Stem Cell Rev and Rep DOI 10.1007/s12015-013-9489-5

Novel Pancreas Organogenesis Markers Refine the Pancreatic Differentiation Roadmap of Embryonic Stem cells Maria Teresa De Angelis & Filomena Russo & Fulvio D’Angelo & Antonella Federico & Marica Gemei & Luigi Del Vecchio & Michele Ceccarelli & Mario De Felice & Geppino Falco

# Springer Science+Business Media New York 2014

Abstract The generation of pancreatic endocrine and exocrine functional precursors from embryonic stem cells (ESCs) is an intriguing opportunity to address cell therapy challenges. The main goal of cellular regeneration is to derive, in vitro, pancreatic progenitor cells (PPCs) that retain the capacity to differentiate following the in vivo developmental ontogeny. In our work, we aim to refine the pancreatic in vitro cellular transitions, through the identification of the intrinsic factors that mark the pancreas budding process at embryonic stage 10.5 (E10.5), in which pancreas precursor specification predominantly occurs. We identified a cohort of genes (Bex1,

Nepn , Pcbd1 , Prdxdd1 , Rnf160 , Slc2a1 , and Tff3 ) that marked the pancreas budding genesis, and above all signaled ESC differentiation transitions during pancreatic lineage commitment. Noticeably, we demonstrated that the expression of Nepn marked a naïve pancreatic cellular state that resembled PPC-like specification. Our data considerably improve the comprehension of pancreatic cellular ontogeny, which could be critical for implementing pluripotent stem cells programming and reprogramming toward pancreatic lineage commitment. Keywords Embryonic stem cells . Pancreas . Bud . Progenitor cells . Laser microdissection . Specification

This work was supported by European International Reintegration Grant Marie Curie FP7th; MIUR Merit program RBNE08NKH7_004; and by Biogem Research Institute “Gaetano Salvatore”. Electronic supplementary material The online version of this article (doi:10.1007/s12015-013-9489-5) contains supplementary material, which is available to authorized users. M. T. De Angelis : F. Russo : F. D’Angelo : M. Ceccarelli : M. De Felice : G. Falco (*) Biogem, Istituto di Ricerche Genetiche Gaetano Salvatore, Ariano Irpino, Italy e-mail: [email protected] G. Falco e-mail: [email protected] A. Federico Istituto di Endocrinologia ed Oncologia Sperimentale del CNR, University of Naples “Federico II”, Naples, Italy M. Gemei : L. Del Vecchio : M. De Felice Department of Molecular Medicine and Medical Biotechnologies, University of Naples “Federico II”, Naples, Italy M. Ceccarelli : G. Falco Department of Science and Technologies, Università degli Studi del Sannio, Benevento, Italy

Introduction The widespread prevalence of debilitating diseases that result from pancreatic dysfunction is encouraging numerous studies to strengthen our knowledge of the principles governing the formation of this organ to promote the pancreatic cell regeneration, or to implement the cancer progression knowledge. One intriguing opportunity to challenge those issues comes from the studies of embryonic stem cells (ESCs) differentiation. ESCs are derived from the inner cell mass of blastocyst and are characterized by the remarkable peculiarity to produce the majority of cell types. In standard culture conditions, the majority of ESCs can divide without losing the pluripotency [1] but under suitable stimuli the ESCs may homogeneously differentiate into all cell types, making a promising renewable source for regenerative medicine, and replacement therapies [2]. The major aim of ESC-based protocols is to derive progenitor cells that retain both the capacity to proliferate and to differentiate following normal developmental ontogeny thus offering an unlimited source of safe precursor cells. The most

