CELL CYCLE 2016, VOL. 15, NO. 3, 432–440 http://dx.doi.org/10.1080/15384101.2015.1127474
REPORT
Notch3 overexpression causes arrest of cell cycle progression by inducing Cdh1 expression in human breast cancer cells Chun-Fa Chena,b, Xiao-Wei Doua, Yuan-Ke Lianga,b, Hao-Yu Lina,b, Jing-Wen Baia,b, Xi-Xun Zhanga,b, Xiao-Long Weia,b, Yao-Chen Lia, and Guo-Jun Zhanga,b a
Department of Thyroid and Breast Surgery, Changjiang Scholar’s Laboratory, The First Affiliated Hospital of Shantou University Medical College, Shantou, China; bDept. of Pathology, and The Breast Center, Cancer Hospital of Shantou University Medical College, Shantou, China
ABSTRACT
ARTICLE HISTORY
Uncontrolled cell proliferation, genomic instability and cancer are closely related to the abnormal activation of the cell cycle. Therefore, blocking the cell cycle of cancer cells has become one of the key goals for treating malignancies. Unfortunately, the factors affecting cell cycle progression remain largely unknown. In this study, we have explored the effects of Notch3 on the cell cycle in breast cancer cell lines by 3 methods: overexpressing the intra-cellular domain of Notch3 (N3ICD), knocking-down Notch3 by RNA interference, and using X-ray radiation exposure. The results revealed that overexpression of Notch3 arrested the cell cycle at the G0/G1 phase, and inhibited the proliferation and colony-formation rate in the breast cancer cell line, MDA-MB-231. Furthermore, overexpressing N3ICD upregulated Cdh1 expression and resulted in p27Kip accumulation by accelerating Skp2 degradation. Conversely, silencing of Notch3 in the breast cancer cell line, MCF-7, caused a decrease in expression levels of Cdh1 and p27Kip at both the protein and mRNA levels, while the expression of Skp2 only increased at the protein level. Correspondingly, there was an increase in the percentage of cells in the G0/G1 phase and an elevated proliferative ability and colony-formation rate, which may be caused by alterations of the Cdh1/Skp2/p27 axis. These results were also supported by exposing MDA-MB-231 cells or MCF-7 treated with siN3 to Xirradiation at various doses. Overall, our data showed that overexpression of N3ICD upregulated the expression of Cdh1 and caused p27Kip accumulation by accelerating Skp2 degradation, which in turn led to cell cycle arrest at the G0/G1 phase, in the context of proliferating breast cancer cell lines. These findings help to illuminate the precision therapy targeted to cell cycle progression, required for cancer treatment.
Received 24 July 2015 Revised 13 November 2015 Accepted 27 November 2015
Introduction Previous studies have shown that, during development, cellcycle arrest is critical for controlling cell number, proliferation rate, and organ size. Many differentiated cells undergo cellcycle arrest as part of their differentiation process.1 Furthermore, studies have also revealed that cellular proliferative activities are frequently increased or deregulated by changes in cell cycle modulators in many types of cancer including breast carcinomas, and altered proliferation is one of the main properties of cancer cells.1 Modifications to the cell cycle are therefore closely linked to cancer development and progression. Accordingly, by which molecular pathway does loss of cell cycle regulation in mammary gland epithelial cells lead to cancer? Although the molecular pathways and mechanisms underlying the disordered cell cycle of malignant tumors remain elusive, researchers have understood that if the cells are arrested at a particular cell-cycle phase, this results in the cancer cells becoming non-proliferative. Studies have demonstrated that the major regulatory events leading to proliferation occur in the G1 phase of the cell cycle.2 Therefore, regulating cell cycle
KEYWORDS
breast cancer; Cdh1; cell cycle; Notch3; p27Kip; Skp2
progression, arresting the cell cycle at the G1 phase, and tightly controlling cell-cycle exit, have become major objectives for treating malignant tumors. An increasing number of studies have shown that Cdh1, a positive regulator of APC/C (Anaphase Promoting Complex/ Cyclosome), which controls the ubiquitination and subsequent degradation of many key cell-cycle regulators from mitosis to late G1 is a critical regulator of G0/G1.3-5 In addition to playing a role in cell cycle progression, deregulated Cdh1 has been found to cause aberrant centrosome formation, impaired cytokinesis and DNA re-replication6; furthermore, Cdh1 can regulate cell differentiation by degradation of cyclin-dependent kinase inhibitors and certain transcriptional inhibitors involved in cell cycle withdrawal or the onset of terminal differentiation.7 Unfortunately, the mechanisms involved in the regulation of Cdh1are not well understood. However, Ruohola-Baker et al. demonstrated that both Notch signaling and Cdh1 are required for the mitotic-to-endocycle transition in Drosophila follicle cells.8 Notch families have 4 receptors (Notch1-4) in mammals, which are type I transmembrane proteins.9 All 4 Notch
CONTACT Guo-Jun Zhang [email protected] Cancer Hospital of Shantou University Medical College, 7 Raoping Road, Shantou 515041, China Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/kccy Supplemental data for this article can be accessed on the publisher’s website. © 2016 Taylor & Francis
CELL CYCLE
receptors are similar, but have subtle differences in their extracellular and cytoplasmic domains.10 The cell-bound ligands, which includes 5 transmembrane ligands (Delta1,3,4, Jagged1,2) on the surface of cells,11 activate Notch receptors on juxtaposed cells and initiate the Notch signaling pathway. This signal cascade not only plays important roles in cell differentiation, survival, self-renewal and proliferation,12 but also has a cell cycle regulatory function.13-15 Ball et al. found that overexpression of activated forms of Notch1 and Notch2 in small cell lung cancer cells caused profound growth suppression stemming from G1 cell cycle arrest. Concomitant with this arrest was an up-regulation of the cyclin-dependent kinase inhibitors (CDKIs) p21waf1(cip1 and p27kip1. Of particular relevance, a recent study showed that upregulation of Notch3 was required for induction of p21 expression in senescent cells, and downregulation of Notch3 led to a delayed onset of senescence,14 suggesting that Notch3 strongly correlated with cell cycle progression. In another study, we found that, unlike the other Notch family members, Notch3 could inhibit the proliferation of breast cancer epithelial cells (unpublished data). Herein, we provide solid evidence that overexpressing N3ICD arrests cell cycle at the G1 phase in breast cancer epithelial cells by directly upregulating expression of Cdh1 and p27Kip at the mRNA and protein levels. Upregulated Cdh1 expression accelerates Skp2 degradation, which further mediates p27Kip accumulation.
Results Notch3 overexpression arrested the cell cycle at the G0/G1 phase in breast cancer cells To elucidate the effects of Notch3 on cell cycle progression of breast cancer cells, we first established aN3ICD stable transfectant in low Notch3-expressing MDA-MB-231 cells by co-transfecting pCLE/N3ICD with pEGFP-N plasmids. Meanwhile, we also generated stable Notch3 knock-down cells in high Notch3expressing MCF-7 cells by transfecting pGPU6/GFP/Neo/ shRNA-N3. GFP-positive cells were used to confirm successful transfection (Figure 1A). Furthermore, to verify ectopic Notch3 expression and the efficiency of knocking-down Notch3 gene expression, Western blotting was carried out. Results showed that the upregulated Notch3 expression level was observed in N3ICD/MDA-MB-231 cells; by contrast, the downregulated Notch3 expression level was evident in shRNA-N3ICD/MCF-7 cells (Figure 1B). Next, we monitored the effects of Notch3 on cell cycle progression by measuring the DNA content of the cells by flow cytometry.16 Usually, the G1 phase of the cell cycle lasts from the end of the previous mitosis (M phase) until the beginning of DNA synthesis (S phase). Ectopic overexpression of N3ICD led to an increase (%G0/G1: 59.07% § 0.030) in the percentage of cells with unreplicated DNA, forming the high G0/G1 group, while control MDA-MB-231 cells transfected with empty vector displayed a lower DNA content at G0/G1 phase (% G1/G0, 44.31% § 0.033). Correspondingly, the percentage of cells at both S (20.18% § 0.013) and G2/M (20.75% § 0.038) phases in N3ICD/MDA-MB-231 cells was lower than that in control
433
MDA-MB-231 cells (%S: 24.72% § 0.027; %M: 30.97% § 0.031) (Figure 1C). By contrast, we compared the frequency distribution of those MCF-7 cells transfected with pGPU6/ GFP/Neo/shRNA-N3 and empty vector, respectively. As expected, shRNA-Notch3/MCF-7 exhibited a lower percentage of G0/G1 content (42.73% § 0.036), resulting in a higher percentage of S (23.29% § 0.013) and G2/M (33.98% § 0.045) phases when compared with the control cells (%G0/G1: 51.92% § 0.014; %S: 30.91% § 0.008 and %M: 17.17% § 0.007) (Figure 1D). We evaluated the effects of N3ICD in at least 3 independent experiments. Therefore, we demonstrated that upregulated N3ICD indeed arrests the cell cycle at the G0/G1 phase in breast cancer epithelial cells.
Overexpressing Notch3 inhibited the proliferation and colony-formation rate of breast cancer cells It is accepted that the perturbation of the cell cycle is followed by a reduction in cell proliferation, clonogenic capacity, and inhibition of tumor growth. To further determine whether N3ICD is a functional G0/G1 inhibitor during cell cycle in breast cancer, the effect of N3ICD on breast cancer epithelial cell proliferation was examined by CCK8 assay and colony-formation assay. CCK8 analysis showed that overexpressing N3ICD could significantly attenuate the proliferation of MDA-MB-231 cells at each time point, compared with vector-transfected MDA-MB231 cells (P < 0.05) (Figure 2A), while knock-down of Notch3 could sharply promote the proliferation of MCF-7 cells when compared with sham shRNA/MCF-7 (P < 0.05) (Figure 2B). These results were further confirmed by the subsequent colony-forming assay. Results from the colonyforming assay showed that N3ICD markedly reduced the colony-formation rate efficiency of MDA-MB-231cells (29.56% § 0.097) compared to controls (47.64% § 0.159, *P < 0.05) (Figure 2C). After knocking-down Notch3 in MCF7 cells, the colony-formation rate increased to 33.67% § 5.13, compared to sham shRNA/MCF-7 (20.33% § 4.51) (Figure 2D). These results indicate that overexpressing N3ICD markedly attenuates the malignant properties of breast cancer epithelial cells, including proliferation and clonogenic capacity. Conversely, attenuation of Notch3 expression levels by shRNA results in an increase in cell proliferation and clonogenic capacity.
