Nonradioactive HLA Class II Typing Using Polymerase Chain Reaction and Digoxigenin- 11-2 '-3 '-dideoxyuridinetriphosphate-Labeled Oligonucleotide Probes C. Nevinny-Stickel, M.d.l.P. Betdno~i, A. Andreas M. Hinzpeter, K. Miihlegger, G. Schm/tz, and E. D. Albert

ABSTRACT: We describe a new, simple, rapid, and sensitive nonradioactive technique for the analysis of genetic variations. Genomic DNA was amplified using polymerase chain reaction and amplified DNA was hybridized, with digoxigenia (DIG)-labeled sequence-specific oligonucleotides. High specificity and sensitivity was achieved when labeling the sequence-specific oligonucleotide at the 3'end with only one DIG using digoxigenin-ll-2',3'-dideoxy-uridine-5'-triphosphate and DNA deoxynucleoddylexotransferase. The hybridized probes were detected using

ABBREVIATIONS 7-deaza-dATP 7-deaza-2 °-deoxyoadenosine5'-triphosphate DIG- 11-ddUTP digoxigenin- 1 l-2°,3°,-dideoxyuridine-5'-triphosphate DIG- 11-ddUTP DIG- 1 l-2',-deoxy-uridine-5' -triphosphate EDTA ethylenediaminetetraacetic acid HTC homozygous typing cell NBT 4-nitro blue tetrazolium chloride

From the Laberf~r lmmungenetik, Kinderpoliklinik, LMU Manchen ¢C.N.-S.; M.D.L.P.B.; A.A.; E.D.A.), Munich, and Boehringer Mannhelm, Biochemical Research Center CM.H.; K.M.: G.S.), Tutzing, Germany. Address reprint rcquests to E. D. Albert, Labor far lmmungenetik, Kinderpoliklinik I2~IU Miinchun, Pettenkoferstrasse 8a, 8000 Manchen 2, Germany. ReceivedSeptember 17, 1990: acceptedOctober31, 1990.

HumanImmunology51, 7-13 (1991) © AmericanSocie~for Histocompatibilityand lmmunogenetics,1991

antidigoxigenin alkaline phosphataso, lab frilgments, and X-phosphate/NBT for visualization. This method was applied to the analysis of HLA-DR4-DRB1 alleles in polymerase chain reaction-amplified genomic DNA and resuited in highly specific and sensitive hybridization signals discriminating even in cases of a one-b~se-pair mismatch. "H~istechnique is particularly suited for HLA oligotyping because it allows the use of tetramethylammonium chloride for the simplification of hybridization and washing conditions. Human Immunology 31, 7 - 1 3 (1991)

PCR RFLP SDS SSO SSPE TdT X-phosphate

polymerase chain reaction restriction fragment length polymorphisms lauryl sulfate sodium salt sequence-specific oligonucleotide saline sodium phosphate EDTA deoxynucleotidylexotrans ferase 5-brom-4-chloro3-indolyl-phospbate

INTRODUCTION The characterization of genetic variations in polymorphic D N A sequences is an important aspect for clinical diagnosis. The abilit?" to specifically amplify D N A sequences using the polymerase chain reaction (PCR) followed by hybridization with sequence-specific oligonu7 0198.8859/91/$3.50

8

C. Nevinny-Stickel et al.

cleotides (SSOs) [1, 2] has b e c o m e a powerful t e c h n i q u e for detailed analysis o f genetic variations. Traditionally, this t e c h n i q u e relied o n the 5 ' e n d radiolabeling (usually 32P-labeled) o f t h e SSO hybridization probe. Since radioactive labeling has m a n y disadvantages, such as expense, instability, cost for disposal o f radioactive waste, and i n c o n v e n i e n t handling, m a n y efforts have b e e n m a d e to replace t h e radioactive labeling o f t h e SSOs with nonradioactive alternatives. So far, m o s t o f the nonradioactive m e t h o d s described are based o n chemical derivatives o f t h e SSOs either with h a p t e n s followed by an antihapten detection system [ 3 - 1 8 ] or by direct labeling o f the oligonucleotides with e n z y m e s [ 1 9 - 2 4 ] . In this p a p e r we describe a new, rapid, sensifive, and simple nonradioactive t e c h n i q u e for t h e analysis o f genetic variations. This m e t h o d was applied to the subt"/pe analysis o f t h e H L A - D R 4 - D R B I alleles o f four h e t e r o z y g o u s healthy families.