Stem Cell Rev and Rep

promising differentiation protocols are based on extrinsic factors that are produced by the notochord, dorsal aorta, and pancreatic mesenchyme during pancreas organogenesis [3–6]. The identification of a detailed molecular roadmap underlining the in vivo pancreatic fate specification would further improve the efficiency and the quality of the in vitro pancreatic cell derivatives. Actually, the characterization of those molecular factors is still missing because of the limited in vivo availability of pancreatic progenitor cells (PPCs) [7–9]. A reliable source of PPCs is temporally and transiently enriched during pancreas budding processes, where PPCs are marked by multipotent phase occurring mainly between embryonic developmental stages E9.5–E12.5, referred to as the “primary transition”, and a highly proliferative state between the stages between E13.5 and E15.5, referred to as “secondary transition” [10]. A greater comprehension of the molecular network that underlines multipotent developmental stage could be crucial for improving cell-replacement methodology. These considerations prompted us to investigate the molecular factors that are specifically expressed in pancreatic bud (PB) during the multipotent first transition to eventually refine pancreatic in vitro specification. In order to homogeneously dissect PB within a complex tissue organization, we relied on both morphogenesis parameters, and the expression of PPCs marker Pancreatic and duodenal homeobox 1 (Pdx1). Those two criteria enabled us to finely and accurately collect the PB through laser capture microdissection (LCM), and to characterize the specific global gene expression profile of pancreas budding through DNA microarray hybridization. In particular, we report a subset of those genes (Bex1 , Nepn , Pcbd1 , Prdxdd1, Rnf160, Slc2a1, and Tff3) that was significantly enriched also during in vitro pancreatic lineage specification. Noticeably, the gene Nepn marked a transient subpopulation of a novel pancreatic cellular state which is induced during ESCs differentiation toward pancreatic lineage specification. Our data suggested that the expression of Nepn could be considered as a novel entry point for pancreas lineage formation both in vivo and in vitro.

Material and Methods Embryo Dissection and Embedding The embryos were collected on E10.5 and the appearance of the vaginal plug denotes E0.5. All animals employed for the experiments were used in accordance with regulations and guidelines of Italy and the European Union and were approved by the local ethical committee. After dissection in cold phosphate-buffered saline (PBS), embryos were treated with 30 % sucrose overnight at 4 °C. They were rinsed in PBS, placed in sterile cryomolds biopsy and embedded in OCT (Sakura).

Immunofluorescence A 8 μm thick frozen sections were collected on polylysine glass slides (Menzel-Gläser) and fixed with 4 % paraformaldehyde (PFA) for 15 min. After, the sections were permeabilizated in 0.1 % Triton X-100 in PBS (PBT) twice for 10 min and then fixed with 4 % PFA for 5 min. The sections were pre-incubated in Protein block serum-free (DakoCytomation) at room temperature for 15 min. The sections were incubated with primary antibodies monoclonal Rat anti-E-Cadherin 1:2500 (ECCD-2, Calbiochem), Rabbit Polyclonal anti-Pdx1 1:1000 (abcam) at room temperature for 2 h; followed by the incubation with secondary antibodies Fluorescein-5-isothiocyanate (FITC) conjugated AffiniPure Donkey Anti-Rat IgG 1:200 (Jackson ImmunoResearch), Texas red dye-conjugated AffiniPure Goat Anti-Rabbit IgG 1:200 (Jackson ImmunoResearch) at room temperature for 30 min. Then the sections were treated with 4′,6-Diamidino2-Phenylindole, DAPI (Sigma Aldrich), diluted 1:10000 in PBS at room temperature for 5 min. After each incubation the sections were washed in PBS. Slides were mounted with Fluorescent mounting medium (Dako Cytomation). The images were Acquired with Zeiss Axioplan2 microscope at different magnifications and processed by AxioVision Rel.4.8 program. Laser Capture Microdissection (LCM) and RNA Isolation Tissue sections (8 μm) were cut on a cryostat (Leica Microm HM 500 M) on polylysine slides (Menzel-Gläser), stored on dry ice and dehydrated (75 % EtOH 30 s, dH2O DEPC 30 s, 75 % EtOH 30 s, 95 % EtOH 30 s, 100 % EtOH 30 s, xylene 5 min, drying 5 min). Laser Capture Microdissection (LCM) was performed using the PixCell II system (Arcturus) under 20× magnification with a laser spot size of 10 μm, laser output power of 100 mW and pulse duration of 1.5 ms. Dorsal pancreatic buds dissected from three embryos at E10.5 were captured on thermoplastic CapSure HS caps (Arcturus) and the whole section without pancreatic buds were scraped with a scalpel. The samples were used to extract total RNA using the Pico-Pure RNA isolation kit (Arcturus). RNA yields were about ~5 ng from 3 dorsal buds. RNA quality and integrity was determined by an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) on RNA Pico Chips (Agilent Technologies). Three biological replicates with RNA integrity numbers (RIN) higher than 7 were considered to obtain labeled sense-strand cDNA (ss cDNA). RNA Amplification, Labelling, and Hybridization RNA samples obtained by LCM were amplified with the RiboAmp HS PLUS RNA Amplification Kit (Arcturus) that provides in linear amplification from 500 to 5 ng of RNA

