changes of CXCL9 expression (p > 0.05) " Fig. 6B). (●
Discussion !
Especially in the first days after transplantation, delayed graft function related to ATN occurs in 2 – 50 % of all cases [30]. At the same time empiric calcineurin inhibitor therapy is started and the dosage often has to be adapted within the next days using therapeutic drug monitoring. Thus, high as well as low levels of these drugs potentially cause toxic effects or can promote early
Abb. 6 Humane T-Lymphozyten konnten immunhistochemisch nur in allogenen Nierentransplantaten nachgewiesen werden (Pfeile POD3 und POD4); nicht dagegen in den Nieren der anderen Kontrollgruppen. POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
episodes of AR. Therefore, the presented method for noninvasive and specific detection of AR seems to be of special interest for clinicians working in the acute transplantation setting. Since AR is characterized by a distinct inflammation pattern, where mainly activated T-lymphocytes are recruited into the transplant, we recently established T-cell PET using 18F-FDG-labeled human T-lymphocytes for noninvasive detection and monitoring of renal allograft rejection[1]. Moreover, T-cell PET allows a highly specific characterization of AR from its two main differential diagnoses, namely ATN and CSA. Nevertheless, potential drawbacks of PET-based diagnosis of AR are the in general limited availability of PET, lack of simple repeatability, exposure to radiation and finally for economic reasons due to disproportionally high expenses. Sonography already plays a decisive role in daily clinical practice of transplant and especially kidney transplant medicine. Nevertheless, ultrasound-based specific tools targeting AR and distinguishing it from important differential diagnoses like acute tubule necrosis or
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 7 Correlation of quantified ultrasound intensity and infiltrating CD3 positive T-lymphocytes in different groups of kidneys. A significant correlation was found R2 = 0.57 A. Relative CXCL 9 mRNA expression was significantly upregulated in renal allografts only when compared to all other control groups B. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). SD: standard deviation, POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Abb. 7 Es besteht eine signifikante Korrelation zwischen quantifizierter Ultraschallsignalintensität und T-Lymphozyten pro Gesichtsfeld (Histologie) (R2 = 0.57) A. Im Verglich zu den Nieren der Kontrollgruppen fand sich eine signifikante Hochregulation der relativen CXCL 9 mRNA Expression nur in allogenen Transplantatnieren B. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). SD: Standardabweichung, POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Primer Gene
Sense
GAPDH
CATCAACGACCCCTTCATTGAC
Antisense ACTCCACGACATACTCAGCACC
CXCL 9
TGTGGAGTTCGAGGAACCCT
ACCCTTGCTGAATCTGGGTC
calcineurin inhibitor toxicity are still missing. Kondo et al. evaluated acute cardiac allograft rejection in rats using CEUS targeted to leukocytes [31]. Moreover, a similar study was performed specifically targeting intercellular adhesion molecule-1 (ICAM-1)[32]. However, both studies assessed cardiac AR only without considering relevant potential differential diagnoses. Since both infiltration of leukocytes as well as endothelial ICAM-1 expression are rather unspecific and can be observed in other inflammatory scenarios like IRI or urinary tract infection, these approaches lack the inevitable specificity for daily clinical application. Renal AR has already been assessed in patients by Fischer et al. using general blood pool echo enhancers[33]. Although episodes of AR were detected and even the effects of perirenal hematomas were shown, a general contrast agent mainly evaluates arterial blood inflow, thereby not distinguishing between different causes of renal perfusion defects. Therefore, we have chosen T-celldependent diagnostics and evaluated CEUS targeted to T-lymphocytes as a highly specific diagnostic tool to assess AR in an established rat model of renal AR in comparison to other renal pathologies (IRI/ATN or CSA). After application of T-lymphocytes and microbubbles labeled with anti-CD3 antibodies, ultrasound intensity was calculated in all used renal injury and transplant models. In comparison to controls without AR, allografts undergoing AR exhibited significantly increased ultrasound signal intensities after administration of CD3-labeled microbubbles as
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Table 2 Sequences of Primers used for RT-PCR.
early as on postoperative day 2 (POD2). Since isografts as well as kidneys with ATN and acute CSA toxicity with comparable degrees of kidney damage[26, 29] did not show significant changes in signal intensity, this approach allows a highly specific differential diagnosis of AR. To further validate our image-based measurements, we correlated the ultrasound signal intensity with the histological quantification of CD3-positive T-lymphocytes. A significant correlation of ultrasound intensity and T-cell number was found. Since the ultrasound signal intensity increased over time (from POD1 to POD4) with this method, it is not only possible to diagnose but probably also to assess the degree of AR in a quantitative fashion. In contrast to aTX kidneys, native control kidneys did not show any remarkable histological changes, again correlating strongly with our findings obtained by sonography. Finally, isografts as well as kidneys undergoing IRI/ATN or acute CSA toxicity only showed lower ti-scores and slight histological changes in terms of T-cell infiltration. Of note, isografts as well as kidneys with IRI showed mainly non-T-cell mediated inflammation, most likely representing ATN in both groups (in the isograft group inflammation arises from ischemia occurring during the renal transplantation procedure). A limitation of our approach is that antibody-mediated rejection will not be addressed. In cases of suspected antibody-mediated rejection, e. g. in highly immunized patients or patients with steroid-refractory rejection, a biopsy still has to be performed. As complement split product
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 8 Effect of CD3 antibody administration on CD3+ T-cell population. Rats were injected intravenously with saline solution containing biotinylated monoclonal mouse anti-rat CD3 antibody (same concentration as used for sonography). Whole blood samples were collected before (0 h) and 24 h after antibody infusion. Samples were stained for CD3, CD4, CD8 and the proportion of T-cells was determined via flow cytometric analysis. A Representative plots of CD3+ T-cells, comparison of CD3+ T-cell population before and 24 h after antibody infusion. Results are expressed as mean ± SD (n = 3). B Quantification of CD3+ proportion. Student’s T test was performed and no significant difference was detected after the antibody treatment. C CD3 antibody treatment also had no effect on different T-cell populations. The proportion of CD4+ and CD8+ gated on CD3+ T-cells, remained the same before and after CD3 antibody treatment.
Abb. 8 Effekt der CD3-Antikörper-Applikation auf die CD3+ T-Zell Population. Kontrollratten erhielten biotinylierten monoklonalen Maus-antiRatten CD3 Antikörper i. v. appliziert. Vollblut wurde vor (0 h) und 24 h nach Gabe entnommen, T-Zellen wurden mittels CD3, CD4 und CD8 gefärbt und mittels FACS analysiert. A Repräsentative Plots CD3+ T-Zellen, sowie Vergleich der CD3+ T-Zell Population vor und 24 h nach Antikörpergabe. Dargestellt sind Medianwerte ± Standardabweichung (n = 3). B Quantifizierung der CD3+ T-Zellfraktion. Mittels Student’s T-Test konnte kein signifikanter Unterschied nach Antikörpergabe festgestellt werden. C CD3-Antikörpergabe hat keinen Effekt auf unterschiedliche T-Zellpopulationen. Der Anteil CD4+ and CD8+ Zellen blieb nach Gabe eines CD-Antikörpers unverändert.