MATERIALS

AND METHODS

H o m o z y g o u s Cell L i n e s

Human

T h e h o m o z y g o u s cell lines WS Nos. 9031, 9026, 9092, 9042, 9 0 7 6 o f t h e T e n t h International Histocompafibil-

TABLE 1 Person Eh

Sta

P M F1 F2 F3 F4 F5 P M F1 F2 F3 F4 P M F1 F2 F3 F4 F5 P M F1 F2 F3 F4

ity W o r k s h o p were used as reference. A l m o s t all o f t h e m were derived f r o m h o m o z y g o u s individuals w h o had b e e n tested repeatedly by serology and by t h e h o m o z y g o u s typing cell ( H T C ) m e t h o d for the definition o f t h e H L A - D w s u b t y p e s o f D R 4 [25]. Panel

Donors

Four families were investigated by serology, restriction f r a g m e n t l e n g t h p o l y m o r p h i s m (RFLP), and PCR/olig o n u c l e o t i d e typing u s i n g ~2P-labeled SSOs. Each family s h o w s haplotype segregation o f t h e H L A - D R 4 alleles (Table 1). Nonradioactive Labeling of Oligonucleotide Probes O l i g o n u c l e o t i d e s were synthesized by b i o - m e d (SchloB Ditfurth, T h e r e s , G e r m a n y ) according to s e q u e n c e s published by Scharf et al. [26, 27] (Table 2). N o n r a d i o active 3 ' e n d labeling o f t h e p r o b e s was p e r f o r m e d with digoxigenin-1 I - 2 ' , 3 ' - d i d e o x y - u r i d i n e - 5 ' - t r i p h o s p h a t e (DIG-11-ddUTP, Boehringer Mannheim GmbH, Germ a n y ) and D N A deoxynucleofidylexotransferase (TdT, B o e h r i n g e r M a n n h e i m G m b H ) . Nonradioactive 3'-tail-

Segregation o f D R 4 in f o u r healthy families as tested with t h r e e different m e t h o d s HLA typing DR serology DR4, DR2, DR4, DR4, DRw6, DRw6, DR4, DR4, DR3, DR4, DRT, DR4, DR7, DR2, DP,2, DR2, DR~-, DR2, DR2, DRw6, DR7, DRS, DRT, DR4, DR4, DR7,

DRw6 DR7 DR2 DR7 DR7 DR2 DR7 DR7 DR4 DR3 DR3 DR3 DR4 DRw6 DR4 DR2 DR2 DR4 DR2 DR4 DR4 DR4 DR5 DR4 DR4 DR4

DNA typing DRB RFLP [29] 4a, 2b, 4a, 4a, 6b, 6b, 4a, 4a, 3b, 4a, 7c, 4a, 7¢, 2a, 2a, 2a, 2a, 2a, 2a, 6c, 7b, 5a, 7b, 4a, 4a, 7b,