Stem Cell Rev and Rep

according to manufacturer’s protocol. ss cDNA is synthesized by the reverse transcription of antisense RNA (aRNA) using Ambion WT Expression Kit (Ambion). After fragmentation and labelling of the ss cDNA samples with Affymetrix GeneChip WT Terminal Labeling Kit (Affymetrix) is possible hybridize on the GeneChip® Mouse Gene 1.0 ST Array. Microarray Data Analysis Biotinylated cRNA was hybridized to GeneChip Mouse Gene 1.0 ST Arrays (Affymetrix, MoGene-1_0-st), which analyse 25136 gene transcripts, according to standard Affymetrix protocols. The datasets obtained, consisted of cell intensity files (CEL files), were analysed with GeneSpring GX 12 Software (Agilent Technologies). Robust multichip average (RMA) algorithm [11] was used for summarization and normalization. Hybridization quality was assessed by spiked-in controls: bioB is at the level of assay sensitivity (1.5 pM) and it was detected on all chips; bioC, bioD and cre were also present in increasing concentrations (5, 25, and 100 pM respectively). Statistical analysis was performed using an unpaired T-test, resulting in 71 out of 301 transcripts satisfying p -value ≤ 0.05. GO terms were analysed by a standard hypergeometric test to evaluate their enrichment in frequency in the regulated genes list relative to all genes list. Differentially expressed genes were further analysed using Ingenuity Pathway Analysis (IPA; http://www.ingenuity.com), a web-based tool for the identification of biological functions as well as canonical pathways that are most significant to the dataset. RT–PCR and Quantitative PCR (qPCR) Analyses One microgram of RNA, extracted with TRIzol (Invitrogen), was reverse transcribed with QuantiTect Reverse Transcription Kit (Qiagen) to obtain cDNA used for qualitative PCR and quantitative PCR analysis (25 ng per reaction). Primers were designed with the Primer 3 program and their sequences are listed in Table S2. RT-qPCR were performed in duplicate with the power SYBR Green PCR Master Mix (Applied Biosystems). The number of cycles of threshold (Ct) was measured with 7900 HT System (Applied Biosystems). The data were processed using SDS 2.3 software. All quantifications (ΔCt) were normalized with the Gapdh mRNA level, then the fold induction was calculated by the ΔΔCt method as described in the original paper [12]. RNA In Situ Hybridization Embryos of wild-type C57/Bl6 mice were collected starting from E9.5 to E12.5 and fixed in 4 % PFA, cryoprotected in 30 % sucrose, embedded in OCT and stored at −80 °C. Frozen sections (10 μm) were collected on Superfrost slides (Mentzel

Gläser). In situ hybridization of frozen sections was performed following the protocol previously described [13]. Briefly, sections were fixed in 4 % PFA, washed in PBS and treated with 1 μg/ml of Proteinase K (PK) in PBS for 10 min at room temperature. After pre-treatment with PK, sections were washed in PBS and subjected to acetylation step using 0.25 % Acetic Anhydride in 1 M Triethanolamine-HCl for 10 min. Thereafter, slides were hybridized over night (50 % Formamide; 5× SSC, pH 4.5; 50 μg/ml yeast tRNA; 1 % SDS; 50 μg/ml Heparin) using a probe concentration of 0.5–1 μg/ml at 68 °C. Digoxygenin labeled riboprobes were generated by in vitro transcription using DIG-labeling RNA kit (Roche). For the detection of hybridization, sections were incubated with anti-digoxigenin alkaline phosphatase-conjugated Fab fragments (Roche) at 1:4000 dilution. Staining was development according to probe-signal, with NBT/BCIP (Roche). Finally, slides were fixed in 4 % PFA −0.2 % gluteraldehyde and mounted in Dako Glycerol Mounting Medium (DakoCytomation). ESCs Culture and Differentiation The ESCs were cultured at 37 °C in a 5 % CO2 on 0,1 % gelatine in ES medium composed of Knockout DMEM high glucose (Gibco) supplemented with 15 % fetal bovine serum (Gibco), 0.1 mM 2(β)-Mercaptoethanol (Sigma), 1 mM nonessential amino acids (Gibco), 2 mM glutamine (Gibco), and 1,000 units/ml leukemia inhibitory factor (Millipore). For differentiation, 1 million of ESCs were plated in 35 mm dishes, as a feeder free monolayer. The differentiation medium consists of the in DMEM Low Glucose (Gibco) supplemented with 5 % fetal bovine serum, 0.1 mM 2(β)-Mercaptoethanol, 1 mM non-essential amino acids, 2 mM glutamine, depleted of LIF, overlayed with 200 μg/ml Matrigel (BD Biosciences) and treated with various factors sequentially. These factors included activin A (30 ng/ml, R&D Systems), all trans retinoid acid (RA, 10 μM, Sigma), fibroblast growth factor 10 (Fgf10, 10 ng/ml, R&D Systems), cyclopamine (CYC, 10 μM, Sigma), N-N-(3,5-difluorophenacetyl)-Lalanylsphenylglycinet-butylesterm (DAPT, 5 μM, Sigma). Medium was changed every 2 days. The experiments were conducted on Nepn ESCs clone EPD0686_5_C01 obtained from Komp Repository and E14Tg2a.4 [14]. Fluorescence Activated Cell Sorting (FACS) Cell suspension preparation and FACS were performed following published methods [15]. Cells were re-suspended in staining medium to a density of 107 cells/ml and loaded with 5-chloromethylfluorescein di-β-D-galactopyranoside (CMFDG) by adding 100 μl 2 mM pre-warmed CMFDG working solution. Cells were mixed rapidly and incubated in a 37 °C water bath for 2 min. Then the CMFDG loading was