C4 d plays a decisive role in the diagnosis of antibody-mediated rejection, we hypothesize that an approach using anti-C4 d imaging could be helpful to differentiate between both entities. In the field of nuclear medicine, molecular imaging using leukocytes is already a well-established method helping in the diagnosis of mainly inflammatory or infectious diseases[34, 35]. However, further preclinical and clinical studies are needed to assess the role of leukocyte-based imaging in the setting of (renal) AR and its differential diagnoses. Since this study utilizes human T-lymphocytes, one might question the fact that xenogeneic cells were used for imaging. However, others have established this before using xenogeneic epithelial cells[36]. Moreover, we have shown that 18F-FDG labeled human T-lymphocytes exhibit a distinct allocation in rats comparable to the biodistribution of ex vivo labeled autologous transferred leukocytes in healthy humans[37]. Finally allografts only exhibited a significant upregulation of CXCL9 mRNA expression, a strong chemokine inducing a local T-cell milieu attracting and activating new T-lymphocytes[23]. At present, a limitation of this application in humans appears to be the usage of an immunogenic streptavidin conjugation linking microbubbles and the appropriate antibodies. In addition, the high-power destructive imaging sequence with stable transducer
position might not be possible in a clinical scenario. This limitation, however, can be overcome by new transducer settings changing from high-power to low-power modes, allowing contrast quantification in real time [38, 39]. Nevertheless, our approach might easily be transferred into humans by using a different antibody-microbubble conjugation approach and simply targeting autologously isolated T-lymphocytes. Analogously to protocols used for nuclear imaging, T-cells need to be isolated from whole blood prior to imaging using a T-cell selection kit working with negative selection. For detection of AR, anti-CD3-microbubbles should be injected after adherence (~10 – 15 min) of the T-cell bolus at the graft vessels which works as a signal booster. Notably, our CEUS approach does not lead to relevant systemic T-cell " Fig. 8). Due to the small number of patients’ own depletion (● " Fig. 6) targeted by anti-CD3, inflammation will probT-cells (● ably not be promoted.
Conclusion !
We present and evaluate a CEUS-based approach to noninvasively assess renal AR and to improve post-transplant rejection monitoring. Using microbubbles targeted to applied T-lymphocytes,
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
this method allows early and highly specific diagnosis of AR. Additionally, it is capable of differentiating AR from ATN and CSA toxicity. Because T-cells play a key role in AR of solid organs, our approach is promising for the diagnosis of AR not only in kidneys but in solid organ transplanted humans. This should be addressed in future studies.
Acknowledgement !
This study was supported in part by the Deutsche Forschungsgemeinschaft (CRC 656 C7 & C3, PM12), the Interdisciplinary Centre for Clinical Research Münster, Germany (IZKF, Core Unit PIX) and the „Innovative Medical Research“ of the University of Münster Medical School. The authors are grateful to Richard Holtmeier, Rita Schröter and Ute Neugebauer for excellent technical assistance.
References 01 Grabner A, Kentrup D, Edemir B et al. PET with 18F-FDG-Labeled T Lymphocytes for Diagnosis of Acute Rat Renal Allograft Rejection. Journal of Nuclear Medicine 2013; 54: 1147 – 1153. DOI: 10.2967/ jnumed.112.109231. 02 Rush D. Protocol transplant biopsies: an underutilized tool in kidney transplantation. Clin J Am Soc Nephrol 2006; 1: 138 – 143. DOI: 10.2215/CJN.00390705 03 Racusen LC, Solez K, Colvin RB et al. The Banff 97 working classification of renal allograft pathology. Kidney Int 1999; 55: 713 – 723. DOI: 10.1046/j.1523-1755.1999.00299.x 04 Bettinger T, Bussat P, Tardy I et al. Ultrasound molecular imaging contrast agent binding to both E- and P-selectin in different species. Invest Radiol 2012; 47: 516 – 523. DOI: 10.1097/RLI.0b013e31825cc605 05 Morath C, Ritz E, Zeier M. Protocol biopsy: what is the rationale and what is the evidence? Nephrology Dialysis Transplantation 2003; 18: 644 – 647. DOI: 10.1093/ndt/gfg036 06 Schlosser T, Pohl C, Kuntz-Hehner S et al. Echoscintigraphy: a new imaging modality for the reduction of color blooming and acoustic shadowing in contrast sonography. Ultrasound Med Biol 2003; 29: 985 – 991 07 Chapman JR. Do protocol transplant biopsies improve kidney transplant outcomes? Current Opinion in Nephrology and Hypertension 2012; 21: 580 – 586. DOI: 10.1097/MNH.0b013e32835903f4 08 Solez K, Colvin RB, Racusen LC et al. Banff 07 Classification of Renal Allograft Pathology: Updates and Future Directions. Am J Transplant 2008; 8: 753 – 760. DOI: 10.1111/j.1600-6143.2008.02159.x 09 Schwarz A, Hiss M, Gwinner W et al. Course and relevance of arteriovenous fistulas after renal transplant biopsies. Am J Transplant 2008; 8: 826 – 831. DOI: 10.1111/j.1600-6143.2008.02160.x 10 El-Mekresh M, Osman Y, Ali-El-Dein B et al. Urological complications after living-donor renal transplantation. BJU Int 2001; 87: 295 – 306 11 Feige JN, Sage D, Wahli W et al. PixFRET, an ImageJ plug-in for FRET calculation that can accommodate variations in spectral bleed-throughs. Microsc Res Tech 2005; 68: 51 – 58. DOI: 10.1002/jemt.20215 12 Muthukumar T, Dadhania D, Ding R et al. Messenger RNA for FOXP3 in the urine of renal-allograft recipients. N Engl J Med 2005; 353: 2342 – 2351. DOI: 10.1056/NEJMoa051907 13 Suthanthiran M, Schwartz JE, Ding R et al. Urinary-Cell mRNA Profile and Acute Cellular Rejection in Kidney Allografts. N Engl J Med 2013; 369: 20 – 31. DOI: 10.1056/NEJMoa1215555 14 Meier-Kriesche HU, Schold JD, Srinivas TR et al. Lack of improvement in renal allograft survival despite a marked decrease in acute rejection rates over the most recent era. Am J Transplant 2004; 4: 378 – 383 15 Cosgrove DO, Chan KE. Renal transplants: what ultrasound can and cannot do. Ultrasound Q 2008; 24 (2): 77 – 87; quiz 141-2. DOI: 10.1097/RUQ.0b013e31817c5e46 16 Opelz G, Döhler B. Collaborative Transplant Study Report. Influence of time of rejection on long-term graft survival in renal transplantation. Transplantation 2008; 85: 661 – 666. DOI: 10.1097/ TP.0b013e3181661695 17 Radermacher J, Mengel M, Ellis S et al. The renal arterial resistance index and renal allograft survival. N Engl J Med 2003; 349: 115 – 124. DOI: 10.1056/NEJMoa022602
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