Overexpressing Notch3 upregulated Cdh1 expression by accelerating Skp2 degradation, which resulted in p27Kip accumulation Considering that cell cycle progression was arrested at the G0/ G1 phase due to overexpression ofN3ICD, we therefore compared the expression levels of certain important G0/G1 phaserelated molecules, such as Cdh1, CDKN1B (p27kip1) and Skp2 by RT-PCR and Western blotting. As shown in Figure 3A, the expression levelN3ICD, Cdh1 and p27kip1, was upregulated in N3ICD-transfecetd MDA-MB-231 cells compared with vectortransfected MDA-MB-231 cells. By contrast, Skp2 exhibited a
434
C.- F. CHEN ET AL.
Figure 1. N3ICD overexpression causes cell cycle arrest at the G0/G1 phase in breast cancer epithelial cells. The successful transfection of N3ICD-overexpressing and Notch3 knock-down constructs is indicated by GFP under fluorescence Microscopy after transfection or co-transfection, respectively. In addition, the successful transfection is shown by co-transfecting the pEGFP-N1 with GFP. N3ICD overexpression and the efficiency of Notch3 knock-down are detected by Western blotting. Upregulated N3ICD is observed in N3ICD-transfected MDA-MB-231 cells (A), and downregulated Notch3 is evident in shRNA-Notch3/MCF-7 cells (B).The percentage of N3ICD-transfecetd MDA-MB-231 cells and shRNA-Notch3/MCF-7 cells in the G0/G1, S and G2/M phases were analyzed by FACS. (C): The percentages of pCLE-transfected MDA-MB-231 cells in the G0/G1, S and G2/M phases are 44.31% § 0.033, 24.72% § 0.027 and 30.97% § 0.031, respectively; while in N3ICD-transfecetd MDA-MB-231 cells, the proportions in the G0/G1, S and G2/M phases are 59.07% § 0.030, 20.18% § 0.013 and G2/M 20.75% § 0.038, respectively (P < 0.05). (D): The percentage of sham siRNA/MCF7 cells in the G0/G1, S and G2/M phases is 51.92% § 0.014, 30.91% § 0.008 and 17.17% § 0.007, respectively; while in siRNA -Notch3/MCF-7 cells, the proportions in the G0/G1,S and G2/M phases are 42.73% § 0.036, 23.29% § 0.013 and 33.98% § 0.045, respectively (P < 0.05)
lower expression in N3ICD-transfecetd MDA-MB-231 cells. The expression level of Cdh1 mRNA sharply increased as a result of Notch3 overexpression. There was no significant difference in mRNA expression levels of Skp2 between the experimental and control groups. Unexpectedly, the mRNA expression level of CDKN1B was significantly upregulated in N3ICD-transfecetd MDA-MB-231 cells (Figure 3B). To further confirm the effect of Notch3 on cell cycle progression, the experiments were also performed in sham shRNA/MCF-7 and shRNA-Notch3/MCF-7 cells. The level of N3ICD, Cdh1 and
p27kip1proteins was downregulated, together with an increased expression of Skp2 in shRNA-Notch3/MCF-7 cells (Figure 3C). At the transcriptional level, the expression level of Cdh1 mRNA sharply decreased with knock-down of Notch3. There was still no significant difference in mRNA expression levels of Skp2 between the experimental and control groups. Consistently, the mRNA expression level of CDKN1B was significantly downregulated in shRNA-Notch3/MCF-7 cells compared with sham shRNA/MCF-7 cells (Figure 3D). This result suggests that the ectopic overexpressed N3ICD directly
CELL CYCLE
435
Figure 2. Effects of N3ICD on colony-formation and cell proliferation of MDA-MB-231 and MCF7cells. (A): Stable expression of N3ICD inhibits MDA-MB-231 cell growth in vitro(P < 0.05). pCLE/N3ICD or pCLE plasmids (as negative control) are co-transfected with pEGFP-N1 vector, as a transfection indicator, into the MDA-MB-231 cells. After 48 h following transfection, the G418-resistant cells were selected by adding G418. The stable cells expressing N3ICD or null cells were used to measure growth absorbance with a CCK-8 kit at the indicated time points. At same time, (B) shows that stable knock-down of Notch3 expression promotes MCF-7 cell growth in vitro (P < 0.05). (C) and (D) show the representative colony-formation assay and quantitative analysis of colony-formation. Values are expressed as the mean § SD from 3 experiments, and the asterisk indicates the statistical significance compared to the controls (*, P < 0.05)
upregulates the expression level of Cdh1, which accelerates Skp2 degradation. Furthermore, Skp2 has been revealed to mediate the ubiquitination of p27kip1 17.
Irradiating MDA-MB-231 cells resulted in p27Kip accumulation, followed by upregulation of Notch3 and Cdh1 expression by accelerating Skp2 degradation Cells subjected to X-irradiation treatment display a dosedependent decrease in cell proliferation and alteration of the cell cycle. To further confirm the relationship between Notch3 and cell cycle progression, we exposed MDA-MB-231 cells to 5 and 10Gy X-ray irradiation. RT-PCR results showed that the mRNA expression levels of Notch3 and Cdh1 were markedly upregulated in a dose-dependent manner after X-ray irradiation treatment. Of particular importance was that there were no significant changes in the mRNA expression levels of Skp2 and p27Kip before or after X-ray irradiation with different doses. Western immunoblotting analysis with anti-Notch3, Cdh1, Skp2 and p27Kip antibodies demonstrated that X-ray irradiation markedly enhanced both Cdh1 and N3ICD protein expression in a dose-dependent manner. Skp2 protein expression was downregulated, while p27Kip protein expression was upregulated. There were no obvious dose-dependent changes observed in Skp2 and p27Kip protein expression after irradiation (Figure 4A, B). To confirm that the X-ray irradiationinduced cell cycle arrest is Notch3-dependent, the IR experiment under the condition of interfering Notch3 with siRNA in MCF-7 cell line was performed. As shown in Figure 4B, D, the results of Western blotting showed that the expression level of endogenous Notch3 was almost completely silenced in MCF-7
cells treated with siN3 when compared with control cells with a dose of irradiation at 0 Gy. However, with irradiation and increasing the irradiation dose, the expression level of Notch3 raised in MCF-7 treated with siN3. Once exposing the cells to 10 Gy of X-rays, the expression level of Notch3 in MCF-7 treated with siN3 almost reached that level of MCF-7 treated with sham siRNA. Correspondently, the expression levels of Cdh1 and p27kip gradually raised with increasing irradiation dose, whereas the expression of skp2 gradually reduced with increasing irradiation dose. In order to assess whether irradiation might affect the expression levels of Notch3, Chd1, skp2 or p27kip via changes in the rate of gene transcription, we used real-time PCR to measure the level of the mRNAs encoding these proteins. The results of qRT-PCR analysis also supported the results of Western blotting. Taken together, these data suggest that the upregulated Notch3 may be involved in X-ray irradiation-mediated cell cycle arrest by enhancing Cdh1 expression, and Skp2 degradation mediated by Cdh1-APC stabilizes p27Kip, thereby ensuring X-ray irradiation -induced cell cycle arrest.
Discussion The present study sought to assess the effects of Notch3 on cell cycle progression by regulating the Cdh1/APC-Skp2-p27Kip axis in breast cancer epithelial cells. It is widely accepted that uncontrolled cell proliferation, genomic instability and cancer initiation are closely related to abnormal activation and progression of cell cycle. Regulating the progression of the cell cycle and blocking the cell cycle of cancer cells have become key objectives for treating malignancies. The cell cycle is driven
436
C.- F. CHEN ET AL.