6b 7a 2b 7a 7a 2b 7a 7¢ 4a 3b 3b 3b 4a 6c 4a 2a 2a 4a 2a 4a 4a 4a 5a 4a 4a 4a

PCR/SSO typing DR4 general

DR4/DRB1 "0401

DR4/DRB1 *0402

+ +

-

+ + + + + + -

+

-

+ + + + + + + + + + + + + +

+ + + + + + + + +

Nonradioactive HLA Class 11 Typing

TABLE 2 SSO/primer

9

HLA-DRB typing SSO probes and primers Nucleotide sequences

GH 59 GH 101 GH 78

CATGTTFAACCTGCTCC GGAGCAGAAGCGGGCCGCG GACATCCTGGAAGACGAGC

GH 50 GH 46

CTCCCCAACCCCGTAGTTGTGTCTGCA CCGGATCCTTCGTGTCCCCACAGCACG

HLA-DRBI allele 0401-0408 0401 0402, 0103, 1102, 1301, 1302, 1301, 1302,

Specificity Hybrldizadon(SSPE, °C) Wash(°C) DR4 general DR4/Dw4 DR4/DwI0

5 x, 48°C 2 x, 60°C 3 x, 54°C

36°C 60°C 46oc

Each$SO probeis conjugatedwithDIG-I1-ddLrrPat the 3'endusingTdT.

ing of the probes was performed with a mixture of either digoxigenin-11-2'-deoxy-uridine-5'-triphosphate (DIG-11-dUTP)/2'-deoxy-adenosine-5'-triphosphate (dATP) (1:9) (Boehringer Mannheim GmbH) and TdT or DIG-11-dUTP/7-deaza-2'-deoxy-adenosine-5'-triphosphate (7-deaza-dATP) (1:9) (Boehringer Mannhelm GmbH). The reaction mixtures contained labeling buffet' (140 mM K-cacodylate, 30 mM Tris/HCl, pH 7.6, 0.1 mM dithiotbreitol), 100 pmol oligonucleotides, 10 nmol DIG-11-ddUTP (3'-end labeling), 10 nmol DIG-11-dUTP/dATP or DIG-11-dUTP/7-deaza-dATP (3'-tailing), 100 nmol CoC12, and 50 U TdT at a final volume of 20 tzl. The reaction mixture was incubated for 15 rain at 37°C. Labeled SSOs were purified either by ethanol precipitation or gel filtration on sephadex G-25.

sodium phosphate EDTA (SSPE) for 15 rain. After drying the membrane on Whatman 3MM paper, the D N A was immobilized on the nylon membrane by UV irradiation for 3 rain (UV-Kontakdampe Chroma 43, Vetter GmbH, Germany). After prehybridization of the membrane in 10 ml of hybridization solution containing SSPE (Table 2), 1% casein, 0.1% lauroylsarcosin, and 0.02% SDS (lauryl sulfate sodium salt), the membrane was hybridized for 1 hour in 5 ml hybridization solution containing 10 pmol of DIG-labeled probes. The temperature of hybridization is listed in Table 2. To remove excess of probe the membrane was first washed two times in i00 ml of wash solution 1 (2 x SSPE, 0.1% SDS) at room temperature for 5 rain and then washed two times in 100 ml of wash solution 2 (0.1 x SSPE, 0.1% SDS) at temperatures listed in Table 2.

Amplification of G e n o m i c D N A by PCR

Nonisotopic Detection

Genomic D N A was purified from white blood cells or B-cell lines as described previously [28]. The HLADRB genes were amplified using the PCR with the primers G H 46 and G H 50 [27] and Thermus aquaticus (Taq) D N A polymerase (Perkin Elmer/Cetus Corp., U.S.A.) [1, 2]. The reaction mixture contained 1 tzg genomic D N A , PCR buffer (10 mM Tris, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin), 25 pmol each of the primers, 20 nmol each of the nucleotides, and 2 U Thermus aquaticus D N A polymerase at a final volume of 100 V.I. Samples were subjected to 30 cycles of PCR, each consisting of 2 rain of denaturation at 94°C, 2 rain of annealing at 55°C, and 2 rain of extension at 72°C using a PCR processor (bio-med, SchloB Ditfurth). After the last cycle the samples were kept at 72°C for an additional 7 rain. The products of amplification were characterized by agarose gel electrophoresis.