18 Mehrsai A, Salem S, Ahmadi H et al. Role of resistive index measurement in diagnosis of acute rejection episodes following successful kidney transplantation. Transplant Proc 2009; 41: 2805 – 2807. DOI: 10.1016/j.transproceed.2009.07.050 19 El Ters M, Grande JP, Keddis MT et al. Kidney Allograft Survival After Acute Rejection, the Value of Follow-Up Biopsies. American Journal of Transplantation 2013; 13: 2334 – 2341. DOI: 10.1111/ajt.12370 20 Grzelak P, Szymczyk K, Strzelczyk J et al. Perfusion of kidney graft pyramids and cortex in contrast-enhanced ultrasonography in the determination of the cause of delayed graft function. Ann Transplant 2011; 16: 48 – 53 21 Benozzi L, Cappelli G, Granito M et al. Contrast-enhanced sonography in early kidney graft dysfunction. Transplant Proc 2009; 41: 1214 – 1215. DOI: 10.1016/j.transproceed.2009.03.029 22 Cornell LD, Smith RN, Colvin RB. Kidney transplantation: mechanisms of rejection and acceptance. Annu Rev Pathol 2008; 3: 189 – 220. DOI: 10.1146/annurev.pathmechdis.3.121806.151508 23 Rosenblum JM, Shimoda N, Schenk AD et al. CXC Chemokine Ligand (CXCL) 9 and CXCL10 Are Antagonistic Costimulation Molecules during the Priming of Alloreactive T Cell Effectors. The Journal of Immunology 2010; 184: 3450 – 3460. DOI: 10.4049/jimmunol.0903831 24 Nankivell BJ, Alexander SI. Rejection of the kidney allograft. N Engl J Med 2010; 363 (15): 1451 – 1462. DOI: 10.1056/NEJMra0902927 25 Lindner JR. Molecular imaging of cardiovascular disease with contrastenhanced ultrasonography. Nat Rev Cardiol 2009; 6 (7): 475 – 481. DOI: 10.1038/nrcardio.2009.77 26 Reuter S, Schnöckel U, Schröter R et al. Non-Invasive Imaging of Acute Renal Allograft Rejection in Rats Using Small Animal 18F-FDG-PET. PLoS ONE 2009; 4: e5296 Zoccali C, ed. DOI: 10.1371/journal. pone.0005296.t003 27 Grabner A, Kentrup D, Schnöckel U et al. Non-invasive Imaging of Acute Allograft Rejection after Rat Renal Transplantation Using 18F-FDG PET. JoVE 2013; DOI: doi:10.3791/4240 28 Reuter S, Velic A, Edemir B et al. Protective role of NHE-3 inhibition in rat renal transplantation undergoing acute rejection. Pflugers Arch 2008; 456: 1075 – 1084. DOI: 10.1007/s00424-008-0484-7 29 Reuter S, Schnöckel U, Edemir B et al. Potential of Noninvasive Serial Assessment of Acute Renal Allograft Rejection by 18F-FDG PET to Monitor Treatment Efficiency. Journal of Nuclear Medicine 2010; 51: 1644 – 1652. DOI: 10.2967/jnumed.110.078550 30 Perico N, Cattaneo D, Sayegh MH et al. Delayed graft function in kidney transplantation. Lancet 2004; 364 (9447): 1814 – 1827. DOI: 10.1016/ S0140-6736(04)17406-0 31 Kondo I. Leukocyte-Targeted Myocardial Contrast Echocardiography Can Assess the Degree of Acute Allograft Rejection in a Rat Cardiac Transplantation Model. Circulation 2004; 109 (8): 1056 – 1061. DOI: 10.1161/01.CIR.0000115586.25803.D5 32 Weller GER, Lu E, Csikari MM et al. Ultrasound imaging of acute cardiac transplant rejection with microbubbles targeted to intercellular adhesion molecule-1. Circulation 2003; 108: 218 – 224. DOI: 10.1161/01. CIR.0000080287.74762.60 33 Fischer T, Dieckhöfer J, Mühler M et al. The use of contrast-enhanced US in renal transplant: first results and potential clinical benefit. Eur Radiol Suppl 2005; 15 (Suppl 5): e109 – e116. DOI: 10.1007/s10406-0050173-y 34 Peters AM, Danpure HJ, Osman S et al. Clinical experience with 99mTchexamethylpropylene-amineoxime for labelling leucocytes and imaging inflammation. Lancet 1986; 2: 946 – 949 35 Dumarey N. Imaging with FDG labeled leukocytes: is it clinically useful? Q J Nucl Med Mol Imaging 2009; 53: 89 – 94 36 Doudet DJ, Cornfeldt ML, Honey CR et al. PET imaging of implanted human retinal pigment epithelial cells in the MPTP-induced primate model of Parkinson's disease. Exp Neurol 2004; 189: 361 – 368. DOI: 10.1016/j.expneurol.2004.06.009 37 Forstrom LA, Dunn WL, Mullan BP et al. Biodistribution and dosimetry of [(18)F]fluorodeoxyglucose labelled leukocytes in normal human subjects. Nucl Med Commun 2002; 23: 721 – 725 38 Claudon M, Dietrich C, Choi B et al. Guidelines and Good Clinical Practice Recommendations for Contrast Enhanced Ultrasound (CEUS) in the Liver – Update 2012. Ultraschall in Med 2013; 34: 11 – 29. DOI: 10.1055/s-0032-1325499 39 Dietrich C, Averkiou M, Correas JM et al. An EFSUMB Introduction into Dynamic Contrast-Enhanced Ultrasound (DCE-US) for Quantification of Tumour Perfusion. Ultraschall in Med 2012; 33: 344 – 351. DOI: 10.1055/s-0032-1313026
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Noninvasive Imaging of Acute Renal Allograft Rejection by Ultrasound Detection of Microbubbles Targeted to T-lymphocytes in Rats Ultraschall-basierte Diagnostik der akuten Nierentransplantatrejektion mittels Antikörper-markierter Microbubbles und humaner T-Lymphozyten im Rattenmodell Authors
A. Grabner1*, D. Kentrup1*, M. Mühlmeister1, H. Pawelski1, C. Biermann1, T. Bettinger2, H. Pavenstädt1, E. Schlatter1, K. Tiemann3*, S. Reuter1*
Affiliations
1
3
Department of Medicine D, Experimental Nephrology, University Hospital Münster, Germany Bracco Suisse SA, Bracco Suisse SA, Geneva, Italy Department of Nuclear Medicine, Technical University Munich, Germany
Key words
Abstract
Zusammenfassung
"
!
!
Purpose: We propose CD3-antibody-mediated contrast-enhanced ultrasonography using human T-lymphocytes for image-based diagnosis of acute allograft rejection (AR) established in a rat renal transplantation model. Materials and Methods: 15 minutes after tail vein injection of 30 × 106 human T-lymphocytes, contrast media/microbubbles conjugated with an anti-human CD3 antibody was applied to uni-nephrectomized 10-week-old allogeneically transplanted male rats (Lewis-Brown Norway (LBN) to Lewis, aTX) and ultrasound was performed to investigate the transplanted kidney as well as the native kidney. In vivo results were confirmed via immunohistochemical stainings of CD3 after post mortem dissection. Syngeneically transplanted rats (LBN to LBN, sTX), rats with ischemia/reperfusion injury (IRI, 45 min. warm ischemia), and rats subjected to acute cyclosporin A toxicity (CSA) (cyclosporine 50 mg/kg BW for 2 days i. p.) served as controls. Results: Accumulation of human T-lymphocytes was clearly detected by antibody-mediated sonography und was significantly increased in allografts undergoing AR (5.41 ± 1.32 A. U.) when compared to native control kidneys (0.70 ± 0.08 A. U.). CD3 signal intensity was low in native kidneys, sTX (0.99 ± 0.30 A. U.), CSA (0.10 ± 0.02 A. U.) and kidneys with IRI (0.46 ± 0.29 A. U.). Quantification of the ultrasound signal correlated significantly with the T-cell numbers obtained by immunohistochemical analysis (R2 = 0.57). Conclusion: Contrast-enhanced sonography using CD3-antibodies is an option for quick and highly specific assessment of AR in a rat model of renal transplantation.
Ziel: Evaluation des Kontrastmittel-gestützten Ultraschalls unter Verwendung humaner T-Lymphozyten und anti-CD3-markierter Microbubbles zur Detektion und Differentialdiagnostik der akuten renalen Abstoßung im Transplantationsmodell der Ratte. Material und Methoden: 30 × 106 humane T-Zellen wurden uninephrektomierten, allogen nierentransplantierten Ratten (LBN auf Lewis) am 4. postoperativen Tag (POD4) injiziert. 15 min später erfolgte die i. v. Gabe humanspezifischer anti-CD3 Antikörpermarkierter Microbubbles. Die Akkumulation humaner T-Zellen und gebundener Microbubbles wurde mittels Kleintierultraschall im Nierentransplantat und der Kontrollniere festgestellt und quantifiziert. Als Differentialdiagnose dienten syngen transplantierte Nieren (LBN auf LBN), Nieren mit warmem Ischämie/Reperfusionsschaden und Nieren mit akuter Calcineurin-inhibitortoxizität. Die Signalstärke der Ultraschallmessung wurde mit der Nierenhistologie (Banff Score, CD3 Färbung) korreliert. Ergebnisse: Ratten mit akuter Abstoßung zeigten am POD4 eine signifikante Akkumulation humaner T-Zellen und Microbubbles in der allogenen Transplantatniere (5,41 ± 1,32 A. U., p < 0,05, n = 4 – 10 in allen Gruppen) im Vergleich zur gesunden Eigenniere (0,70 ± 0,08 A. U.). Syngen transplantierte Nieren ohne Rejektion (0,99 ± 0,30 A. U.), Nieren mit akuter Cyclosporin A Toxizität (0,10 ± 0,02 A. U.), bzw. akutem Ischämie/Reperfusionsschaden (0,46 ± 0,29 A. U.) wiesen keine erhöhte Anhäufung auf. Die Signalstärke des kontrastmittelgestützten Ultraschalls korrelierte in allen Nierenschädigungsmodellen signifikant mit der histologischen Quantifizierung des inflammatorischen Infiltrates. Schlussfolgerungen: Mithilfe von T-Zellen und Antikörper-markierter Microbubbles ermöglicht die Kontrastmittel-gestützte Sonographie eine frühe und spezifische Diagnose der akuten Nierentransplantatabstoßung.