Figure 3. N3ICD overexpression upregulated Cdh1, and Notch3 knock-down downregulated Cdh1 at both the protein and mRNA expression levels, ultimately affecting downstream genes of Cdh, namely Skp2 and p27Kip.(A) Western blotting shows upregulated Cdh1 and p27Kip by overexpressed N3ICD, while the expression level of Skp2 is reduced in N3ICD-transfecetd MDA-MB-231 cells compared with pCLE/MDA-MB-231 cells. By contrast, (C) shows that Cdh1 and p27Kip expressions were downregulated, while Skp2 was upregulated after Notch3 was knocked down in shRNA-Notch3/MCF-7 cells, compared with sham shRNA/MCF-7 cells. GAPDH was used as an internal standard. (B) and (D) Quantitative RT-PCR of N3ICD, Cdh1, Skp2, and p27Kip cDNA show the expression levels in N3ICD-transfected MDA-MB-231 cells and shRNA-Notch3/MCF7 cells, as well as their control cells. The results are representative of 3 independent experiments
and tightly regulated by a series of cyclins and their associated cyclin-dependent kinases (CDKs). Usually, CDKs are activated by cyclins and suppressed by CDK inhibitors. The expression level of these regulators exhibits dynamic changes during the cell cycle, and displays rapid turnover in ubiquitination-dependent degradation. For example, both the Skp1-Cul1-F-box protein (SCF) complex and the APC/C are important ubiquitin E3 ligases during the cell cycle, and are mainly responsible for controlling the specifically sequential degradation of many regulators during the cell cycle.18 SCF is mainly active in the G1, S, and early M phases, whereas APC/C regulates mitosis and G1.19-23 Although Notch 1 and 2 have been demonstrated to promote cell cycle progression in various types of cancer,24 it has not yet been determined whether Notch3 is associated with changes in cell cycle. In the present study, we investigated the effects of Notch3 on cell cycle in breast cancer epithelial cells by either overexpressing or knocking-down the expression level of N3ICD in 2 different breast cancer cell lines, MDA-MB-231 and MCF-7, respectively. We found that overexpression of N3ICD inhibited proliferation and reduced the colony-formation rate of the N3ICD/MDA-MB-231 cells. We demonstrated that overexpressing N3ICD arrested the cell cycle at the G0/G1 phase, which was a novel effect of N3ICD. Furthermore, in an
attempt to illustrate the mechanism underlying cell cycle regulation by Notch3, we showed that N3ICD overexpression could upregulate the expression level of Cdh1 and p27kip1 proteins, and could downregulate Skp2 expression. Importantly, the expression level of Cdh1 and p27kip1 mRNA increased, but the expression level of Skp2 mRNA reduced concomitantly with N3ICD overexpression. Our results suggest that N3ICD may directly regulate Cdh1 at the transcriptional level, and that Skp2 was regulated at a post-transcriptional level. In this way, the high expression of p27kip1 could be regulated by 2 possible mechanisms. The first can be explained by Skp2 degradation caused by p27kip1 accumulation, and the second is that p27kip1 expression may be directly up-regulated by N3ICD at the transcriptional level. We therefore surmised that this proliferation defect of N3ICD/MDA-MB-231 cells could also be caused by activating the Cdh1/APC-Skp2-p27kip1 axis. The results outlined above were further verified by knocking-down Notch3 in MCF-7 cells. Consistently, knockingdown Notch3 caused downregulation of the percentage shRNA-Notch3/MCF-7 cells in the G0/G1 phase, and these cells acquired enhanced proliferation potential and colonyforming capability. In a parallel fashion, knocking-down Notch3 caused downregulation of the expression of Cdh1 and
CELL CYCLE
437
Figure 4. X-ray irradiation induced N3ICD and Cdh1 expression both at the mRNA and protein levels in a dose-dependent manner, ultimately affecting their downstream genes Skp2 and p27Kip. MDA-MB-231 cells were irradiated with 5Gy and 10Gy, and then whole-cell lysates were harvested for Western blotting and total RNAs were extracted for quantitative RT-PCR. (A) Western blotting shows that N3ICD protein and Cdh1 was upregulated after irradiation in a dose-dependent manner, while Skp2 downregulation and p27 upregulation was observed after irradiation. (B) Quantitative RT-PCR shows that X-rays irradiation induced N3ICD and Cdh1 mRNA expression levels in a dose-dependent manner. However, there were no significant differences in the mRNA expression levels of Skp2 and p27Kip before and after irradiation. The data represents mean § standard error from triplicates. Results are representative of 3 independent experiments. (C) Western blotting shows that N3ICD, Cdh1 and p27 proteins were upregulated in siN3 treated MCF-7 cells after irradiation in a dose-dependent manner when compared with siNC treated MCF-7 cells, whereas Skp2 downregulation was observed after irradiation. (D) Quantitative RT-PCR shows that X-ray irradiation induced N3ICD, Cdh1 and p27 mRNA expression levels increase in a dosedependent manner in siN3 treated MCF-7 cells when compared with siNC treated MCF-7 cells. However, the mRNA expression levels of Skp2 raised at the beginning of the irradiation and then presented a significant decline. The data represents mean § standard error from triplicates. Results are representative of 3 independent experiments
p27kip1 proteins in shRNA-Notch3/MCF-7 cells. Skp2 expression was enhanced when the expression of Notch3 was reduced. Importantly, the expression level of both Cdh1 and p27kip1 mRNA reduced in shRNA-Notch3/MCF-7 cells, but no change was observed in Skp2 mRNA. These results further supported our conclusion that the overexpression of N3ICD specifically induced expression of Cdh1 and p27kip1, and activated the Cdh1/APC-Skp2-p27kip1 axis. To further evaluate the relationship between Notch3 and cell cycle progression, MDA-MB-231 cells were treated with X-ray irradiation, which is frequently associated with the arrest of cell cycle progression. We found that irradiating MDA-MB-231 cells upregulated the expression of Cdh1 and p27kip1 accumulation, followed by an increase in Notch3 expression, while the expression of Skp2 reduced at the protein level. However, we did not observe any significant changes in the expression of Skp2 and p27kip1 mRNA. We believe that the cell cycle arrest caused by X-ray irradiation involved a fairly complex process, and X-ray irradiation was not able to completely imitate ectopic N3ICD overexpression. To confirm whether the IR-induced cell cycle arrest is Notch3-dependent, the Western blotting and RT-qPCR
experiments were performed followed by X-ray irradiation under the condition of interfering Notch3 with siRNA in MCF7 cell line. We found that the expression level of endogenous Notch3 increased with increasing irradiation dose in MCF-7 treated with siN3. Correspondently, the expression levels of Cdh1 and p27kip gradually increased with increasing irradiation dose, whereas the expression of skp2 gradually reduced with increasing irradiation dose. The levels of the mRNAs encoding these proteins in MCF-7 treated with siN3 correspondingly raised accompanied by an increasing irradiation dose except for skp2. Our data suggest that the IR-induced cell cycle arrest is partially dependent on Notch3. We therefore conclude that Notch3 may arrest cell cycle progression of the breast cancer epithelial cells by regulating the Cdh1/Skp2/p27kip1 signaling axis. Although previous studies have shown that in a limited number of tumor types, including human T-cell leukemia and mouse mammary tumors, Notch signaling is oncogenic rather than anti-proliferative,25-27 a recent study has demonstrated opposite functions of Notch in lymphopoiesis. For example, in the development of lymphoid cells, Notch promotes T-cell proliferation but induces apoptosis and growth arrest of B-cell precursors.28 Consequently, we
438
C.- F. CHEN ET AL.
believe that the phenotypic outcome of Notch signaling is often context-dependent. Overall, our data have shown a correlation between cell cycle arrest and activated Notch3 signaling in 2 different breast cancer epithelial cell lines. In greater detail, N3ICD overexpression upregulated the expression of Cdh1 and p27kip1 accumulation, which led to cell cycle arrest at the G0/G1 phase by accelerating theSkp2 degradation in the context of a proliferating breast cancer epithelial cell line. This knowledge can help illuminate the precision therapy targeted to cell cycle progression required for cancer treatment. Future studies should be directed at characterizing the signaling pathway responsible for Notch3-dependent growth arrest in breast cancer epithelial cells, and at understanding the downstream target molecules of Notch3 signaling in epithelial and non-epithelial cell lines.
Materials & methods Plasmids construct 1) The eukaryotic expression plasmids pGLE, pGLE-N3ICD and pEGFP-N1 were developed by our laboratory. Notch3-interferring plasmid, which was constructed using pGPU6/GFP/Neo as a backbone, was purchased from Shanghai Gene Pharma Co. Ltd. The shRNA sequences targeting Notch3 mRNA were designed; the sense sequence was 50 -CACCGTATAGGTGTTGACGCCATCCACGCATTCAAGAGATGCGTGGATGGCGTCAACACCTATATTTTTTG-30 , and the antisense sequence was 50 -GATCCAAAAAATATAGGTGTTGACGCCATCCACGCATCTCTTGAATGCGTGGATGGCGTCAACACCTATAC ¡30 . After annealing, the shRNA was inserted into the pGPU6/ GFP/Neo vector. Cell culture T47D, BT549, SKBR3, MDA-MB-231 and MCF-7 breast cancer cells were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were routinely grown with DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Cells were passaged every 4–5 days and the medium was changed once during this time. Once these cultures attained confluence, the cells were used for various experiments such as RT-PCR, irradiation, colony-formation assays or Western blotting. Transient and stable transfection Cells were plated in 6-well plates at a density of 1 £ 105 cells per well, in 2 ml of the appropriate growth medium supplemented with serum. For each transfection, 1 to 2 mg of DNA was diluted in 100 ml of serum-free medium, and 2 to 25 ml of lipofectamine reagent was diluted in 100 ml of serum-free medium. These two solutions were combined, mixed gently, and then incubated at room temperature for 15 to 45 min. The cells were then washed once with 2 ml of serum-free medium. For each transfection, 0.8 ml of serum-free medium was added, without antibacterial agents, to each tube containing the lipidDNA complexes. The diluted lipid-DNA solution was mixed gently, and then overlaid onto the washed cells. Medium was
replaced at 6 to 8 hours following the start of transfection. For the transient transfection, cell extracts were tested for gene activity at 24 to 72 hours after the start of transfection, according to cell type and promoter activity. For the stable transfection, following transfection, cells were allowed to grow and express the protein for G418 resistance under non-selective conditions for at least 24 hours. For selection of stably-expressing cells, cells were cultivated in standard medium with supplements and the appropriate amount of G418. Cells were grown for at least 3 weeks under selection pressure to avoid contamination with non-resistant cells, and then the G418 concentration was reduced after 1–2 weeks. Cell cycle analysis with FACS The MDA-MB-231 cells stably expressing Notch3, and the MCF-7 cells stably knocking-down Notch3, as well as the control cells transfected with empty vectors in an exponential growth phase, were trypsinized, suspended into single-cell mixtures and washed with PBS. Cells were then treated with 20 mg/ mL RNase A, and stained with 25 mg/ml Propidium Iodide (PI) for 1 h before being subjected to cell cycle analyses. Flowcytometric analyses were performed using a FACS Calibur flow cytometer (FACS420) to measure DNA content. A total of 10,000 events were collected per experiment, and the data were analyzed using the MODFIT software program. Real time reverse transcriptional PCR Ò
Briefly, total RNA was extracted using Trizol reagent (Invitrogen Corporation, USA) according to the manufacturer’s protocol, and was purified using the TURBO DNA-freeTM Kit (Ambion, cat. no. AM1907). cDNAs were then synthesized using Prime ScriptTM RT reagent Kit (TAKARA, DRR036A) in a 20 ml volume of reaction mixture, according to the manufacturer’s instructions. Real-time PCR was carried out in the ABI step one plus Real-time PCR System. Primers were designed online with NCBI and the sequences are shown in Table S1. The change in expression of a target gene was calculated as: fold change D 2-(DCT,Tg- DCT,control). The following PCR conditions were used: 6 min denaturing at 94 C, (30 s denaturing at 94 C, 30 s annealing at 60 C, 30 s extension at 72 C) for 35 cycles, 10 min extension at 72 C and then at 4 C thereafter. Each reaction was run in triplicate with at least 3 independent biological replicates. CT values were first normalized to GAPDH as an internal control. Antibodies and western blotting The cells in each group were lysed in ice-cold RIPA lysis buffer. The homogenates were then centrifuged at 12,000 £ g for 10 min at 4 C. The clear supernatants were quantified and were stored at -80 C until required for use. Samples were separated by 4%-20% gradient polyacrylamide gel SDS-PAGE. Proteins were then transferred from the gel onto a PVDF membrane. After transferring, the PVDF membranes were blocked with 5% BSA for 1 h at room temperature. Membranes were then incubated with primary antibodies (listed in Table S2) overnight at 4 C. After this period, all membranes were
CELL CYCLE
incubated in different secondary antibodies, in turn, for 1 h at 37 C while shaking. Finally, the PVDF membranes were developed using the ECL detection system.Notch3 intra-cellular domain (Notch3-ICD) protein and green fluorescence protein (GFP) were detected using a rabbit monoclonal antibody (CST/ C37C3, 1:4000)or a mouse monoclonal antibody (CST/ 4B10,1:3000) from Cell signaling Technology, Inc. (Danvers, MA). The antibodies used for Cdh1, Skp1 and p27 were a mouse monoclonal antibody (Calbiochem at 1:1000),a rabbit polyclonal antibody(Santa Cruz, 1:4000), and a rabbit polyclonal antibody (Santa Cruz,1:4000), respectively and the mouse monoclonal antibody to GAPDH (Santa Cruz,1:3000) was also obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).
