Vol. 66, No. 4

JOURNAL OF VIROLOGY, Apr. 1992, p. 2170-2179

0022-538X/92/042170-10$02.00/0 Copyright © 1992, American Society for MicrobiologY

Novel Human Endogenous Sequences Related to Human Immunodeficiency Virus Type 1 M. S. HORWITZ,12 M. T. BOYCE-JACINO,l AND A. J. FARAS1,2* Department of Microbiology and Institute of Human Genetics, University of Minnesota, Minneapolis, Minnesota 55455 Received 27 January 1991/Accepted 18 December 1991

Endogenous retrovirus-related sequences exist within the normal genomic DNA of all eukaryotes, and these endogenous sequences have been shown to be important to the nature and biology of related exogenous retroviruses and may also play a role in cellular functions. To date, no endogenous sequences related to human immunodeficiency virus type 1 (HIV-1) have been reported. Herein we describe the first report of the presence of nucleotide sequences related to HIV-1 in human, chimpanzee, and rhesus monkey DNAs from normal uninfected individuals. We also present the isolation and characterization of two of these endogenous HIV-1-related sequences, EHS-1 and EHS-2. With use of low-stringency Southern blot hybridization, complex banding patterns were detected in human DNA with 5' and 3' HIV-1-derived probes. When an HIV-1 env region probe was used, we detected a less complex, conserved banding pattern in human DNA as well as a related but distinct banding pattern in chimpanzee and rhesus monkey DNAs. EHS-1 and -2 were cloned from normal human genomic DNA libraries by using the env region probe. Clone EHS-1 shows sequence similarity with the domain of the envelope cellular protease cleavage site of HIV-1, while EHS-2 has sequence similarity to the overlapping reading frame for Rev and gp4i. Stringent hybridization of EHS-1 back to primate genomic DNA indicates two distinct EHS-1 loci in normal human DNA, an identical band pattern in chimpanzee DNA, and a single locus in rhesus monkey DNA. Likewise, EHS-2 is present as a single highly conserved locus in all three species. An oligonucleotide derived from EHS-2 across a region of near identity to HIV-1 detects a complex banding pattern in all primates tested similar to that seen with the 3' HIV-1 probe. These data suggest that most of the HIV-1-related sequences identified in primate DNA share a common core of nucleic acid sequence found in both EHS-2 and rev and that some of these H1V-1-related sequences have additional larger regions of sequence similarity to HIV-1.

The genomes of eukaryotic organisms contain a wide variety of endogenous retroviruses and retroviruslike elements which are transmitted as heritable Mendelian elements yet exhibit structural and sequence similarities to infectious exogenous retroviruses (48). Endogenous retrovirus-related sequences can encode gene products that compete in trans for retrovirus function, can offer sites for recombination, and can embody a pool of related cellular genetic material from which the exogenous virus can evolve. Generally, endogenous retroviruses detected within a given species are most closely related to exogenous retroviruses which infect that host. Human endogenous retrovirus sequences have been identified by several approaches, including low-stringency hybridization to nonhuman exogenous and endogenous retroviruses (2, 4, 30, 34, 36), hybridization to the 3' terminus of tRNAs (16, 18), analysis of flanking regions of cellular genes (23, 24), and polymerase chain reaction (PCR) amplification of conserved retrovirus domains with use of mixed oligonucleotide primers (1, 40). Although the function of these endogenous retroviruslike sequences is unknown, their potential contributions to exogenous viral pathogenesis is suggested by several previously described endogenous-exogenous recombinations which produce viruses with new tropisms and pathology. For example, Harvey and Kirsten murine leukemia viruses resulted from recombination of exogenous murine leukemia virus with the endogenous VL30 elements (5, 10). Feline leukemia viruses also acquire altered tropism and pathogen*