● diagnostic radiology ● ultrasound ● molecular imaging ● microbubbles ● transplantation " " " "
received accepted
4.3.2014 8.11.2014
Bibliography DOI http://dx.doi.org/ 10.1055/s-0034-1385796 Published online: 2015 Ultraschall in Med © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0172-4614 Correspondence Dr. Alexander Grabner Department of Medicine D, Experimental Nephrology, University Hospital Münster Albert-Schweitzer Campus 1, A14 48149 Münster Germany Tel.: ++ 49/2 51/8 35 81 30 alexander.grabner@ ukmuenster.de
* Contributed equally
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
2
Introduction !
At present, patients with impaired renal allograft function (characterized e. g. by elevated serum creatinine and/or blood urea nitrogen, proteinuria and/or changes in diuresis) typically undergo biopsy for the diagnosis of acute transplant rejection (AR) [1 – 3]. Nevertheless, more than 50 % of all rejection episodes occur subclinically without impairment of renal function, but mostly with histological changes equivalent to patients with a decreased glomerular filtration rate [4, 5]. Therefore, protocol biopsies at a defined time course after transplantation, independent of graft function, are suggested by some authors to diagnose AR [6, 7]. However, core needle biopsy as an invasive method bares several disadvantages like the risk of significant graft injury. Moreover, it is not feasible in patients under anticoagulation therapy and the inherent small sampling site might miss AR, especially if rejection is focal or patchy [8 – 10]. Thus, noninvasive methods based on the detection of specific biomarkers would be preferable. Although this can be achieved by measuring serum or urine samples (e. g. FOXP3 mRNA or CD3ε mRNA) [11 – 13], entirely image-based methods stand out by enabling visualization of the whole organ. In this regard ultrasonography is an easily accessible, reproducible and inexpensive tool for the diagnostic investigation of the renal transplant [14, 15]. Several efforts have been made to specifically diagnose AR, e. g. by calculating the resistance index [16 – 18] or by the usage of contrast-enhanced ultrasonography (CEUS) [19 – 21]. Nevertheless, at present biopsy is still required to differentiate AR from its main differential diagnoses of acute tubular necrosis (ATN) and calcineurin inhibitor toxicity (CSA) [15]. AR is a complex mechanism comprising the recipient’s immune system and foreign antigens (alloantigens), mostly major histocompatibility complex (MHC) molecules. Acute cellular rejection is mainly mediated by both CD4+ and CD8+ T-lymphocytes, whereas B-cells, the innate immune system consisting of monocytes/macrophages, the complement system, neutrophils and dendritic cells also contribute[22]. After recognition of alloantigens T-cells become activated, proliferate and migrate to the allograft. Thereby several chemokines, e. g. CXCL9, play a distinct role in the chemotaxis of activated T-cells [23]. Finally, effector T-lymphocytes infiltrate the interstitial department causing local destruction [24]. Since infiltration of T-cells appears before allograft dysfunction occurs, imaging employing lymphocytes is a promising tool for sensitive and early detection of AR. Thus, we recently established positron emission tomography (PET) using 18F-FDGlabeled human T-lymphocytes in a rat renal transplant model [1]. However, the main limitations of this approach are exposure to radiation, availability of PET and high expenses. Therefore, sonography-based molecular imaging of AR might be a better alternative [25]. Nevertheless, specific targeting of graft infiltrating T-lymphocytes with CEUS has never been tested before. Hence, we aimed to clarify whether CD3-mediated ultrasound is able to detect renal AR, to differentiate it from ATN and CSA, and to assess the degree of inflammation.
ard rat chow (Altromin, Lage, Germany) and tap water were used for all experiments (4 – 6 animals per group). Experiments were approved by a governmental committee on animal welfare and were performed in accordance with national animal protection guidelines. Surgeries were performed under anesthesia via intraperitoneal (i. p.) administration of ketamine 100 mg/kg body weight and xylazine 5 mg/kg BW (Xylazin, Ketamin, CEVA Tiergesundheit, Düsseldorf, Germany). Further doses of ketamine were injected as needed. For imaging experiments anesthesia was maintained by continuous application of medical air/isoflurane 2 % (Abbott, Wiesbaden, Germany). Transplantation was simultaneously performed by two investigators as described previously[1, 26] and recently published in detail elsewhere [27]. In short, the left kidney including urethra, renal artery, pieces of aorta and renal vein was transplanted into a uni-nephrectomized age- and weight-matched recipient (LBN to LEW, aTX). The chosen aTX model leads to histological and functional changes typical for acute rejection [26, 28, 29]. Syngeneically transplanted rats (LBN to LBN, sTX), healthy control rats as well as rats (LEW) with two common differential diagnoses of AR, i. e. ATN after IRI induced by ligation of the left renal artery for 45 minutes and rats with acute CSA nephropathy occurring after application of 50 mg/kg CSA (Sandimmun, Novartis, Nuremberg, Germany) i. p. for two days, served as controls (protocols analogous to [26]).
T-Cell Isolation There are several reasons for choosing human T-cells. Besides being easily accessible, the applied T-cells can be specifically detected within the graft for ex vivo verification of in vivo signals. The concept that the T-cell milieu of AR strongly attracts further T-cells which do not essentially need allograft specificity has been proven before[1]. In short, the applied T-cells follow a chemokine gradient and adhere to the luminal side of the grafts vessels. There, still exposed to the bloodstream, they can be used for specific visualization of a T-cell milieu (“signal amplifier”) by circulating microbubbles. Extravascular targets however, like secreted chemokines or T-cells which have already passed the vascular wall and reside inside the grafts tissue, cannot be directly detected by the latter. Buffy coats from human healthy donors mainly consisting of white blood cells, red blood cells and platelets were purchased at the German Red Cross (DRK) Münster, Germany. T-lymphocytes were isolated by negative antibody selection using the RosetteSep® method according to the manufacturer’s protocol (Stemcell, Cologne, Germany) as described previously[1].
Labeling of Microbubbles 3 × 108 microbubbles (BG6438, Bracco Suisse SA, Geneva, Switzerland) functionalized with streptavidin were labeled with 7.5 µg biotinylated anti-human anti-CD3-antibodies (ab28 071, Abcam, Cambridge, United Kingdom) by incubation for 30 minutes at room temperature (see details for microbubble preparation in [4]). Unlabeled microbubbles and IgM isotype control labeled microbubbles served as controls (20 µg of biotinylated rat IgM Isotype control (RTK2118 (clone) Fisher Scientific Waltham MA USA).
Materials and Methods !
Image Acquisition
Animal Models
Image acquisition using an HDI-5000 ultrasound system (Philips Healthcare, Best, The Netherlands) was performed 1 – 4 days after transplantation under general anesthesia delivered through a nose mask while heart rate and body temperature were maintained.
Male Lewis–Brown-Norway (LBN) and Lewis (LEW) rats (200 – 270 g body weight (BW), Janvier, Le Genest Saint Isle Saint, France and Charles River, Sulzfeld, Germany) with free access to stand-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Original Article
Abb. 1 Beispielultraschallbilder von aTX und sTX Ratten, Ratten mit IRI oder akuter CSA Toxizität sowie einer gesunden Kontrollratte. Gezeigt werden Transversalschnitte vom Tag 4 nach Operation, 15 min nach Infusion von 30 × 106 T-Lymphozyten in eine Schwanzvene vor (pre CM) und 2 min nach (post CM) Gabe von anti-CD3-markierten Kontrastmittelbläschen. POD: postoperativer Tag, CM: Kontrastmittel, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Imaging was performed using a high frequency 15 MHz linear array transducer at an MI of 1.1 in destructive intermittent imaging mode (0.5 Hz). The transplanted kidney and control kidney were simultaneously imaged. Gain settings at baseline were adjusted to be close to the noise floor to allow optimal use of the dynamic range (50 dB) for microbubble imaging. 15 minutes after tail vein injection of 30 × 106 human T-lymphocytes, a baseline image of both kidneys was recorded followed by the bolus application of
9 × 107 anti-CD3 labeled microbubbles while the ultrasound system was paused. The ultrasound transducer was kept in a stable position and after a waiting period, when microbubbles were cleared from the blood stream (5 – 7 minutes), contrast images were acquired. In order to avoid contamination of image analysis by circulating bubbles, clearance of contrast bubbles was confirmed by means of imaging of the heart chamber using an additional transducer. A short imaging sequence was obtained for de-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Fig. 1 Examples of ultrasound kidney images of aTX and sTX rats, rat with IRI, rat with acute CSA toxicity, and native controls. Shown are transverse images on POD4 15 minutes after tail vein injection of 30 × 106 T-lymphocytes before (pre-CM) and 2 minutes after (post-CM) application of anti-CD3-labeled microbubbles. For visualization of post-CM images, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. POD: postoperative day, CM: contrast media, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A (toxicity).