439
Statistical analysis All data are presented as means and standard errors of the mean (mean § SEM). For comparing means at the same time point between the experiment and control group, a Student’s T test was performed. To compare the rates in the 2 groups, data were evaluated by the Pearson’s Chi-Square method with SSPS software (Version 16.0). Values of P < 0.05 were considered to be statistically significant.
Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed.
References Irradiation of breast cancer cells MDA-MB-231 cells were dissociated by trypsinization and mechanical agitation with a Pasteur pipette into single cell suspensions in the culture medium supplemented with 10% FBS. A total of 1 £ 104 cells were seeded in each 25 mm2 culture flask, and then incubated for 48 h in antibiotic-free medium at37 C, in a 5% CO2 incubator. When cell confluence reached 60%, the flasks were filled to the limit with PBS. Cells were then irradiated from a vertical direction at a dose rate of 400 cGy/min with 6-MV X-rays produced by a Varian linear accelerator obtained by the Department of radiotherapy of Cancer Hospital of Shantou University Medical College. Cells were irradiated for the time required to receive a total dose of 0, 5, and 10 Gy, respectively. Negative control cells were sham-irradiated. Following irradiation, cells were washed twice with PBS and supplemented with fresh medium contained 10% FCS, then cultured continuously at 37 C in a 5% CO2 environment for 7 days for subsequent experiments.
Cell proliferative assay and colony-formation assay Cell proliferation potential was evaluated by cell proliferation assays using CCK-8 assays (Tokyo, Japan). The MDA-MB-231 cells stably expressing Notch3 and the MCF-7 cells stably knocking-down Notch3 in an exponential growth phase were plated at a concentration of 1 £ 105 cells/ml into 96-well culture plates. Cells transfected with empty vectors were used as negative controls. The replications were carried out with 5 wells plated with the same cells. For the cellular proliferation assay, 10 ml of CKK-8 solution was added to each plate-well at 0, 2, 3, 4, 5, 6 and 7 d after inoculation, and plates were then incubated for 2 h. Absorbance was measured at 450 nm using a microplate reader (SpectraMax M5, Sunnyvale, CA, USA). For the colony-formation assay, approximately 5 £ 102 MDA-MB-231 cells stably transfected withNotch3 and the MCF-7 cells stably knocking-down Notch3 in an exponential growth phase, and negative control cells were plated in 100-mm culture dishes. After 18 days, cells were fixed with methanol and stained with 0.5 ml of Giemsa’s staining for 15 min. Visible colonies were manually counted.
1. Fernandez PL, Jares P, Rey MJ, Campo E, Cardesa A. Cell cycle regulators and their abnormalities in breast cancer. Mol Pathol: MP 1998; 51:305-9; PMID:10193510; http://dx.doi.org/10.1136/mp.51.6.305 2. Blagosklonny MV, Pardee AB. The restriction point of the cell cycle. Cell Cycle 2002; 1:103-10; PMID:12429916 3. Reed SI. Ratchets and clocks: the cell cycle, ubiquitylation and protein turnover. Nat Rev Mol Cell Biol 2003; 4:855-64; PMID:14625536; http://dx.doi.org/10.1038/nrm1246 4. Nakayama KI, Nakayama K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer 2006; 6:369-81; PMID:16633365; http://dx. doi.org/10.1038/nrc1881 5. Skaar JR, Pagano M. Cdh1: a master G0/G1 regulator. Nat Cell Biol 2008; 10:755-7; PMID:18591966; http://dx.doi.org/10.1038/ncb0708755 6. Taylor S, Peters JM. Polo and Aurora kinases: lessons derived from chemical biology. Curr Opin Cell Biol 2008; 20:77-84; PMID:18249108; http://dx.doi.org/10.1016/j.ceb.2007.11.008 7. Li W, Wu G, Wan Y. The dual effects of Cdh1/APC in myogenesis. FASEB J 2007; 21:3606-17; PMID:17601983; http://dx.doi.org/ 10.1096/fj.07-8159com 8. Schaeffer V, Althauser C, Shcherbata HR, Deng WM, Ruohola-Baker H. Notch-dependent Fizzy-related/Hec1/Cdh1 expression is required for the mitotic-to-endocycle transition in Drosophila follicle cells. Curr Biol: CB 2004; 14:630-6; http://dx.doi.org/10.1016/j. cub.2004.03.040 9. Almen MS, Nordstrom KJ, Fredriksson R, Schioth HB. Mapping the human membrane proteome: a majority of the human membrane proteins can be classified according to function and evolutionary origin. BMC Biol 2009; 7:50; PMID:19678920; http://dx.doi.org/10.1186/ 1741-7007-7-50 10. Weinmaster G. The ins and outs of notch signaling. Mol Cell Neurosci 1997; 9:91-102; PMID:9245493; http://dx.doi.org/10.1006/ mcne.1997.0612 11. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999; 284:7706; PMID:10221902; http://dx.doi.org/10.1126/science.284.5415.770 12. Bolos V, Grego-Bessa J, de la Pompa JL. Notch signaling in development and cancer. Endocr Rev 2007; 28:339-63; PMID:17409286; http://dx.doi.org/10.1210/er.2006-0046 13. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res 2001; 61:3200-5; PMID:11306509 14. Cui H, Kong Y, Xu M, Zhang H. Notch3 functions as a tumor suppressor by controlling cellular senescence. Cancer Res 2013; 73:34519; PMID:23610446; http://dx.doi.org/10.1158/0008-5472.CAN12-3902 15. Dohda T, Maljukova A, Liu L, Heyman M, Grander D, Brodin D, Sangfelt O, Lendahl U. Notch signaling induces SKP2 expression and promotes reduction of p27Kip1 in T-cell acute lymphoblastic leukemia cell lines. Exp Cell Res 2007; 313:3141-52; PMID:17560996; http://dx.doi.org/10.1016/j.yexcr.2007.04.027
440
C.- F. CHEN ET AL.
16. Haase SB, Lew DJ. Flow cytometric analysis of DNA content in budding yeast. Methods Enzymol 1997; 283:322-32; PMID:9251030; http://dx.doi.org/10.1016/S0076-6879(97)83026-1 17. Kossatz U, Dietrich N, Zender L, Buer J, Manns MP, Malek NP. Skp2dependent degradation of p27kip1 is essential for cell cycle progression. Genes & Dev 2004; 18:2602-7; PMID:15520280; http://dx.doi. org/10.1101/gad.321004 18. Vodermaier HC. APC/C and SCF: controlling each other and the cell cycle. Curr Biol: CB 2004; 14:R787-96; PMID:15380093; http://dx.doi. org/10.1016/j.cub.2004.09.020 19. Prosser SL, Samant MD, Baxter JE, Morrison CG, Fry AM. Oscillation of APC/C activity during cell cycle arrest promotes centrosome amplification. J Cell Sci 2012; 125:5353-68; PMID:22956538; http://dx.doi. org/10.1242/jcs.106096 20. Tudzarova S, Colombo SL, Stoeber K, Carcamo S, Williams GH, Moncada S. Two ubiquitin ligases, APC/C-Cdh1 and SKP1-CUL1-F (SCF)-beta-TrCP, sequentially regulate glycolysis during the cell cycle. Proc Natl Acad Sci U S A 2011; 108:5278-83. 21. Yamao F. [Ubiquitin system connected with cell cycle control]. Tanpakushitsu Kakusan Koso 2001; 46:1704-9; PMID:11579569 22. Pfleger CM, Kirschner MW. The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev 2000; 14:655-65; PMID:10733526
23. Li M, Zhang P. The function of APC/CCdh1 in cell cycle and beyond. Cell Div 2009; 4:2; PMID:19152694; http://dx.doi.org/10.1186/17471028-4-2 24. Roy M, Pear WS, Aster JC. The multifaceted role of Notch in cancer. Curr Opin Gen Dev 2007; 17:52-9; PMID:17178457; http://dx.doi.org/ 10.1016/j.gde.2006.12.001 25. Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 1991; 66:649-61; PMID:1831692; http://dx.doi.org/10.1016/00928674(91)90111-B 26. Uyttendaele H, Marazzi G, Wu G, Yan Q, Sassoon D, Kitajewski J. Notch4/int-3, a mammary proto-oncogene, is an endothelial cell-specific mammalian Notch gene. Development 1996; 122:2251-9; PMID:8681805 27. Pear WS, Aster JC, Scott ML, Hasserjian RP, Soffer B, Sklar J, Baltimore D. Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 1996; 183:2283-91; PMID:8642337; http://dx.doi.org/10.1084/ jem.183.5.2283 28. Morimura T, Goitsuka R, Zhang Y, Saito I, Reth M, Kitamura D. Cell cycle arrest and apoptosis induced by Notch1 in B cells. J Biol Chem 2000; 275:36523-31; PMID:10967117; http://dx.doi.org/10.1074/jbc. M006415200
REPORT
Notch3 overexpression causes arrest of cell cycle progression by inducing Cdh1 expression in human breast cancer cells Chun-Fa Chena,b, Xiao-Wei Doua, Yuan-Ke Lianga,b, Hao-Yu Lina,b, Jing-Wen Baia,b, Xi-Xun Zhanga,b, Xiao-Long Weia,b, Yao-Chen Lia, and Guo-Jun Zhanga,b a
Department of Thyroid and Breast Surgery, Changjiang Scholar’s Laboratory, The First Affiliated Hospital of Shantou University Medical College, Shantou, China; bDept. of Pathology, and The Breast Center, Cancer Hospital of Shantou University Medical College, Shantou, China
ABSTRACT
ARTICLE HISTORY
Uncontrolled cell proliferation, genomic instability and cancer are closely related to the abnormal activation of the cell cycle. Therefore, blocking the cell cycle of cancer cells has become one of the key goals for treating malignancies. Unfortunately, the factors affecting cell cycle progression remain largely unknown. In this study, we have explored the effects of Notch3 on the cell cycle in breast cancer cell lines by 3 methods: overexpressing the intra-cellular domain of Notch3 (N3ICD), knocking-down Notch3 by RNA interference, and using X-ray radiation exposure. The results revealed that overexpression of Notch3 arrested the cell cycle at the G0/G1 phase, and inhibited the proliferation and colony-formation rate in the breast cancer cell line, MDA-MB-231. Furthermore, overexpressing N3ICD upregulated Cdh1 expression and resulted in p27Kip accumulation by accelerating Skp2 degradation. Conversely, silencing of Notch3 in the breast cancer cell line, MCF-7, caused a decrease in expression levels of Cdh1 and p27Kip at both the protein and mRNA levels, while the expression of Skp2 only increased at the protein level. Correspondingly, there was an increase in the percentage of cells in the G0/G1 phase and an elevated proliferative ability and colony-formation rate, which may be caused by alterations of the Cdh1/Skp2/p27 axis. These results were also supported by exposing MDA-MB-231 cells or MCF-7 treated with siN3 to Xirradiation at various doses. Overall, our data showed that overexpression of N3ICD upregulated the expression of Cdh1 and caused p27Kip accumulation by accelerating Skp2 degradation, which in turn led to cell cycle arrest at the G0/G1 phase, in the context of proliferating breast cancer cell lines. These findings help to illuminate the precision therapy targeted to cell cycle progression, required for cancer treatment.