After hybridization the membrane was rinsed in buffer 1 (0.1 M Tris/HCl, pH 7.5, 0.15 M NaCI) and then, for blocking of unspecific binding, the membrane was incubated in 100 ml of buffer 2 (0.1 M Tris/HCl, pH 7.5, 0.15 M NaCI, 1% casein) for 30 rain at room temperature. After briefly rinsing the membrane in buffer 1, 20 ml of buffer 1 containing 150 mU/mL of anti-DIG alkaline phosphatase, fab fragments (Boehringer Mannheim GmbH) were added and incubated for 30 rain at room temperature. To remove unbound antibody coniugate the membrane was washed two times wi.,h 100 ml of buffer I for 15 rain. For color development the membrane was first equilibrated for 2 rain with 20 ml of buffer 3 (0.1 M Tris/HCl, p H 9.5, 0.1 M NaCI, 50 mM MgClz) and then incubated with 10 ml of substrate solution [45/zi nitro blue tetrazolium chloride (NBT), 35/zl 5-bromo-4-chloro-3-1ndolyl-phosphate (X-phosphate) (Boehringer Mannheim GmbH)] in 10 ml of buffer 3 for 10 rain-6 h protected from light in a sealed plastic bag. The immunoreaction was stopped by washing with 100 ml of buffer 4 (10 mM Trls/HCl, pH 8.0, 1 mM EDTA). Documentation of the results was performed by ei-

D o t Blot Hybridization Amplified D N A (2/zl) was applied on a Biotrace RP nylon membrane (Gelman Science). The membrane was then shortly rinsed in 100 ml 0.4 M N a O H for 1 rain and after that immediately rinsed in 100 ml 10 x saline

C. Nevinny-Stickel et al.

ther photocopy of the dried membranes or photography of the wet membranes. Dried membranes can be stored for several months if light-protected. RESULTS Nonradioactive Dot Blot Hybridization of DRB-Amplified Genomic D N A with Different Labeled SSOs For our experiments four healthy HLA-DR4-positive families (Eh, Co, St, Sta) were chosen, each family consisting of father (P), mother (M), child 1 (FI), child 2 (F2), child 3 (F3), child 4 (F4), and child 5 (FS). These families were already HLA-typed by serology, RFLP, and PCR/oligonucleotide genotyping using the 3zP-labeled DR4 SSO GH59 (data not shown). From these experiments we knew beforehand that from family Eh, only P, F1, F2, and F5; from family Co, only P, M, F1, F3, and F4; from family St, only M, F3, and F5; and from family Sta, only P, M, F2, F3, and F4 should give a positive hybridization signal with the SSO GH59 (see also Table 1). As a reference we used five HTC lines from the Tenth International Histocompatibility Workshop (for a detailed description, see Materials and Methods). Genomic DNA of the four healthy families and of the five HTCs were amplified with PCR using the primers GH50 and GH46 (sequence listed in Table 2), which flank and define a 271 base pair segment of the FIGURE 1 Specificity of DiG-11-dUTP/dATP-tailed oligonucleotide probe for the HLA-DRBI*0401-0408 alleles on amplified DNA. The genotype of four health families (Eh, Co, St, Sta: P, father; M, mother; child 1, F1; child 2, F2; child 3, F3; child 4, F4; child 5, F5) was analyzed by PCR-SSO typing using GH59 SSO probe (specific for HLADRB1*0401-0408) tailed with DIG-11-dUTP/7-deazadATP. The following control DNAs from HTCs were used: A, HTC-9031 (DR4/Dw4); B, HTC-9026 (DR4/Dwl0); C, HTC-9092 (DR4/Dw14); D, HTC-9042 [DRll(5)/DwS]; Er, HTC-9076 (DR9).