Fig. 2 T-lymphocyte accumulation was assessed in all groups of kidneys. As early as on POD2 aTX kidneys showed a significantly increased ultrasound signal, when compared to native controls (P < 0.0001). Control kidneys including syngeneically transplanted kidneys, kidneys with IRI and kidneys with acute CSA toxicity did not show any significant difference when compared to native controls. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity. Abb. 2 Die T-Lymphozyten Akkumulation in den Nieren wurde in allen Gruppen gemessen. Bereits 2 Tage nach allogener Nierentransplantation zeigten die Transplantatnieren signifikant stärkere Ultraschallsignale als gesunde Eigennieren (P < 0.0001). Kontrollnieren inklusive syngen transplantierter Nieren, Nieren mit IRI oder akuter CSA Toxizität unterschieden sich dagegen hinsichtlich der Signalintensität nicht von gesunden Eigennieren. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: IschämieReperfusionsschaden, CSA: Cyclosporin A (Toxizität).
structive contrast imaging, and imaging was stopped when bubble signals disappeared (5 – 8 frames). Animals were immediately sacrificed and kidneys were isolated and prepared for histological analysis.
Image Quantification Images were stored as raw data prior to scan conversion (Rθdata) and analyzed off-line by means of a calibrated software package as previously published[6]. Briefly, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. Image analysis was performed in an image frame created of background subtracted images displaying maximal signal intensity by drawing regions of interest (ROI) to cover the parenchyma of the transplanted or control kidney. Linearized Rθ-data was expressed as acoustical units.
Histology and Immunohistochemistry Portions of kidneys were snap-frozen and fixed using 4 % formaldehyde in PBS. Paraffin embedded tissue was stained using Periodic-acid-Schiff (PAS) and histological changes were evaluated by light microscopy. In addition, graft infiltration was quantified " Table 1) using the ti-score (total interstitial inflammation score,● according to Solez et al.[8]. For evaluation of T-lymphocyte infil-
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Fig. 3 Examples of ultrasound kidney images of an aTX rat. Shown are transverse images on POD4 15 minutes after tail vein injection of 30 × 106 T-lymphocytes before (pre-CM) and 2 minutes after (post-CM) application of microbubbles alone or microbubbles labeled with an isotype control antibody. For the visualization of post-CM images, baseline images prior to contrast injection were averaged and subtracted from contrast image sequences. POD: postoperative day, CM: contrast media, aTX: allogeneically transplanted, MB: microbubbles Abb. 3 Beispielultraschallbilder einer aTX Ratte. Gezeigt werden Transversalschnitte vom Tag 4 nach Operation vor (pre CM) und 2 Min. nach (post CM) i. v. Applikation von nicht gelabelten, (MB only) und IgG Kontrollantikörper gelabelten Kontrastmittelbläschen (IgG control). CM: Kontrastmittel, aTX: allogen transplantiert, MB: Kontrastmittelbläschen.
Table 1 grafts.
ti-score of control kidneys (CTR, sTX, IRI, CSA) and allogeneic
Group
ti-
Quantitative criteria for cellular
score
interstitial inflammation
CTR (31), sTX (4), IRI (1), CSA (10), aTX POD 1 (5)
ti0
no or trivial interstitial inflammation (< 10 % of parenchyma)
IRI (3), aTX POD 1 (2), 2 (4), 3 (2)
ti1
10 – 25 % of parenchyma inflamed
aTX POD 2 (2), 3 (2)
ti2
26 – 50 % of parenchyma inflamed
aTX POD 3 (1), 4 (5)
ti3
> 50 % of parenchyma inflamed
POD: postoperative day; number of samples in brackets, ti-score according to [8].
tration, kidney slices with a thickness of 3 µm were blocked with BSA 10 %, immunostained with antibodies against CD3 epsilon (RM-9107-S1, Thermo Fisher Scientific, Dreieich, Germany) and against human-specific CD3 epsilon (ab52 959, Abcam, Cambridge, United Kingdom) using the alkaline phosphatase method and counterstained with Haemalaun. Stainings without primary antibody served as controls. Image acquisition was performed using an Axio Zeiss microscope (Axiovert 100, Carl Zeiss AG, Oberkochen, Germany) equipped with a digital camera (AxiocamMRc, Carl Zeiss AG) using the AxionVisonLE Release 4.7.1 software (Carl Zeiss AG). Quantification of CD3-positive cells was accomplished in a semi-automated manner in 12 fields of view (FOV, 350 × 250 µm each) using ImageJPixFRET software (downloadable at http://rsb.info.nih.gov/ij/)[11].
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 4 Periodic-acid-Schiff staining revealed typical histological signs of AR namely glomerulitis, tubulitis and endothelialitis in aTX kidneys, which are absent in all controls (native contralateral control kidney, sTX, IRI and CSA) A. Consistently, a significant infiltration pattern with CD3-positive T-lymphocytes was found only in renal allografts, gradually increasing over time from POD1 to POD4 B. POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Abb. 4 Eine Periodic-acid-Schiff Färbung verdeutlicht typische histologische Zeichen der akuten Rejektion wie beispielsweise Glomerulitis, Tubulitis oder Endothelialitis in allogenen Transplantatnieren, wohingegen sich diese Zeichen in den Kontrollgruppen (kontralaterale Eigennieren, sTX, IRI und CSA) A nicht nachweisen ließen. Dazu passend fand sich eine signifikante Infiltration von CD3-positiven T-Lymphozyten nur in allogenen Transplantatnieren, wobei der Schweregrad der Infiltration von Tag 1 – 4 (POD1 – 4) kontinuierlich zunahm B. POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Original Article
Statistics Data was compared by ANOVA with a Scheffé multiple comparisons test. Data is presented as median ± range (n = number of rats, samples, or experiments). Significance was inferred at a level of P < 0.05.
Results !
Fig. 5 Semiautomated quantification of CD3-positive cells revealed a significant infiltration in allografts undergoing AR when compared to all other control groups. Of note, infiltration of T-lymphocytes increased over time after transplantation. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/ reperfusion injury, CSA: cyclosporine A toxicity. Abb. 5 Die halbautomatische Quantifizierung CD3-positiver Zellen zeigte eine im Vergleich zu den Kontrollgruppen signifikant erhöhte Lymphozyteninfiltration in allogenen Transplantaten mit laufender Abstoßung an. Es sei darauf hingewiesen, dass die Infiltratmenge mit zunehmendem Abstand vom Zeitpunkt der Transplantation zunimmt. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Quantitative Real-Time (RT) Polymerase Chain Reaction (PCR) Expression of the T-lymphocyte chemoattractant CXCL 9 was quantified by RT-PCR using CYBR Green PCR Master Mix on an ABI Prism 7700 Sequence Detection System. All instruments and reagents were purchased by Applied Biosystems. A list of specific primer pairs is shown in table 2. Relative gene expression was evaluated using the 2-ΔΔCt method with GAPDH as housekeeping gene.