Received 24 July 2015 Revised 13 November 2015 Accepted 27 November 2015
Introduction Previous studies have shown that, during development, cellcycle arrest is critical for controlling cell number, proliferation rate, and organ size. Many differentiated cells undergo cellcycle arrest as part of their differentiation process.1 Furthermore, studies have also revealed that cellular proliferative activities are frequently increased or deregulated by changes in cell cycle modulators in many types of cancer including breast carcinomas, and altered proliferation is one of the main properties of cancer cells.1 Modifications to the cell cycle are therefore closely linked to cancer development and progression. Accordingly, by which molecular pathway does loss of cell cycle regulation in mammary gland epithelial cells lead to cancer? Although the molecular pathways and mechanisms underlying the disordered cell cycle of malignant tumors remain elusive, researchers have understood that if the cells are arrested at a particular cell-cycle phase, this results in the cancer cells becoming non-proliferative. Studies have demonstrated that the major regulatory events leading to proliferation occur in the G1 phase of the cell cycle.2 Therefore, regulating cell cycle
KEYWORDS
breast cancer; Cdh1; cell cycle; Notch3; p27Kip; Skp2
progression, arresting the cell cycle at the G1 phase, and tightly controlling cell-cycle exit, have become major objectives for treating malignant tumors. An increasing number of studies have shown that Cdh1, a positive regulator of APC/C (Anaphase Promoting Complex/ Cyclosome), which controls the ubiquitination and subsequent degradation of many key cell-cycle regulators from mitosis to late G1 is a critical regulator of G0/G1.3-5 In addition to playing a role in cell cycle progression, deregulated Cdh1 has been found to cause aberrant centrosome formation, impaired cytokinesis and DNA re-replication6; furthermore, Cdh1 can regulate cell differentiation by degradation of cyclin-dependent kinase inhibitors and certain transcriptional inhibitors involved in cell cycle withdrawal or the onset of terminal differentiation.7 Unfortunately, the mechanisms involved in the regulation of Cdh1are not well understood. However, Ruohola-Baker et al. demonstrated that both Notch signaling and Cdh1 are required for the mitotic-to-endocycle transition in Drosophila follicle cells.8 Notch families have 4 receptors (Notch1-4) in mammals, which are type I transmembrane proteins.9 All 4 Notch
CONTACT Guo-Jun Zhang [email protected] Cancer Hospital of Shantou University Medical College, 7 Raoping Road, Shantou 515041, China Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/kccy Supplemental data for this article can be accessed on the publisher’s website. © 2016 Taylor & Francis
CELL CYCLE
receptors are similar, but have subtle differences in their extracellular and cytoplasmic domains.10 The cell-bound ligands, which includes 5 transmembrane ligands (Delta1,3,4, Jagged1,2) on the surface of cells,11 activate Notch receptors on juxtaposed cells and initiate the Notch signaling pathway. This signal cascade not only plays important roles in cell differentiation, survival, self-renewal and proliferation,12 but also has a cell cycle regulatory function.13-15 Ball et al. found that overexpression of activated forms of Notch1 and Notch2 in small cell lung cancer cells caused profound growth suppression stemming from G1 cell cycle arrest. Concomitant with this arrest was an up-regulation of the cyclin-dependent kinase inhibitors (CDKIs) p21waf1(cip1 and p27kip1. Of particular relevance, a recent study showed that upregulation of Notch3 was required for induction of p21 expression in senescent cells, and downregulation of Notch3 led to a delayed onset of senescence,14 suggesting that Notch3 strongly correlated with cell cycle progression. In another study, we found that, unlike the other Notch family members, Notch3 could inhibit the proliferation of breast cancer epithelial cells (unpublished data). Herein, we provide solid evidence that overexpressing N3ICD arrests cell cycle at the G1 phase in breast cancer epithelial cells by directly upregulating expression of Cdh1 and p27Kip at the mRNA and protein levels. Upregulated Cdh1 expression accelerates Skp2 degradation, which further mediates p27Kip accumulation.
Results Notch3 overexpression arrested the cell cycle at the G0/G1 phase in breast cancer cells To elucidate the effects of Notch3 on cell cycle progression of breast cancer cells, we first established aN3ICD stable transfectant in low Notch3-expressing MDA-MB-231 cells by co-transfecting pCLE/N3ICD with pEGFP-N plasmids. Meanwhile, we also generated stable Notch3 knock-down cells in high Notch3expressing MCF-7 cells by transfecting pGPU6/GFP/Neo/ shRNA-N3. GFP-positive cells were used to confirm successful transfection (Figure 1A). Furthermore, to verify ectopic Notch3 expression and the efficiency of knocking-down Notch3 gene expression, Western blotting was carried out. Results showed that the upregulated Notch3 expression level was observed in N3ICD/MDA-MB-231 cells; by contrast, the downregulated Notch3 expression level was evident in shRNA-N3ICD/MCF-7 cells (Figure 1B). Next, we monitored the effects of Notch3 on cell cycle progression by measuring the DNA content of the cells by flow cytometry.16 Usually, the G1 phase of the cell cycle lasts from the end of the previous mitosis (M phase) until the beginning of DNA synthesis (S phase). Ectopic overexpression of N3ICD led to an increase (%G0/G1: 59.07% § 0.030) in the percentage of cells with unreplicated DNA, forming the high G0/G1 group, while control MDA-MB-231 cells transfected with empty vector displayed a lower DNA content at G0/G1 phase (% G1/G0, 44.31% § 0.033). Correspondingly, the percentage of cells at both S (20.18% § 0.013) and G2/M (20.75% § 0.038) phases in N3ICD/MDA-MB-231 cells was lower than that in control
433
MDA-MB-231 cells (%S: 24.72% § 0.027; %M: 30.97% § 0.031) (Figure 1C). By contrast, we compared the frequency distribution of those MCF-7 cells transfected with pGPU6/ GFP/Neo/shRNA-N3 and empty vector, respectively. As expected, shRNA-Notch3/MCF-7 exhibited a lower percentage of G0/G1 content (42.73% § 0.036), resulting in a higher percentage of S (23.29% § 0.013) and G2/M (33.98% § 0.045) phases when compared with the control cells (%G0/G1: 51.92% § 0.014; %S: 30.91% § 0.008 and %M: 17.17% § 0.007) (Figure 1D). We evaluated the effects of N3ICD in at least 3 independent experiments. Therefore, we demonstrated that upregulated N3ICD indeed arrests the cell cycle at the G0/G1 phase in breast cancer epithelial cells.
Overexpressing Notch3 inhibited the proliferation and colony-formation rate of breast cancer cells It is accepted that the perturbation of the cell cycle is followed by a reduction in cell proliferation, clonogenic capacity, and inhibition of tumor growth. To further determine whether N3ICD is a functional G0/G1 inhibitor during cell cycle in breast cancer, the effect of N3ICD on breast cancer epithelial cell proliferation was examined by CCK8 assay and colony-formation assay. CCK8 analysis showed that overexpressing N3ICD could significantly attenuate the proliferation of MDA-MB-231 cells at each time point, compared with vector-transfected MDA-MB231 cells (P < 0.05) (Figure 2A), while knock-down of Notch3 could sharply promote the proliferation of MCF-7 cells when compared with sham shRNA/MCF-7 (P < 0.05) (Figure 2B). These results were further confirmed by the subsequent colony-forming assay. Results from the colonyforming assay showed that N3ICD markedly reduced the colony-formation rate efficiency of MDA-MB-231cells (29.56% § 0.097) compared to controls (47.64% § 0.159, *P < 0.05) (Figure 2C). After knocking-down Notch3 in MCF7 cells, the colony-formation rate increased to 33.67% § 5.13, compared to sham shRNA/MCF-7 (20.33% § 4.51) (Figure 2D). These results indicate that overexpressing N3ICD markedly attenuates the malignant properties of breast cancer epithelial cells, including proliferation and clonogenic capacity. Conversely, attenuation of Notch3 expression levels by shRNA results in an increase in cell proliferation and clonogenic capacity.