Stem Cell Rev and Rep

stopped by adding 1.8 mL ice-cold staining buffer. The cells were kept on ice prior to FACS. The cells with fluorescence labeling (lacZ positive) were analysed and sorted using the BD FACSAria following the user’s guide. Southern Blot Genomic DNA was digested with AccI and SacII restriction enzymes, runned on a 0.8 % agarose gel, and transferred to a nylon membrane as described previously [16]. A 514-bp Neomicin probe was amplified on NeoR with primers NeoProbe-Fw (GACCGACCTGTCCGGTGCCCTGAATGAA CT) and Neo-Probe-Rev (TATGTCCTGATAGCGGTCCG CCACACCCAG). Hybridization with this probe revealed a 10 kb band from the targeted locus. The bands of interest signal was detected with CDP-Star (Roche), after incubation with anti-digoxigenin-AP-Fab (Roche).

Results Global Expression Profile of Mouse DPB at Stage E10.5 At developmental stage E10.5 the pancreas is formed by dorsal and ventral buds that, although receiving distinct environmental signals, form the same cohort of cell types and likely preserve intrinsic factors crucial for specification. To reduce biological variability due to differences of PPCs enrichments in dorsal and ventral buds our study was limited to the dorsal pancreatic bud (DPB). We identified the DPB in reference to the progression of PDX1 following through immunostaining, thus defining a thickness of the entire pancreatic structure of about 140 μm. In particular, we alternated PDX1 immunostaining with Laser Capture Microdissection (LCM) of DPB for every other embryo section (Fig. 1). To increase the amount of total RNA, and at the same time to reduce the biological variability, we pooled DPB LCM dissections of three embryos belonging to three different litters, then the RNA was processed through linear amplification to enable DNA chip microarray hybridization. The global expression profile comparison between DPB and embryo sections from which the DPB was dissected (SwDPB) revealed 46 transcripts enriched in DPB with a fold change higher than 1.6, and 221 genes enriched in SwDPB (Table S1). In particular, among 46 enriched transcripts, 17 were gene model predictions, 1 microRNA (Mir689-1), 2 were annotated as pseudogenes (LOC638361, and Prdxdd1), 1 corresponded to cDNA sequences (AY036118), 8 were associated to endoderm differentiation (Pyy, Gcg , Sct , Ghrl , Slc2a1 , Tff3 , Pcbd1 , and Nepn), 4 were associated to ectoderm development (Fat3 , Churc1 , Tmem50b , and Bex1 ) and 13 corresponded to housekeeping genes (Snora75, Rrs1, Gstp1, Rplp1 , Rnf160 , Hspd1 , ATP6 , Nob1 , Rbm39 , Gapdh ,