HTC

A

B

C

e



~



~



D



~



~

~

~

P

~

~1

• a

~

-

~

~

~,

~

~

~

E. Co

e~



st sta

~

A

B

C

D

E

HTC ~ Eh ~7

@, ~

~

~

co ~

~!~i'

~

@ @

$

~

St

i st" !

M

~

~

$

FIGURE 2 Specificity of D1G-11-dUTP/7-deaza-dATPtailed oligonucleotide probe for the HLA-DRBI*0401-0408 alleles on amplified DNA. The genotype of four healthy families (Eh, Co, St, Sta: P, father; M, mother; child 1, F1; child 2, F2; child 3, F3; child 4, F4; child 5, F5) was analyzed by PCRSSO typing using GH59 SSO probe (specific for HLADRB1"0401-0408) tailed with DIG-11-dUTP/7-deazadATP. Control DNA~ from HTCs were used as described in Fig. 1.

polymorphic second exon sequence of the HLA-DRB locus [27, 29]. The amplified DNA was dotted on nylon membranes and hybridized with the SSO GH59 (see Table 2), which had been tailed with DIG-11-dUTP/ dATP using D N A TdT (for detailed conditions, see Materials and Methods). The nonradioactive detection was performed using anti-DIG alkaline phosphatase, fab fragments, and X-phosphatase/NBT for visualization. The results given in Fig. 1 show that although the sensitivity of the method is quite acceptable, nonspecific hybridization occurs (eg, see ST/F1 or ST/F2), which is not detectable when performing the experiment with 3ZP-labeled SS0 GH59 (data not shown). In an attempt to diminish nonspecific hybridization, we repeated the experiment described above, with the exception that the SS0 GH59 was now tailed with DIG-11-dUTP/7deaza-dATP. 7-deaza-dATP forms only one hydrogen bond, which we believed might reduce unspecific hybridization (Fig. 2). Since nonspecific hybridization could still be detected (see Fig. 2, ST/F2 or EH/F3), although it was slightly reduced, we had the idea to label the SSO GH59 with only one DIG using DIG-11ddUTP, thereby avoiding the tail at the 3'end of the SSO, which most likely caused the nonspecific hybridization. The experiment described above was again performed, this time using the DIG-11-ddUTP-labded SSO

Nonradioactive HLA Class 11 Typing

A

B

HTC

C

D

11

A

E

B

C

D

~

~"

~

~

Eh

~

0

Co St

~

Co

O

st

~ P

M

Sta F1

F3

F4

F5

FIGURE 3 Specificity of DIG-1 l-ddUTP-labeled oligonucleotide probe for the HLA-DRB 1"0401-0408 alleles on amplified DNA. The genotype of four healthy families (Eh, Co, St, Sta: P, father; M, mother; child I, FI; child 2, F2; child 3, F3; child 4, F4; child 5, F5) was analyzed by PCR-SSO typing using GH59 SSO probe (specific for HLA-DRBI°0401 0408) labeled with DIG-11-ddUTP. HTC control DNAs were used .as described in Fig. 1. G H 5 9 for hybridization. Figure 3 clearly demonstrates that when using DIG-11-ddUTP-labeled SSO GH59, only specific and no nonspecific hybridization is detectable. Subtyping of H L A - D R 4 - D R B I Alleles Using DIG-11-ddUTP-Labeled SSOs Since the hybridization with DIG-11-ddUTP-labeled SSO G H 5 9 resulted in specific and sensitive hybridization signals, we asked whether it would be possible to analyze the subtype of the HLA-DR4-DRB 1 alleles of the above-described four healthy DR4-positive families. As a reference we used the above-described five HTCs. The amplified D N A was spotted on nylon membranes and h]'bridized with DIG-11-ddUTP-labeled SSO probes G H 101 or GH78, respectively (sequences listed in Table 2). The SSO GH101 is designed to hybridize specifically with the allele DRBI*0401 (DR4/Dw4) (Fig. 4), whereas the SSO G H 7 8 is designed to hybridize specifically with the alleles DRBI*0402 (DR4/ Dwl0), DRBI*0103, D R B I * I I 0 2 , DRBl*1301, and DRBI*1302 [25]. All DR4-positive members of the family Co (P, M, F1, F3, F4) and four members of the DR4-positive family Sta (M, F2, F3, F4) specificahy hybridize with the DRBI*0401 (DR4/Dw4)-specific DIG-11-ddUTP-labeled oligonucleotide GH101 (Fig. 4), whereas the DR4 positive genotypes of the family