Overexpressing Notch3 upregulated Cdh1 expression by accelerating Skp2 degradation, which resulted in p27Kip accumulation Considering that cell cycle progression was arrested at the G0/ G1 phase due to overexpression ofN3ICD, we therefore compared the expression levels of certain important G0/G1 phaserelated molecules, such as Cdh1, CDKN1B (p27kip1) and Skp2 by RT-PCR and Western blotting. As shown in Figure 3A, the expression levelN3ICD, Cdh1 and p27kip1, was upregulated in N3ICD-transfecetd MDA-MB-231 cells compared with vectortransfected MDA-MB-231 cells. By contrast, Skp2 exhibited a
434
C.- F. CHEN ET AL.
Figure 1. N3ICD overexpression causes cell cycle arrest at the G0/G1 phase in breast cancer epithelial cells. The successful transfection of N3ICD-overexpressing and Notch3 knock-down constructs is indicated by GFP under fluorescence Microscopy after transfection or co-transfection, respectively. In addition, the successful transfection is shown by co-transfecting the pEGFP-N1 with GFP. N3ICD overexpression and the efficiency of Notch3 knock-down are detected by Western blotting. Upregulated N3ICD is observed in N3ICD-transfected MDA-MB-231 cells (A), and downregulated Notch3 is evident in shRNA-Notch3/MCF-7 cells (B).The percentage of N3ICD-transfecetd MDA-MB-231 cells and shRNA-Notch3/MCF-7 cells in the G0/G1, S and G2/M phases were analyzed by FACS. (C): The percentages of pCLE-transfected MDA-MB-231 cells in the G0/G1, S and G2/M phases are 44.31% § 0.033, 24.72% § 0.027 and 30.97% § 0.031, respectively; while in N3ICD-transfecetd MDA-MB-231 cells, the proportions in the G0/G1, S and G2/M phases are 59.07% § 0.030, 20.18% § 0.013 and G2/M 20.75% § 0.038, respectively (P < 0.05). (D): The percentage of sham siRNA/MCF7 cells in the G0/G1, S and G2/M phases is 51.92% § 0.014, 30.91% § 0.008 and 17.17% § 0.007, respectively; while in siRNA -Notch3/MCF-7 cells, the proportions in the G0/G1,S and G2/M phases are 42.73% § 0.036, 23.29% § 0.013 and 33.98% § 0.045, respectively (P < 0.05)
lower expression in N3ICD-transfecetd MDA-MB-231 cells. The expression level of Cdh1 mRNA sharply increased as a result of Notch3 overexpression. There was no significant difference in mRNA expression levels of Skp2 between the experimental and control groups. Unexpectedly, the mRNA expression level of CDKN1B was significantly upregulated in N3ICD-transfecetd MDA-MB-231 cells (Figure 3B). To further confirm the effect of Notch3 on cell cycle progression, the experiments were also performed in sham shRNA/MCF-7 and shRNA-Notch3/MCF-7 cells. The level of N3ICD, Cdh1 and
p27kip1proteins was downregulated, together with an increased expression of Skp2 in shRNA-Notch3/MCF-7 cells (Figure 3C). At the transcriptional level, the expression level of Cdh1 mRNA sharply decreased with knock-down of Notch3. There was still no significant difference in mRNA expression levels of Skp2 between the experimental and control groups. Consistently, the mRNA expression level of CDKN1B was significantly downregulated in shRNA-Notch3/MCF-7 cells compared with sham shRNA/MCF-7 cells (Figure 3D). This result suggests that the ectopic overexpressed N3ICD directly
CELL CYCLE
435
Figure 2. Effects of N3ICD on colony-formation and cell proliferation of MDA-MB-231 and MCF7cells. (A): Stable expression of N3ICD inhibits MDA-MB-231 cell growth in vitro(P < 0.05). pCLE/N3ICD or pCLE plasmids (as negative control) are co-transfected with pEGFP-N1 vector, as a transfection indicator, into the MDA-MB-231 cells. After 48 h following transfection, the G418-resistant cells were selected by adding G418. The stable cells expressing N3ICD or null cells were used to measure growth absorbance with a CCK-8 kit at the indicated time points. At same time, (B) shows that stable knock-down of Notch3 expression promotes MCF-7 cell growth in vitro (P < 0.05). (C) and (D) show the representative colony-formation assay and quantitative analysis of colony-formation. Values are expressed as the mean § SD from 3 experiments, and the asterisk indicates the statistical significance compared to the controls (*, P < 0.05)
upregulates the expression level of Cdh1, which accelerates Skp2 degradation. Furthermore, Skp2 has been revealed to mediate the ubiquitination of p27kip1 17.
Irradiating MDA-MB-231 cells resulted in p27Kip accumulation, followed by upregulation of Notch3 and Cdh1 expression by accelerating Skp2 degradation Cells subjected to X-irradiation treatment display a dosedependent decrease in cell proliferation and alteration of the cell cycle. To further confirm the relationship between Notch3 and cell cycle progression, we exposed MDA-MB-231 cells to 5 and 10Gy X-ray irradiation. RT-PCR results showed that the mRNA expression levels of Notch3 and Cdh1 were markedly upregulated in a dose-dependent manner after X-ray irradiation treatment. Of particular importance was that there were no significant changes in the mRNA expression levels of Skp2 and p27Kip before or after X-ray irradiation with different doses. Western immunoblotting analysis with anti-Notch3, Cdh1, Skp2 and p27Kip antibodies demonstrated that X-ray irradiation markedly enhanced both Cdh1 and N3ICD protein expression in a dose-dependent manner. Skp2 protein expression was downregulated, while p27Kip protein expression was upregulated. There were no obvious dose-dependent changes observed in Skp2 and p27Kip protein expression after irradiation (Figure 4A, B). To confirm that the X-ray irradiationinduced cell cycle arrest is Notch3-dependent, the IR experiment under the condition of interfering Notch3 with siRNA in MCF-7 cell line was performed. As shown in Figure 4B, D, the results of Western blotting showed that the expression level of endogenous Notch3 was almost completely silenced in MCF-7
cells treated with siN3 when compared with control cells with a dose of irradiation at 0 Gy. However, with irradiation and increasing the irradiation dose, the expression level of Notch3 raised in MCF-7 treated with siN3. Once exposing the cells to 10 Gy of X-rays, the expression level of Notch3 in MCF-7 treated with siN3 almost reached that level of MCF-7 treated with sham siRNA. Correspondently, the expression levels of Cdh1 and p27kip gradually raised with increasing irradiation dose, whereas the expression of skp2 gradually reduced with increasing irradiation dose. In order to assess whether irradiation might affect the expression levels of Notch3, Chd1, skp2 or p27kip via changes in the rate of gene transcription, we used real-time PCR to measure the level of the mRNAs encoding these proteins. The results of qRT-PCR analysis also supported the results of Western blotting. Taken together, these data suggest that the upregulated Notch3 may be involved in X-ray irradiation-mediated cell cycle arrest by enhancing Cdh1 expression, and Skp2 degradation mediated by Cdh1-APC stabilizes p27Kip, thereby ensuring X-ray irradiation -induced cell cycle arrest.
Discussion The present study sought to assess the effects of Notch3 on cell cycle progression by regulating the Cdh1/APC-Skp2-p27Kip axis in breast cancer epithelial cells. It is widely accepted that uncontrolled cell proliferation, genomic instability and cancer initiation are closely related to abnormal activation and progression of cell cycle. Regulating the progression of the cell cycle and blocking the cell cycle of cancer cells have become key objectives for treating malignancies. The cell cycle is driven
436
C.- F. CHEN ET AL.