Method Rats (Lewis, male, Charles River, Sulzfeld, Germany) were injected intravenously with 300 μl saline solution containing 1.5 μg biotinylated monoclonal mouse anti-rat CD3 antibody (ab95 508, Abcam, Cambridge, United Kingdom). Whole blood samples were collected in heparin blood collection tubes before and after (24 h) antibody infusion. Samples were stained with biotinylated anti-CD3 (ab95 508, Abcam, Cambridge, United Kingdom) followed by Streptavidin FITC (554 060, BD, Franklin Lakes, USA), anti-CD4 APC (ab25 617, Abcam, Cambridge, United Kingdom) and anti-CD8 PE (ab95 526, Abcam, Cambridge, United Kingdom) staining. Erythrocytes were lysed with BD Pharm Lyse (555 899, BD, Franklin Lakes, USA) according to the manufacturer and flow cytometric analyses were performed with BD FACSCalibur.
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Already one day after transplantation (postoperative day 1, POD1) a clearly increased T-lymphocyte signal was detected by CEUS in renal allografts (1.17 ± 0.23 A. U.), with a further increase from " Fig. 1, 2). Assessment of microbubble accumulaPOD2 to POD4 (● tion revealed a significant increase in renal allografts only, reaching significance on POD2 (4.30 ± 0.45 A. U.), when compared to native control kidneys (0.70 ± 0.08 A. U.). The intensity of the ultrasound signal peaked on POD4 (5.41 ± 1.32 A. U.). No significant differences in signal intensities were found between native controls and sTX (0.99 ± 0.30 A. U.), CSA (0.10 ± 0.02 A. U.) and kidneys " Fig. 2). Control microbubbles and with IRI (0.46 ± 0.29 A. U.) (● BR1 labeled microbubbles were tested in pilot studies and did not result in a significant increase in signal intensity in the aTX group " Fig. 3). or in any other group (●
Histology Histological evaluation of allografts showed typical signs of acute rejection namely marked glomerulitis, tubulitis, endothelialitis " Fig. 4A, " Table 1). For validation of and interstitial infiltration (● ● our data obtained by sonography, we estimated the degree of AR by quantifying the number of CD3-positive infiltrating T-lymphocytes. Allografts undergoing AR showed increased ti-scores (aTX " Table 1) POD1 (ti0 – 1), POD2 (ti1 – 2), POD3 (ti1 – 3), POD4 (ti3), ● as well as distinct infiltration with T-cells, already reaching signif" Fig. 4B, " Table 1; icance on POD1, when compared to controls (● ● ti-scores of CTR (ti0), sTx (ti0), IRI (ti0 – 1), CSA (ti0)). This infiltration pattern clearly increased over time reaching a maximum on " Fig. 5). Histological characteristics of AR as well as signiPOD4 (● ficant T-cell infiltration were completely absent in all other control " Fig. 5). Nevertheless, signs of significant renal damage groups (● like tubulitis, detachment of cells into the tubular lumen (ATN) or hyaline arteriolar thickening (CSA) were observed in distinct con" Fig. 4). trols confirming the presence of ATN or CSA (● To validate the origin of the obtained ultrasound signal, the applied human T-lymphocytes were detected by histological staining of rat kidneys using a human-specific antibody against the CD3 epsilon subunit. Although all kidneys had been perfused with physiological saline before further analysis, at least some human CD3-positive cells were found in allografts undergoing AR (aTX), whereas all other control groups (sTX, CSA, IRI) did not " Fig. 6). contain any relevant amount of human cells at all (●
Correlation of Sonography and Histology To verify our hypothesis that sonographic detection of infiltrating T-cells not only ascertains AR but also represents the degree of inflammation, we correlated our results obtained by ultrasound with the number of CD3-positive cells/FOV of each group. This correlation was found significant through all groups of kidneys " Fig. 7A). (R2 = 0.57) (●
Downloaded by: University of Pittsburgh. Copyrighted material.
CEUS
Fig. 6 Human T-lymphocytes could be detected by immunohistochemistry in renal allografts only (arrows: POD3, POD4) and were completely absent in all other control groups. POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Quantitative RT-PCR Using quantitative real-time PCR, we evaluated mRNA expression of chemokine (C-X-C motif) ligand 9 (CXCL9). Renal allografts only (aTXPOD4) exhibited a significant upregulation of CXCL9 when compared to control animals (Lewis CTR) (p < 0.0001). Concordantly isografts (sTX), kidneys with IRI and acute CSA toxicity did not show significant changes of CXCL9 expression (p > 0.05) " Fig. 6B). (●
Discussion !
Especially in the first days after transplantation, delayed graft function related to ATN occurs in 2 – 50 % of all cases [30]. At the same time empiric calcineurin inhibitor therapy is started and the dosage often has to be adapted within the next days using therapeutic drug monitoring. Thus, high as well as low levels of these drugs potentially cause toxic effects or can promote early
Abb. 6 Humane T-Lymphozyten konnten immunhistochemisch nur in allogenen Nierentransplantaten nachgewiesen werden (Pfeile POD3 und POD4); nicht dagegen in den Nieren der anderen Kontrollgruppen. POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
episodes of AR. Therefore, the presented method for noninvasive and specific detection of AR seems to be of special interest for clinicians working in the acute transplantation setting. Since AR is characterized by a distinct inflammation pattern, where mainly activated T-lymphocytes are recruited into the transplant, we recently established T-cell PET using 18F-FDG-labeled human T-lymphocytes for noninvasive detection and monitoring of renal allograft rejection[1]. Moreover, T-cell PET allows a highly specific characterization of AR from its two main differential diagnoses, namely ATN and CSA. Nevertheless, potential drawbacks of PET-based diagnosis of AR are the in general limited availability of PET, lack of simple repeatability, exposure to radiation and finally for economic reasons due to disproportionally high expenses. Sonography already plays a decisive role in daily clinical practice of transplant and especially kidney transplant medicine. Nevertheless, ultrasound-based specific tools targeting AR and distinguishing it from important differential diagnoses like acute tubule necrosis or
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 7 Correlation of quantified ultrasound intensity and infiltrating CD3 positive T-lymphocytes in different groups of kidneys. A significant correlation was found R2 = 0.57 A. Relative CXCL 9 mRNA expression was significantly upregulated in renal allografts only when compared to all other control groups B. Median values ± range. * indicates statistical significance to all other groups (P < 0.0001). SD: standard deviation, POD: postoperative day, aTX: allogeneically transplanted, sTX: syngeneically transplanted, IRI: ischemia/reperfusion injury, CSA: cyclosporine A toxicity.
Abb. 7 Es besteht eine signifikante Korrelation zwischen quantifizierter Ultraschallsignalintensität und T-Lymphozyten pro Gesichtsfeld (Histologie) (R2 = 0.57) A. Im Verglich zu den Nieren der Kontrollgruppen fand sich eine signifikante Hochregulation der relativen CXCL 9 mRNA Expression nur in allogenen Transplantatnieren B. Medianwerte ± Abweichung. * weist auf einen signifikanten Unterschied zu allen anderen Gruppen hin (P < 0.0001). SD: Standardabweichung, POD: postoperativer Tag, aTX: allogen transplantiert, sTX: syngen transplantiert, IRI: Ischämie-Reperfusionsschaden, CSA: Cyclosporin A (Toxizität).
Primer Gene
Sense
GAPDH
CATCAACGACCCCTTCATTGAC
Antisense ACTCCACGACATACTCAGCACC
CXCL 9
TGTGGAGTTCGAGGAACCCT
ACCCTTGCTGAATCTGGGTC
calcineurin inhibitor toxicity are still missing. Kondo et al. evaluated acute cardiac allograft rejection in rats using CEUS targeted to leukocytes [31]. Moreover, a similar study was performed specifically targeting intercellular adhesion molecule-1 (ICAM-1)[32]. However, both studies assessed cardiac AR only without considering relevant potential differential diagnoses. Since both infiltration of leukocytes as well as endothelial ICAM-1 expression are rather unspecific and can be observed in other inflammatory scenarios like IRI or urinary tract infection, these approaches lack the inevitable specificity for daily clinical application. Renal AR has already been assessed in patients by Fischer et al. using general blood pool echo enhancers[33]. Although episodes of AR were detected and even the effects of perirenal hematomas were shown, a general contrast agent mainly evaluates arterial blood inflow, thereby not distinguishing between different causes of renal perfusion defects. Therefore, we have chosen T-celldependent diagnostics and evaluated CEUS targeted to T-lymphocytes as a highly specific diagnostic tool to assess AR in an established rat model of renal AR in comparison to other renal pathologies (IRI/ATN or CSA). After application of T-lymphocytes and microbubbles labeled with anti-CD3 antibodies, ultrasound intensity was calculated in all used renal injury and transplant models. In comparison to controls without AR, allografts undergoing AR exhibited significantly increased ultrasound signal intensities after administration of CD3-labeled microbubbles as
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Table 2 Sequences of Primers used for RT-PCR.