P

u

~

@

~

~

F2

5

~4

sta %

FIGURE 4 Specificity of DIG-I 1-ddUTP-la~led oligonucleotide probe for the HLA-DRBI*040! allele on amplified DNA. The genotype of four healthy families (Eh, Co, St, Sta: P, father; M, motber; child 1, FI; child 2, F2; child 3, F3; child 4, F4; child 5, FS) was analyzed by PCR-SSO typing using GFIIOI SSO probe (specific for HLA-DRBI*O40D laSded with DIG-11-ddUTP. HTC control DNAs were used as described in Fig. 1. Eh (P, F1, F2, F5) and two members of the family St (P, F5) specifically hybridize with the DRB~0402 (DR4/ Dw 10)-specific DIG- 1 l-ddUTP-labeled oligonucleotide G H 78 (Fig. 5). These results are in accordance with our previous data, in which the same experiments were performed with 32P-labeled SSO (data not shown). Hybridization of the two DRw6 positive members of FIGURE 5 Specificity of DIG-11-ddUTP-labcled oligonucleodde probe for the HLA-DRBI*0402 allele on amplified DNA. The genotype of four healthy families (Eh, Co, St, Sta: P, father; M, mother, child I, FI; child 2, F2; child 3, F3; child 4, F4; child 5, FS) was analyzed by PCR-SSO typing using GH78 SSO probe (specific for HLA-DRB 1"0402) la&ledwkh DIG-I I-ddUTP. Control DNAs from HTCs were used as described in Fig. 1. A HTC

B ~

®

C

D

~

~

E

" Eh

co ~

=

st Sta

M

~

12

the family St with the SSO GH78 is a well-known crosshybridization due to sequence identity (Fig. 5 and Table 2) [26]. DISCUSSION In the present study we describe a new, sensitive, simple, and rapid nonradioactive technique for the analysis of genetic variations of HLA genes using PCR-~raplified DNA hybridized with DRB SSOs, which have been labeled at the 3'end with DIG. In order to work out the best labeling procedure we first compared tailing of the SSO with DIG-11-dUTP/dATP or DIG-11-dUTP/7deaza-dATP, respectively, using DNA TdT. Both of the tailing procedures resulted in a sensitivity comparable to 32P-labeling of the SSO but showed nonspecific hybridization signals (Figs. 1 and 2). As a solution to this problem, we decided to label the SSO with only one DIG, using DIG-11-ddUTP and TdT. With this procedure we expected higher specificity but probably less sensitivity. Surprisingly, we found the same sensitivity as before, combined with the expected higher specificity (Fig. 3). Since labeling of the SSO with DIG-11-ddUTP seems to be as good as 32P-labeling with regard to sentitivity ~-nd specificity, we tested our labeling procedures in subtyping analysis of the HLA-DR4-DRB1 alleles, where high sensitivity and specificity is an absolute prerequisite. Figure 4 and 5 clearly demonstrate that the DIG-11-ddUTP-labeled SSOs specifically hybridize with the amplified genomic DNA, exhibiting a sensitivity equivalent to that of 3ZP-labeling. In summary, the major advantages of oligonucleotide labeling with DIG11-ddUTP using TdT and detection of the hybridized oligonucleotides with anti-DIG alkaline phosphatase, fab fragments, and X-phosphatase/NBT are that this method is ver~ simple and rapid (labeling and purification of the SSO takes less than 1 hour; prehFbridization and hybridization, including all washing steps, take less than 3 h; the detection of the hybridized SSO takes, depending on the SSO, about 3 h). Hybridization with DIG-11-ddUTP-labeled SSOs achieves at least the same sensitivity and specificity as 3~P-labeling of the SSOs. In addition, the DIG-11-ddUTP-labeled SSOs are stable for at least 6 months when stored at -20°C. Furthermore, the development of the hybridization signals can be checked during the reaction of the alkaline phosphatase, and ready-developed membranes can be documented either by photocopy or photography, and can then be stored at least for a few months when protected from light. One further practical aspect is the fact that this technique allows the use of tetramethylammonium chloride (data not shown), which descreases the number of different hybridizing and washing conditions necessary for the typing procedure with many different