Figure 3. N3ICD overexpression upregulated Cdh1, and Notch3 knock-down downregulated Cdh1 at both the protein and mRNA expression levels, ultimately affecting downstream genes of Cdh, namely Skp2 and p27Kip.(A) Western blotting shows upregulated Cdh1 and p27Kip by overexpressed N3ICD, while the expression level of Skp2 is reduced in N3ICD-transfecetd MDA-MB-231 cells compared with pCLE/MDA-MB-231 cells. By contrast, (C) shows that Cdh1 and p27Kip expressions were downregulated, while Skp2 was upregulated after Notch3 was knocked down in shRNA-Notch3/MCF-7 cells, compared with sham shRNA/MCF-7 cells. GAPDH was used as an internal standard. (B) and (D) Quantitative RT-PCR of N3ICD, Cdh1, Skp2, and p27Kip cDNA show the expression levels in N3ICD-transfected MDA-MB-231 cells and shRNA-Notch3/MCF7 cells, as well as their control cells. The results are representative of 3 independent experiments
and tightly regulated by a series of cyclins and their associated cyclin-dependent kinases (CDKs). Usually, CDKs are activated by cyclins and suppressed by CDK inhibitors. The expression level of these regulators exhibits dynamic changes during the cell cycle, and displays rapid turnover in ubiquitination-dependent degradation. For example, both the Skp1-Cul1-F-box protein (SCF) complex and the APC/C are important ubiquitin E3 ligases during the cell cycle, and are mainly responsible for controlling the specifically sequential degradation of many regulators during the cell cycle.18 SCF is mainly active in the G1, S, and early M phases, whereas APC/C regulates mitosis and G1.19-23 Although Notch 1 and 2 have been demonstrated to promote cell cycle progression in various types of cancer,24 it has not yet been determined whether Notch3 is associated with changes in cell cycle. In the present study, we investigated the effects of Notch3 on cell cycle in breast cancer epithelial cells by either overexpressing or knocking-down the expression level of N3ICD in 2 different breast cancer cell lines, MDA-MB-231 and MCF-7, respectively. We found that overexpression of N3ICD inhibited proliferation and reduced the colony-formation rate of the N3ICD/MDA-MB-231 cells. We demonstrated that overexpressing N3ICD arrested the cell cycle at the G0/G1 phase, which was a novel effect of N3ICD. Furthermore, in an
attempt to illustrate the mechanism underlying cell cycle regulation by Notch3, we showed that N3ICD overexpression could upregulate the expression level of Cdh1 and p27kip1 proteins, and could downregulate Skp2 expression. Importantly, the expression level of Cdh1 and p27kip1 mRNA increased, but the expression level of Skp2 mRNA reduced concomitantly with N3ICD overexpression. Our results suggest that N3ICD may directly regulate Cdh1 at the transcriptional level, and that Skp2 was regulated at a post-transcriptional level. In this way, the high expression of p27kip1 could be regulated by 2 possible mechanisms. The first can be explained by Skp2 degradation caused by p27kip1 accumulation, and the second is that p27kip1 expression may be directly up-regulated by N3ICD at the transcriptional level. We therefore surmised that this proliferation defect of N3ICD/MDA-MB-231 cells could also be caused by activating the Cdh1/APC-Skp2-p27kip1 axis. The results outlined above were further verified by knocking-down Notch3 in MCF-7 cells. Consistently, knockingdown Notch3 caused downregulation of the percentage shRNA-Notch3/MCF-7 cells in the G0/G1 phase, and these cells acquired enhanced proliferation potential and colonyforming capability. In a parallel fashion, knocking-down Notch3 caused downregulation of the expression of Cdh1 and
CELL CYCLE
437
Figure 4. X-ray irradiation induced N3ICD and Cdh1 expression both at the mRNA and protein levels in a dose-dependent manner, ultimately affecting their downstream genes Skp2 and p27Kip. MDA-MB-231 cells were irradiated with 5Gy and 10Gy, and then whole-cell lysates were harvested for Western blotting and total RNAs were extracted for quantitative RT-PCR. (A) Western blotting shows that N3ICD protein and Cdh1 was upregulated after irradiation in a dose-dependent manner, while Skp2 downregulation and p27 upregulation was observed after irradiation. (B) Quantitative RT-PCR shows that X-rays irradiation induced N3ICD and Cdh1 mRNA expression levels in a dose-dependent manner. However, there were no significant differences in the mRNA expression levels of Skp2 and p27Kip before and after irradiation. The data represents mean § standard error from triplicates. Results are representative of 3 independent experiments. (C) Western blotting shows that N3ICD, Cdh1 and p27 proteins were upregulated in siN3 treated MCF-7 cells after irradiation in a dose-dependent manner when compared with siNC treated MCF-7 cells, whereas Skp2 downregulation was observed after irradiation. (D) Quantitative RT-PCR shows that X-ray irradiation induced N3ICD, Cdh1 and p27 mRNA expression levels increase in a dosedependent manner in siN3 treated MCF-7 cells when compared with siNC treated MCF-7 cells. However, the mRNA expression levels of Skp2 raised at the beginning of the irradiation and then presented a significant decline. The data represents mean § standard error from triplicates. Results are representative of 3 independent experiments
p27kip1 proteins in shRNA-Notch3/MCF-7 cells. Skp2 expression was enhanced when the expression of Notch3 was reduced. Importantly, the expression level of both Cdh1 and p27kip1 mRNA reduced in shRNA-Notch3/MCF-7 cells, but no change was observed in Skp2 mRNA. These results further supported our conclusion that the overexpression of N3ICD specifically induced expression of Cdh1 and p27kip1, and activated the Cdh1/APC-Skp2-p27kip1 axis. To further evaluate the relationship between Notch3 and cell cycle progression, MDA-MB-231 cells were treated with X-ray irradiation, which is frequently associated with the arrest of cell cycle progression. We found that irradiating MDA-MB-231 cells upregulated the expression of Cdh1 and p27kip1 accumulation, followed by an increase in Notch3 expression, while the expression of Skp2 reduced at the protein level. However, we did not observe any significant changes in the expression of Skp2 and p27kip1 mRNA. We believe that the cell cycle arrest caused by X-ray irradiation involved a fairly complex process, and X-ray irradiation was not able to completely imitate ectopic N3ICD overexpression. To confirm whether the IR-induced cell cycle arrest is Notch3-dependent, the Western blotting and RT-qPCR
experiments were performed followed by X-ray irradiation under the condition of interfering Notch3 with siRNA in MCF7 cell line. We found that the expression level of endogenous Notch3 increased with increasing irradiation dose in MCF-7 treated with siN3. Correspondently, the expression levels of Cdh1 and p27kip gradually increased with increasing irradiation dose, whereas the expression of skp2 gradually reduced with increasing irradiation dose. The levels of the mRNAs encoding these proteins in MCF-7 treated with siN3 correspondingly raised accompanied by an increasing irradiation dose except for skp2. Our data suggest that the IR-induced cell cycle arrest is partially dependent on Notch3. We therefore conclude that Notch3 may arrest cell cycle progression of the breast cancer epithelial cells by regulating the Cdh1/Skp2/p27kip1 signaling axis. Although previous studies have shown that in a limited number of tumor types, including human T-cell leukemia and mouse mammary tumors, Notch signaling is oncogenic rather than anti-proliferative,25-27 a recent study has demonstrated opposite functions of Notch in lymphopoiesis. For example, in the development of lymphoid cells, Notch promotes T-cell proliferation but induces apoptosis and growth arrest of B-cell precursors.28 Consequently, we
438
C.- F. CHEN ET AL.
believe that the phenotypic outcome of Notch signaling is often context-dependent. Overall, our data have shown a correlation between cell cycle arrest and activated Notch3 signaling in 2 different breast cancer epithelial cell lines. In greater detail, N3ICD overexpression upregulated the expression of Cdh1 and p27kip1 accumulation, which led to cell cycle arrest at the G0/G1 phase by accelerating theSkp2 degradation in the context of a proliferating breast cancer epithelial cell line. This knowledge can help illuminate the precision therapy targeted to cell cycle progression required for cancer treatment. Future studies should be directed at characterizing the signaling pathway responsible for Notch3-dependent growth arrest in breast cancer epithelial cells, and at understanding the downstream target molecules of Notch3 signaling in epithelial and non-epithelial cell lines.
Materials & methods Plasmids construct 1) The eukaryotic expression plasmids pGLE, pGLE-N3ICD and pEGFP-N1 were developed by our laboratory. Notch3-interferring plasmid, which was constructed using pGPU6/GFP/Neo as a backbone, was purchased from Shanghai Gene Pharma Co. Ltd. The shRNA sequences targeting Notch3 mRNA were designed; the sense sequence was 50 -CACCGTATAGGTGTTGACGCCATCCACGCATTCAAGAGATGCGTGGATGGCGTCAACACCTATATTTTTTG-30 , and the antisense sequence was 50 -GATCCAAAAAATATAGGTGTTGACGCCATCCACGCATCTCTTGAATGCGTGGATGGCGTCAACACCTATAC ¡30 . After annealing, the shRNA was inserted into the pGPU6/ GFP/Neo vector. Cell culture T47D, BT549, SKBR3, MDA-MB-231 and MCF-7 breast cancer cells were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were routinely grown with DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Cells were passaged every 4–5 days and the medium was changed once during this time. Once these cultures attained confluence, the cells were used for various experiments such as RT-PCR, irradiation, colony-formation assays or Western blotting. Transient and stable transfection Cells were plated in 6-well plates at a density of 1 £ 105 cells per well, in 2 ml of the appropriate growth medium supplemented with serum. For each transfection, 1 to 2 mg of DNA was diluted in 100 ml of serum-free medium, and 2 to 25 ml of lipofectamine reagent was diluted in 100 ml of serum-free medium. These two solutions were combined, mixed gently, and then incubated at room temperature for 15 to 45 min. The cells were then washed once with 2 ml of serum-free medium. For each transfection, 0.8 ml of serum-free medium was added, without antibacterial agents, to each tube containing the lipidDNA complexes. The diluted lipid-DNA solution was mixed gently, and then overlaid onto the washed cells. Medium was
replaced at 6 to 8 hours following the start of transfection. For the transient transfection, cell extracts were tested for gene activity at 24 to 72 hours after the start of transfection, according to cell type and promoter activity. For the stable transfection, following transfection, cells were allowed to grow and express the protein for G418 resistance under non-selective conditions for at least 24 hours. For selection of stably-expressing cells, cells were cultivated in standard medium with supplements and the appropriate amount of G418. Cells were grown for at least 3 weeks under selection pressure to avoid contamination with non-resistant cells, and then the G418 concentration was reduced after 1–2 weeks. Cell cycle analysis with FACS The MDA-MB-231 cells stably expressing Notch3, and the MCF-7 cells stably knocking-down Notch3, as well as the control cells transfected with empty vectors in an exponential growth phase, were trypsinized, suspended into single-cell mixtures and washed with PBS. Cells were then treated with 20 mg/ mL RNase A, and stained with 25 mg/ml Propidium Iodide (PI) for 1 h before being subjected to cell cycle analyses. Flowcytometric analyses were performed using a FACS Calibur flow cytometer (FACS420) to measure DNA content. A total of 10,000 events were collected per experiment, and the data were analyzed using the MODFIT software program. Real time reverse transcriptional PCR Ò
Briefly, total RNA was extracted using Trizol reagent (Invitrogen Corporation, USA) according to the manufacturer’s protocol, and was purified using the TURBO DNA-freeTM Kit (Ambion, cat. no. AM1907). cDNAs were then synthesized using Prime ScriptTM RT reagent Kit (TAKARA, DRR036A) in a 20 ml volume of reaction mixture, according to the manufacturer’s instructions. Real-time PCR was carried out in the ABI step one plus Real-time PCR System. Primers were designed online with NCBI and the sequences are shown in Table S1. The change in expression of a target gene was calculated as: fold change D 2-(DCT,Tg- DCT,control). The following PCR conditions were used: 6 min denaturing at 94 C, (30 s denaturing at 94 C, 30 s annealing at 60 C, 30 s extension at 72 C) for 35 cycles, 10 min extension at 72 C and then at 4 C thereafter. Each reaction was run in triplicate with at least 3 independent biological replicates. CT values were first normalized to GAPDH as an internal control. Antibodies and western blotting The cells in each group were lysed in ice-cold RIPA lysis buffer. The homogenates were then centrifuged at 12,000 £ g for 10 min at 4 C. The clear supernatants were quantified and were stored at -80 C until required for use. Samples were separated by 4%-20% gradient polyacrylamide gel SDS-PAGE. Proteins were then transferred from the gel onto a PVDF membrane. After transferring, the PVDF membranes were blocked with 5% BSA for 1 h at room temperature. Membranes were then incubated with primary antibodies (listed in Table S2) overnight at 4 C. After this period, all membranes were
CELL CYCLE
incubated in different secondary antibodies, in turn, for 1 h at 37 C while shaking. Finally, the PVDF membranes were developed using the ECL detection system.Notch3 intra-cellular domain (Notch3-ICD) protein and green fluorescence protein (GFP) were detected using a rabbit monoclonal antibody (CST/ C37C3, 1:4000)or a mouse monoclonal antibody (CST/ 4B10,1:3000) from Cell signaling Technology, Inc. (Danvers, MA). The antibodies used for Cdh1, Skp1 and p27 were a mouse monoclonal antibody (Calbiochem at 1:1000),a rabbit polyclonal antibody(Santa Cruz, 1:4000), and a rabbit polyclonal antibody (Santa Cruz,1:4000), respectively and the mouse monoclonal antibody to GAPDH (Santa Cruz,1:3000) was also obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).