early as on postoperative day 2 (POD2). Since isografts as well as kidneys with ATN and acute CSA toxicity with comparable degrees of kidney damage[26, 29] did not show significant changes in signal intensity, this approach allows a highly specific differential diagnosis of AR. To further validate our image-based measurements, we correlated the ultrasound signal intensity with the histological quantification of CD3-positive T-lymphocytes. A significant correlation of ultrasound intensity and T-cell number was found. Since the ultrasound signal intensity increased over time (from POD1 to POD4) with this method, it is not only possible to diagnose but probably also to assess the degree of AR in a quantitative fashion. In contrast to aTX kidneys, native control kidneys did not show any remarkable histological changes, again correlating strongly with our findings obtained by sonography. Finally, isografts as well as kidneys undergoing IRI/ATN or acute CSA toxicity only showed lower ti-scores and slight histological changes in terms of T-cell infiltration. Of note, isografts as well as kidneys with IRI showed mainly non-T-cell mediated inflammation, most likely representing ATN in both groups (in the isograft group inflammation arises from ischemia occurring during the renal transplantation procedure). A limitation of our approach is that antibody-mediated rejection will not be addressed. In cases of suspected antibody-mediated rejection, e. g. in highly immunized patients or patients with steroid-refractory rejection, a biopsy still has to be performed. As complement split product
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
Fig. 8 Effect of CD3 antibody administration on CD3+ T-cell population. Rats were injected intravenously with saline solution containing biotinylated monoclonal mouse anti-rat CD3 antibody (same concentration as used for sonography). Whole blood samples were collected before (0 h) and 24 h after antibody infusion. Samples were stained for CD3, CD4, CD8 and the proportion of T-cells was determined via flow cytometric analysis. A Representative plots of CD3+ T-cells, comparison of CD3+ T-cell population before and 24 h after antibody infusion. Results are expressed as mean ± SD (n = 3). B Quantification of CD3+ proportion. Student’s T test was performed and no significant difference was detected after the antibody treatment. C CD3 antibody treatment also had no effect on different T-cell populations. The proportion of CD4+ and CD8+ gated on CD3+ T-cells, remained the same before and after CD3 antibody treatment.
Abb. 8 Effekt der CD3-Antikörper-Applikation auf die CD3+ T-Zell Population. Kontrollratten erhielten biotinylierten monoklonalen Maus-antiRatten CD3 Antikörper i. v. appliziert. Vollblut wurde vor (0 h) und 24 h nach Gabe entnommen, T-Zellen wurden mittels CD3, CD4 und CD8 gefärbt und mittels FACS analysiert. A Repräsentative Plots CD3+ T-Zellen, sowie Vergleich der CD3+ T-Zell Population vor und 24 h nach Antikörpergabe. Dargestellt sind Medianwerte ± Standardabweichung (n = 3). B Quantifizierung der CD3+ T-Zellfraktion. Mittels Student’s T-Test konnte kein signifikanter Unterschied nach Antikörpergabe festgestellt werden. C CD3-Antikörpergabe hat keinen Effekt auf unterschiedliche T-Zellpopulationen. Der Anteil CD4+ and CD8+ Zellen blieb nach Gabe eines CD-Antikörpers unverändert.
C4 d plays a decisive role in the diagnosis of antibody-mediated rejection, we hypothesize that an approach using anti-C4 d imaging could be helpful to differentiate between both entities. In the field of nuclear medicine, molecular imaging using leukocytes is already a well-established method helping in the diagnosis of mainly inflammatory or infectious diseases[34, 35]. However, further preclinical and clinical studies are needed to assess the role of leukocyte-based imaging in the setting of (renal) AR and its differential diagnoses. Since this study utilizes human T-lymphocytes, one might question the fact that xenogeneic cells were used for imaging. However, others have established this before using xenogeneic epithelial cells[36]. Moreover, we have shown that 18F-FDG labeled human T-lymphocytes exhibit a distinct allocation in rats comparable to the biodistribution of ex vivo labeled autologous transferred leukocytes in healthy humans[37]. Finally allografts only exhibited a significant upregulation of CXCL9 mRNA expression, a strong chemokine inducing a local T-cell milieu attracting and activating new T-lymphocytes[23]. At present, a limitation of this application in humans appears to be the usage of an immunogenic streptavidin conjugation linking microbubbles and the appropriate antibodies. In addition, the high-power destructive imaging sequence with stable transducer
position might not be possible in a clinical scenario. This limitation, however, can be overcome by new transducer settings changing from high-power to low-power modes, allowing contrast quantification in real time [38, 39]. Nevertheless, our approach might easily be transferred into humans by using a different antibody-microbubble conjugation approach and simply targeting autologously isolated T-lymphocytes. Analogously to protocols used for nuclear imaging, T-cells need to be isolated from whole blood prior to imaging using a T-cell selection kit working with negative selection. For detection of AR, anti-CD3-microbubbles should be injected after adherence (~10 – 15 min) of the T-cell bolus at the graft vessels which works as a signal booster. Notably, our CEUS approach does not lead to relevant systemic T-cell " Fig. 8). Due to the small number of patients’ own depletion (● " Fig. 6) targeted by anti-CD3, inflammation will probT-cells (● ably not be promoted.
Conclusion !
We present and evaluate a CEUS-based approach to noninvasively assess renal AR and to improve post-transplant rejection monitoring. Using microbubbles targeted to applied T-lymphocytes,
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
this method allows early and highly specific diagnosis of AR. Additionally, it is capable of differentiating AR from ATN and CSA toxicity. Because T-cells play a key role in AR of solid organs, our approach is promising for the diagnosis of AR not only in kidneys but in solid organ transplanted humans. This should be addressed in future studies.
Acknowledgement !
This study was supported in part by the Deutsche Forschungsgemeinschaft (CRC 656 C7 & C3, PM12), the Interdisciplinary Centre for Clinical Research Münster, Germany (IZKF, Core Unit PIX) and the „Innovative Medical Research“ of the University of Münster Medical School. The authors are grateful to Richard Holtmeier, Rita Schröter and Ute Neugebauer for excellent technical assistance.