esis from recombination with their endogenous counterparts (35). The acquisition of cellular oncogenes by retroviruses demonstrates that a cellular sequence merely needs to provide a desirable characteristic to bring about a selectable recombination event. Because of the recent identification of several classes of human endogenous retroviruses and our interest in obtaining a better understanding of the evolution of human immunodeficiency virus (HIV), experiments were performed to detect the presence of HIV-1-related sequences in normal human DNA. To date, no endogenous sequences related to HIV-1 have been described. Such species, if detected, could represent either a related endogenous retrovirus or a cellular genetic sequence with a functional domain similar to one or more of those found in HIV-1. We have previously used reduced-stringency hybridization conditions to allow us to detect novel endogenous retroviruses exhibiting as little as 65% sequence similarity to the retroviral probes employed (8, 9). We report herein the initial detection and characterization of endogenous HIV-1-related sequences (EHS) in normal human DNA by using both low-stringency Southern blot hybridization and low-stringency hybridization screening of human genomic DNA lambda libraries. MATERIALS AND METHODS Cloned viral DNAs. Plasmid pN1GD4 is a proviral clone of HIV-1 containing a minor deletion within gag and was provided by D. Volsky (47). Subgenomic probes of HIV-1 were generated by deleting the EcoRI fragments of pNlGD4 to generate the 5' probe and alternatively the SalI fragment

Corresponding author. 2170

VOL. 66, 1992

NOVEL HUMAN ENDOGENOUS SEQUENCES RELATED TO HIV-1

to generate the 3' probe. The envelope containing BglII probe was generated by digesting the target DNA with the appropriate enzyme and cloning into pUC13. Preparation of DNA probes. Plasmid DNA was digested with an appropriate restriction enzyme and separated by gel electrophoresis. Gel-isolated DNA restriction fragments were radioactively labeled by incorporation of [32P]dCTP by the random-priming method (11) to a specific activity of at least 5 x 10 cpm/,ug. A synthetic oligonucleotide primer was generated to EHS-2 by the University of Minnesota Microchemical Facility. The 31-mer (AGAAATGGGTGGAGAGAGAGACA GAGACAGA) was end labeled (29) with [32P]dATP and T4 polynucleotide kinase to a specific activity of at least 5 x 108 cpm/,g. Preparation of eukaryotic genomic DNA. High-molecularweight eukaryotic genomic DNA was extracted from human placental tissue, human peripheral blood lymphocytes (PBLs) extracted from blood samples, chimpanzee PBLs

extracted from EDTA-treated blood samples provided by William Hobson at the Primate Research Institute at Holloman Air Force Base in New Mexico, and rhesus monkey spleen tissue provided by Dan Houser at the Wisconsin Regional Primate Research Center in Madison, Wis. Homogenized tissue or PBLs were resuspended in 2 volumes of buffer (0.2 M Tris-HCl [pH 8.2], 0.1 M EDTA, 0.5% sodium dodecyl sulfate [SDS], 500 ,ug of pronase per ml) and incubated at 37°C for 24 h. DNA was extracted several times with an equal volume of buffer-saturated phenol-chloroform. Sodium acetate to a final concentration of 0.2 M and 2 volumes of ethanol were added, and the genomic DNA was spooled out of solution. DNAs were RNase treated and subjected to another round of extraction and precipitation. Nucleic acid hybridization. DNAs were digested with an appropriate restriction enzyme, fractionated by agarose gel electrophoresis, and transferred to Bio-Rad Zetaprobe nylon membrane in 20x SSC (3 M NaCl, 0.3 M sodium citrate) by a modification of the Southern procedure (43). Membranes with bound DNA were washed in 0.1 x SSC-0.5% SDS prior to hybridization. The following standard prehybridization solution was used for all Southern blot hybridizations using a random-primed probe: 30 or 50% formamide (30% formamide for low stringency, 50% for high stringency), 1 M NaCl, 20 mM Tris-HCl (pH 7.4), 0.1% SDS, and 150 U of heparin (500 ,ug/ml) per ml (42). For hybridization, a fresh solution of prehybridization solution was prepared with the addition of 8% dextran sulfate and 5 x 106 cpm of 32P-labeled probe per ml and incubated for 12 to 15 h at 42°C. Blots were washed in a solution of 2x SSC, 0.1% SDS, and 0.1% sodium pyrophosphate for three times of 15 min each at room temperature. High-stringency blots were washed an additional two times for 1 h at 50°C in 0.5x SSC-0.1% SDS-0.1% sodium pyrophosphate. Low-stringency blots were washed an additional two times for 1 h each at 50°C in 3x SSC-0.1% SDS-0.1% sodium pyrophosphate. Blots probed with an oligonucleotide were prehybridized in a solution containing 1 M NaCl, 50 mM Tris-HCl (pH 7.5), 10% dextran sulfate, 1% SDS, and 100 ,ug of denatured sheared salmon sperm DNA per ml for 1 h at 55°C. After incubation, 2 x 106 cpm of 32P-end-labeled oligomer per ml was added, and hybridization was allowed to continue for 12 h at 55°C. Oligonucleotide-hybridized blots were washed initially like the DNA-probed blots and additionally for 1 h at 420C in 3x SSC-0.1% SDS-0.1% sodium pyrophosphate. After washing, all blots were sealed in bags to prevent drying and exposed to X-ray film. Prior to reprobing, blots were