439
Statistical analysis All data are presented as means and standard errors of the mean (mean § SEM). For comparing means at the same time point between the experiment and control group, a Student’s T test was performed. To compare the rates in the 2 groups, data were evaluated by the Pearson’s Chi-Square method with SSPS software (Version 16.0). Values of P < 0.05 were considered to be statistically significant.
Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed.
References Irradiation of breast cancer cells MDA-MB-231 cells were dissociated by trypsinization and mechanical agitation with a Pasteur pipette into single cell suspensions in the culture medium supplemented with 10% FBS. A total of 1 £ 104 cells were seeded in each 25 mm2 culture flask, and then incubated for 48 h in antibiotic-free medium at37 C, in a 5% CO2 incubator. When cell confluence reached 60%, the flasks were filled to the limit with PBS. Cells were then irradiated from a vertical direction at a dose rate of 400 cGy/min with 6-MV X-rays produced by a Varian linear accelerator obtained by the Department of radiotherapy of Cancer Hospital of Shantou University Medical College. Cells were irradiated for the time required to receive a total dose of 0, 5, and 10 Gy, respectively. Negative control cells were sham-irradiated. Following irradiation, cells were washed twice with PBS and supplemented with fresh medium contained 10% FCS, then cultured continuously at 37 C in a 5% CO2 environment for 7 days for subsequent experiments.
Cell proliferative assay and colony-formation assay Cell proliferation potential was evaluated by cell proliferation assays using CCK-8 assays (Tokyo, Japan). The MDA-MB-231 cells stably expressing Notch3 and the MCF-7 cells stably knocking-down Notch3 in an exponential growth phase were plated at a concentration of 1 £ 105 cells/ml into 96-well culture plates. Cells transfected with empty vectors were used as negative controls. The replications were carried out with 5 wells plated with the same cells. For the cellular proliferation assay, 10 ml of CKK-8 solution was added to each plate-well at 0, 2, 3, 4, 5, 6 and 7 d after inoculation, and plates were then incubated for 2 h. Absorbance was measured at 450 nm using a microplate reader (SpectraMax M5, Sunnyvale, CA, USA). For the colony-formation assay, approximately 5 £ 102 MDA-MB-231 cells stably transfected withNotch3 and the MCF-7 cells stably knocking-down Notch3 in an exponential growth phase, and negative control cells were plated in 100-mm culture dishes. After 18 days, cells were fixed with methanol and stained with 0.5 ml of Giemsa’s staining for 15 min. Visible colonies were manually counted.
1. Fernandez PL, Jares P, Rey MJ, Campo E, Cardesa A. Cell cycle regulators and their abnormalities in breast cancer. Mol Pathol: MP 1998; 51:305-9; PMID:10193510; http://dx.doi.org/10.1136/mp.51.6.305 2. Blagosklonny MV, Pardee AB. The restriction point of the cell cycle. Cell Cycle 2002; 1:103-10; PMID:12429916 3. Reed SI. Ratchets and clocks: the cell cycle, ubiquitylation and protein turnover. Nat Rev Mol Cell Biol 2003; 4:855-64; PMID:14625536; http://dx.doi.org/10.1038/nrm1246 4. Nakayama KI, Nakayama K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer 2006; 6:369-81; PMID:16633365; http://dx. doi.org/10.1038/nrc1881 5. Skaar JR, Pagano M. Cdh1: a master G0/G1 regulator. Nat Cell Biol 2008; 10:755-7; PMID:18591966; http://dx.doi.org/10.1038/ncb0708755 6. Taylor S, Peters JM. Polo and Aurora kinases: lessons derived from chemical biology. Curr Opin Cell Biol 2008; 20:77-84; PMID:18249108; http://dx.doi.org/10.1016/j.ceb.2007.11.008 7. Li W, Wu G, Wan Y. The dual effects of Cdh1/APC in myogenesis. FASEB J 2007; 21:3606-17; PMID:17601983; http://dx.doi.org/ 10.1096/fj.07-8159com 8. Schaeffer V, Althauser C, Shcherbata HR, Deng WM, Ruohola-Baker H. Notch-dependent Fizzy-related/Hec1/Cdh1 expression is required for the mitotic-to-endocycle transition in Drosophila follicle cells. Curr Biol: CB 2004; 14:630-6; http://dx.doi.org/10.1016/j. cub.2004.03.040 9. Almen MS, Nordstrom KJ, Fredriksson R, Schioth HB. Mapping the human membrane proteome: a majority of the human membrane proteins can be classified according to function and evolutionary origin. BMC Biol 2009; 7:50; PMID:19678920; http://dx.doi.org/10.1186/ 1741-7007-7-50 10. Weinmaster G. The ins and outs of notch signaling. Mol Cell Neurosci 1997; 9:91-102; PMID:9245493; http://dx.doi.org/10.1006/ mcne.1997.0612 11. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999; 284:7706; PMID:10221902; http://dx.doi.org/10.1126/science.284.5415.770 12. Bolos V, Grego-Bessa J, de la Pompa JL. Notch signaling in development and cancer. Endocr Rev 2007; 28:339-63; PMID:17409286; http://dx.doi.org/10.1210/er.2006-0046 13. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res 2001; 61:3200-5; PMID:11306509 14. Cui H, Kong Y, Xu M, Zhang H. Notch3 functions as a tumor suppressor by controlling cellular senescence. Cancer Res 2013; 73:34519; PMID:23610446; http://dx.doi.org/10.1158/0008-5472.CAN12-3902 15. Dohda T, Maljukova A, Liu L, Heyman M, Grander D, Brodin D, Sangfelt O, Lendahl U. Notch signaling induces SKP2 expression and promotes reduction of p27Kip1 in T-cell acute lymphoblastic leukemia cell lines. Exp Cell Res 2007; 313:3141-52; PMID:17560996; http://dx.doi.org/10.1016/j.yexcr.2007.04.027
440
C.- F. CHEN ET AL.
16. Haase SB, Lew DJ. Flow cytometric analysis of DNA content in budding yeast. Methods Enzymol 1997; 283:322-32; PMID:9251030; http://dx.doi.org/10.1016/S0076-6879(97)83026-1 17. Kossatz U, Dietrich N, Zender L, Buer J, Manns MP, Malek NP. Skp2dependent degradation of p27kip1 is essential for cell cycle progression. Genes & Dev 2004; 18:2602-7; PMID:15520280; http://dx.doi. org/10.1101/gad.321004 18. Vodermaier HC. APC/C and SCF: controlling each other and the cell cycle. Curr Biol: CB 2004; 14:R787-96; PMID:15380093; http://dx.doi. org/10.1016/j.cub.2004.09.020 19. Prosser SL, Samant MD, Baxter JE, Morrison CG, Fry AM. Oscillation of APC/C activity during cell cycle arrest promotes centrosome amplification. J Cell Sci 2012; 125:5353-68; PMID:22956538; http://dx.doi. org/10.1242/jcs.106096 20. Tudzarova S, Colombo SL, Stoeber K, Carcamo S, Williams GH, Moncada S. Two ubiquitin ligases, APC/C-Cdh1 and SKP1-CUL1-F (SCF)-beta-TrCP, sequentially regulate glycolysis during the cell cycle. Proc Natl Acad Sci U S A 2011; 108:5278-83. 21. Yamao F. [Ubiquitin system connected with cell cycle control]. Tanpakushitsu Kakusan Koso 2001; 46:1704-9; PMID:11579569 22. Pfleger CM, Kirschner MW. The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev 2000; 14:655-65; PMID:10733526
23. Li M, Zhang P. The function of APC/CCdh1 in cell cycle and beyond. Cell Div 2009; 4:2; PMID:19152694; http://dx.doi.org/10.1186/17471028-4-2 24. Roy M, Pear WS, Aster JC. The multifaceted role of Notch in cancer. Curr Opin Gen Dev 2007; 17:52-9; PMID:17178457; http://dx.doi.org/ 10.1016/j.gde.2006.12.001 25. Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 1991; 66:649-61; PMID:1831692; http://dx.doi.org/10.1016/00928674(91)90111-B 26. Uyttendaele H, Marazzi G, Wu G, Yan Q, Sassoon D, Kitajewski J. Notch4/int-3, a mammary proto-oncogene, is an endothelial cell-specific mammalian Notch gene. Development 1996; 122:2251-9; PMID:8681805 27. Pear WS, Aster JC, Scott ML, Hasserjian RP, Soffer B, Sklar J, Baltimore D. Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 1996; 183:2283-91; PMID:8642337; http://dx.doi.org/10.1084/ jem.183.5.2283 28. Morimura T, Goitsuka R, Zhang Y, Saito I, Reth M, Kitamura D. Cell cycle arrest and apoptosis induced by Notch1 in B cells. J Biol Chem 2000; 275:36523-31; PMID:10967117; http://dx.doi.org/10.1074/jbc. M006415200