References 01 Grabner A, Kentrup D, Edemir B et al. PET with 18F-FDG-Labeled T Lymphocytes for Diagnosis of Acute Rat Renal Allograft Rejection. Journal of Nuclear Medicine 2013; 54: 1147 – 1153. DOI: 10.2967/ jnumed.112.109231. 02 Rush D. Protocol transplant biopsies: an underutilized tool in kidney transplantation. Clin J Am Soc Nephrol 2006; 1: 138 – 143. DOI: 10.2215/CJN.00390705 03 Racusen LC, Solez K, Colvin RB et al. The Banff 97 working classification of renal allograft pathology. Kidney Int 1999; 55: 713 – 723. DOI: 10.1046/j.1523-1755.1999.00299.x 04 Bettinger T, Bussat P, Tardy I et al. Ultrasound molecular imaging contrast agent binding to both E- and P-selectin in different species. Invest Radiol 2012; 47: 516 – 523. DOI: 10.1097/RLI.0b013e31825cc605 05 Morath C, Ritz E, Zeier M. Protocol biopsy: what is the rationale and what is the evidence? Nephrology Dialysis Transplantation 2003; 18: 644 – 647. DOI: 10.1093/ndt/gfg036 06 Schlosser T, Pohl C, Kuntz-Hehner S et al. Echoscintigraphy: a new imaging modality for the reduction of color blooming and acoustic shadowing in contrast sonography. Ultrasound Med Biol 2003; 29: 985 – 991 07 Chapman JR. Do protocol transplant biopsies improve kidney transplant outcomes? Current Opinion in Nephrology and Hypertension 2012; 21: 580 – 586. DOI: 10.1097/MNH.0b013e32835903f4 08 Solez K, Colvin RB, Racusen LC et al. Banff 07 Classification of Renal Allograft Pathology: Updates and Future Directions. Am J Transplant 2008; 8: 753 – 760. DOI: 10.1111/j.1600-6143.2008.02159.x 09 Schwarz A, Hiss M, Gwinner W et al. Course and relevance of arteriovenous fistulas after renal transplant biopsies. Am J Transplant 2008; 8: 826 – 831. DOI: 10.1111/j.1600-6143.2008.02160.x 10 El-Mekresh M, Osman Y, Ali-El-Dein B et al. Urological complications after living-donor renal transplantation. BJU Int 2001; 87: 295 – 306 11 Feige JN, Sage D, Wahli W et al. PixFRET, an ImageJ plug-in for FRET calculation that can accommodate variations in spectral bleed-throughs. Microsc Res Tech 2005; 68: 51 – 58. DOI: 10.1002/jemt.20215 12 Muthukumar T, Dadhania D, Ding R et al. Messenger RNA for FOXP3 in the urine of renal-allograft recipients. N Engl J Med 2005; 353: 2342 – 2351. DOI: 10.1056/NEJMoa051907 13 Suthanthiran M, Schwartz JE, Ding R et al. Urinary-Cell mRNA Profile and Acute Cellular Rejection in Kidney Allografts. N Engl J Med 2013; 369: 20 – 31. DOI: 10.1056/NEJMoa1215555 14 Meier-Kriesche HU, Schold JD, Srinivas TR et al. Lack of improvement in renal allograft survival despite a marked decrease in acute rejection rates over the most recent era. Am J Transplant 2004; 4: 378 – 383 15 Cosgrove DO, Chan KE. Renal transplants: what ultrasound can and cannot do. Ultrasound Q 2008; 24 (2): 77 – 87; quiz 141-2. DOI: 10.1097/RUQ.0b013e31817c5e46 16 Opelz G, Döhler B. Collaborative Transplant Study Report. Influence of time of rejection on long-term graft survival in renal transplantation. Transplantation 2008; 85: 661 – 666. DOI: 10.1097/ TP.0b013e3181661695 17 Radermacher J, Mengel M, Ellis S et al. The renal arterial resistance index and renal allograft survival. N Engl J Med 2003; 349: 115 – 124. DOI: 10.1056/NEJMoa022602
Grabner A et al. Noninvasive Imaging of … Ultraschall in Med
18 Mehrsai A, Salem S, Ahmadi H et al. Role of resistive index measurement in diagnosis of acute rejection episodes following successful kidney transplantation. Transplant Proc 2009; 41: 2805 – 2807. DOI: 10.1016/j.transproceed.2009.07.050 19 El Ters M, Grande JP, Keddis MT et al. Kidney Allograft Survival After Acute Rejection, the Value of Follow-Up Biopsies. American Journal of Transplantation 2013; 13: 2334 – 2341. DOI: 10.1111/ajt.12370 20 Grzelak P, Szymczyk K, Strzelczyk J et al. Perfusion of kidney graft pyramids and cortex in contrast-enhanced ultrasonography in the determination of the cause of delayed graft function. Ann Transplant 2011; 16: 48 – 53 21 Benozzi L, Cappelli G, Granito M et al. Contrast-enhanced sonography in early kidney graft dysfunction. Transplant Proc 2009; 41: 1214 – 1215. DOI: 10.1016/j.transproceed.2009.03.029 22 Cornell LD, Smith RN, Colvin RB. Kidney transplantation: mechanisms of rejection and acceptance. Annu Rev Pathol 2008; 3: 189 – 220. DOI: 10.1146/annurev.pathmechdis.3.121806.151508 23 Rosenblum JM, Shimoda N, Schenk AD et al. CXC Chemokine Ligand (CXCL) 9 and CXCL10 Are Antagonistic Costimulation Molecules during the Priming of Alloreactive T Cell Effectors. The Journal of Immunology 2010; 184: 3450 – 3460. DOI: 10.4049/jimmunol.0903831 24 Nankivell BJ, Alexander SI. Rejection of the kidney allograft. N Engl J Med 2010; 363 (15): 1451 – 1462. DOI: 10.1056/NEJMra0902927 25 Lindner JR. Molecular imaging of cardiovascular disease with contrastenhanced ultrasonography. Nat Rev Cardiol 2009; 6 (7): 475 – 481. DOI: 10.1038/nrcardio.2009.77 26 Reuter S, Schnöckel U, Schröter R et al. Non-Invasive Imaging of Acute Renal Allograft Rejection in Rats Using Small Animal 18F-FDG-PET. PLoS ONE 2009; 4: e5296 Zoccali C, ed. DOI: 10.1371/journal. pone.0005296.t003 27 Grabner A, Kentrup D, Schnöckel U et al. Non-invasive Imaging of Acute Allograft Rejection after Rat Renal Transplantation Using 18F-FDG PET. JoVE 2013; DOI: doi:10.3791/4240 28 Reuter S, Velic A, Edemir B et al. Protective role of NHE-3 inhibition in rat renal transplantation undergoing acute rejection. Pflugers Arch 2008; 456: 1075 – 1084. DOI: 10.1007/s00424-008-0484-7 29 Reuter S, Schnöckel U, Edemir B et al. Potential of Noninvasive Serial Assessment of Acute Renal Allograft Rejection by 18F-FDG PET to Monitor Treatment Efficiency. Journal of Nuclear Medicine 2010; 51: 1644 – 1652. DOI: 10.2967/jnumed.110.078550 30 Perico N, Cattaneo D, Sayegh MH et al. Delayed graft function in kidney transplantation. Lancet 2004; 364 (9447): 1814 – 1827. DOI: 10.1016/ S0140-6736(04)17406-0 31 Kondo I. Leukocyte-Targeted Myocardial Contrast Echocardiography Can Assess the Degree of Acute Allograft Rejection in a Rat Cardiac Transplantation Model. Circulation 2004; 109 (8): 1056 – 1061. DOI: 10.1161/01.CIR.0000115586.25803.D5 32 Weller GER, Lu E, Csikari MM et al. Ultrasound imaging of acute cardiac transplant rejection with microbubbles targeted to intercellular adhesion molecule-1. Circulation 2003; 108: 218 – 224. DOI: 10.1161/01. CIR.0000080287.74762.60 33 Fischer T, Dieckhöfer J, Mühler M et al. The use of contrast-enhanced US in renal transplant: first results and potential clinical benefit. Eur Radiol Suppl 2005; 15 (Suppl 5): e109 – e116. DOI: 10.1007/s10406-0050173-y 34 Peters AM, Danpure HJ, Osman S et al. Clinical experience with 99mTchexamethylpropylene-amineoxime for labelling leucocytes and imaging inflammation. Lancet 1986; 2: 946 – 949 35 Dumarey N. Imaging with FDG labeled leukocytes: is it clinically useful? Q J Nucl Med Mol Imaging 2009; 53: 89 – 94 36 Doudet DJ, Cornfeldt ML, Honey CR et al. PET imaging of implanted human retinal pigment epithelial cells in the MPTP-induced primate model of Parkinson's disease. Exp Neurol 2004; 189: 361 – 368. DOI: 10.1016/j.expneurol.2004.06.009 37 Forstrom LA, Dunn WL, Mullan BP et al. Biodistribution and dosimetry of [(18)F]fluorodeoxyglucose labelled leukocytes in normal human subjects. Nucl Med Commun 2002; 23: 721 – 725 38 Claudon M, Dietrich C, Choi B et al. Guidelines and Good Clinical Practice Recommendations for Contrast Enhanced Ultrasound (CEUS) in the Liver – Update 2012. Ultraschall in Med 2013; 34: 11 – 29. DOI: 10.1055/s-0032-1325499 39 Dietrich C, Averkiou M, Correas JM et al. An EFSUMB Introduction into Dynamic Contrast-Enhanced Ultrasound (DCE-US) for Quantification of Tumour Perfusion. Ultraschall in Med 2012; 33: 344 – 351. DOI: 10.1055/s-0032-1313026
Downloaded by: University of Pittsburgh. Copyrighted material.
Original Article