2171

stripped of hybridizing probe by incubation in 0.4 N NaOH for 30 min at 42°C and then in 0.1x SSC-0.1% SDS-0.2 M Tris-HCI (pH 7.4) for 30 min at 42°C. Blots were exposed overnight to X-ray film to show that probe was completely removed. Library screening and cloning of genomic DNA. Two human genomic libraries were screened for clones by using a low-stringency modification of the Benton-Davis plaque lift hybridization procedure (29). Lifts were hybridized like the membranes described above. A Charon 4 recombinant human genomic fetal liver DNA library was provided by T. Maniatis (20). Additionally, human placental DNA was completely digested with BamHI and fractionated on a salt gradient. Fractions were tested for hybridization, and an appropriate 15-kb fraction was half site filled in with dATP, dGTP, and Klenow fragment. This target DNA was ligated to lambda Gem 11 arms digested with XhoI and half site filled in with dCTP and dTlP (Promega Biotec Inc.). The ligation mixture was packaged into in vitro packaging extracts (29). Plate lysates were used to prepare lambda DNA for analysis and subcloning (29). Subclones of recombinant lambda clones were constructed in pUC13, using appropriate restriction enzymes and standard ligation conditions. Subclones for sequencing were generated by using a double-stranded nested deletion kit purchased from Pharmacia. DNA sequencing. Cesium chloride gradient-purified plasmid DNAs were sequences by the dideoxy method of Sanger et al. (38) adapted for double-stranded templates and T7 DNA polymerase (Sequenase; United States Biochemical Corp.). Sequence data were analyzed by using a SUN computer equipped with Intelligenetics software. Programs used included FastDB, IFIND, GenAlign, ALIGN, GEL, SEQ, and PEP. Nucleotide sequence accession numbers. The sequence data for EHS-1 and EHS-2 have been entered in the GenBank data base under accession numbers M85292 and M86246, respectively. RESULTS HIV-1-related sequence in primate DNA. Three probes (5', 3', and BglII) representing subgenomic regions of HIV-1 were subcloned from a cloned HIV-1 isolate, N1GD4, for use in hybridization analysis (Fig. 1). The 4.1-kb 5' probe extends from the first Sacl site to the second EcoRI site and includesgag,pol, and vip. The 3.8-kb 3' probe extends from the Sall site to the SacI site in the long terminal repeat. This probe includes all of env as well as tat, rev, and nef. The 1.3-kb BglII probe encompasses the domains encoding all of gp4l, the 3' end of gpl20, and most of Nef. These probes were labeled with 32P and hybridized to a Southern blot of human genomic placental DNA under high- and low-stringency conditions as described in Materials and Methods. As expected, no hybridization was observed under conditions of high-stringency hybridization (blot not shown); however, several bands that hybridized to either the 5' or 3' HIV probe under low-stringency hybridization conditions were detected (Fig. 1A). The 3' HIV probe was capable of detecting stronger, more distinct bands than was the 5' HIV probe. Four major bands (9.5, 6.0, 4.4, and 3.2 kb) were detected in PstI-digested genomic DNA when probed with the 3' probe. To better define the portion of HIV-1 responsible for the major hybridization seen with the 3' probe, the BglII probe was hybridized under high- and low-stringency conditions to human, chimpanzee, and rhesus monkey genomic DNAs

2172