C. Nevinny-Stickel et al.

oligonucleotides. This is particularly important for the application of oligonucleotide hybridization for HLA typing, in which the investigated genetic variability is so great that about 100 oligos are necessary for ~ ,~hl~typing. We believe that these advantages make this method not only superior to 32p SSO labeling but also superior to other, so far described nonradioactive methods for SSO in clinical diagnosis [31-35].

REFERENCES 1. Saiki RK, Schaff S, Falloaa F, Mullis KB, Horn GT, Erlich HE, Amheim N: Enzymatic amplification of ~8o globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350, 1985. 2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487, 1988. 3. Hopman AHN, Wiegant J, Tesser GI, van Duiin P: A nonradioactive in situ hybridization method based on mercurated nucleic acids and sulfhydryl-hapten ligands. Nucleic Acids Res 14:6471, 1986. 4. Tchen P, Fuchs RPP, Sage E, Leng M: Chemically moditied nucleic acids as immunodetectable probes in hybrid° ization experiments. Proc Natl Acad Sci USA 81:3466, 1984. 5. Lebacq P, Sq~,alliD, Duchenne M, Pouletty P, Johannes M: A new sensitive non isotopic method using sulfonated probes to detect picogram quantities of specific DNA sequences on blot hybridization. J Biochem Biophys Methods 15:255, 1988. 6. Chollet A, Kawashima EH: Biotin-labeled synthetic oligodeoxyribonucleotides: Chemical synthesis and uses as hybridization probes. Nucleic Acids Res 13:1529, 1985. 7. Wachter L, Jablonski JA, Ramachandran KL: A simple and efficient procedure for the synthesis of 5'-aminoalkyl oligodeox~nucleotides. Nucleic Acids Res 14:7985, 1986. 8. Kempe T, Sudquist WI, Chow F, Hu SL: Chemical and enzymatic biotin-labeling of oligodeoxyribonucleotides. Nucleic Acids Res 13:45, 1985. 9. EliaouJ-F, Humbert M, Balagaer P, Gebuhrer L, Amsellem S, Betuel H, Nicolas J-C, Clot J: A method of HLA class II typing using nonradioactive labelled oligonucleotides. Tissue Antigens 33:475, 1989. 10. Agrawal S, Christodoulou C, Gait MJ: Efficient methods of attaching non-radioactive labels to the 5°-ends of synthetic oligodeoxyribonucleotides. Nucleic Acids Res 14:6227, 1986. 11. Chu BCF, Orgel LE: Detection of specific DNA sequences with short biotindabeled probes. DNA 4:327, 1985. 12. Cook AF, Vuocolo E, Brakel CL: Synthesis and hybrid-

Nonradioactive HLA class II typing using polymerase chain reaction and digoxigenin-11-2'-3'-dideoxy-uridinetriphosphate-labeled oligonucleotide probes.

We describe a new, simple, rapid, and sensitive nonradioactive technique for the analysis of genetic variations. Genomic DNA was amplified using polym...
562KB Sizes 0 Downloads 0 Views