Mrpl27, Scarna13, and Arhgef5). It was not surprising that downregulated transcripts were encoded by a higher gene set because of the higher molecular and cellular complexities of the SwDPB compared to DPB. The maximum differences in expression levels corresponded to genes known to be specifically expressed during early-differentiated endocrine cells, in agreement with previous works [17–20]. To evaluate the DPB enrichment in terms of molecular functions and molecular networks, we performed an in-silico functional annotation using Ingenuity Pathway Analysis (IPA, Ingenuity Systems, www.ingenuity.com) respectively. DPB enriched genes resulted in a high number of interacting proteins, involved in the digestive system development, embryonic development, tissue morphology, and endocrine system development (Fig. S1A – Fig. S1B). Dorsal Pancreatic Bud Marker Analyses In order to evaluate the DNA microarray results, we validated the gene expressions of the most enriched transcripts through reverse transcriptase quantitative PCR (RT-qPCR) (Fig. 2a). We confirmed that the expressions of Bex1, Nepn, Pcbd1, Prdxdd1, Rnf160, Slc2a1, Tff3 were significantly higher in DPB than in SwDPB. In particular, the expressions of Nepn and Prdxdd1 were exclusive of the DPB as shown by RT-PCR results (Fig. 2b). Bex1 (brain expressed gene 1) belongs to a family of small proteins of unknown function, it is primarily expressed in nerve cells and in hematopoietic system [21]. Nepn (Nephrocan), a member of the small leucine-rich repeat protein family, and Pcbd1 (pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1) are expressed in the early epithelia structures [22–24]. Prdxdd1 (prolyl -tRNA synthetase associated domain -containing protein 1) is not yet characterized, neither for expression nor function. We identified two isoforms for Prdxdd1 that differed in the exon 2 (Fig. 2c). The Prdxdd1 isoform1 was specifically present only in DPB meanwhile the Prdxdd1isoform2 was amplified both in DPB, and SwDPB (Fig. 2c). Rnf160 encodes a protein that contains a RING finger domain that can function as an E3 ubiquitin ligase and it has a role in neurodegeneration [25]. Slc2a1 (solute carrier family 2 member 1) is expressed in a variety of tissues and it is mainly involved in energy homeostasis [26]. Tff3 (Trefoil Factor 3, cysteine-rich domain), is expressed in the gut in a tissue- and cell-specific manner, has been shown to be involved in the protection of the gastrointestinal tract against mucosal damage [27, 28], and stimulates pancreatic islet βcell replication [29]. It is notable that genes expected to be enriched such as Pdx1 and Sox9 were not present in our microarray analysis. The RT-PCR amplification of Pdx1 and Sox9 highlighted False negative markers in the reported DPB microarray dataset (Fig. S2A, Fig. S2B). In our experience [30] employing RNA linear amplification for DNA

Stem Cell Rev and Rep

Fig. 1 Microdissection of dorsal pancreatic bud af E10.5 a Pancreatic structure progression at E10.5. PDX1 (red) and E-Cadherin (green) immunostaining discriminate between VPB and DPB structures, and other gut evaginations such as GB. b Sequential histological DPB sections: I. PDX1 (red ) and E-Cadherin (green ) immunofluorescence

showed DPB structure in the first histological section. II. Histological section in which can be detected DPB (red dotted line). III. DPB region dissected (red dotted line) by LCM. Sagittal sections. DPB dorsal pancreatic bud, GB gall bladder, St stomach, VPB ventral pancreatic bud. Scale bars=50 μm

microarray hybridization could hamper the detection of genes expressed at low levels resulting in False Negative data.

detect any signal in the pancreatic structure, while a weak expression was detected in the stomach epithelium. Staining in the hepatic primordium and in the surrounding mesenchyme was not detected at any stage. Although Prdxdd1 isoform1 was a promising candidate, we were not able to design a suitable riboprobe to discriminate the isoform1 (pancreas specific) from the isoform2 . The RNA ISH signals of Pcbd1 , Rnf160 , Slc2a1 , and Tff3 were not detected.

In Vivo Spatial and Temporal Assessment of Novel Candidate Expressions In order to characterize the spatial and temporal patterns of our candidates during early pancreas organogenesis, we investigated their expressions through RNA in situ hybridization (ISH) using specific digoxigenin labelled riboprobes (Fig. 3). In particular, Bex1 expression was detected in the epithelium of DPB, foregut epithelium and hepatic primordium from E9.5 to E12.5; Nepn expression changed during embryonic development, it was detected in the epithelium of the DPB and foregut epithelium of embryos at E9.5 as well as at E10.5. Nepn expression was observed in the ventral pancreatic bud (VPB) and DPB of embryos at E11.5, the DPB staining was weaker than VPB staining. At E12.5, we did not

Evaluation of DPB Markers Expression During Pancreatic Progenitor Differentiation of ESCs In order to evaluate whether newly identified DPB candidates marked in vitro pancreas specification, we analysed the expression profiles of those genes through the main differentiation phases of ESCs. To achieve a high efficiency of pancreatic lineage specification, we followed a previously described

Stem Cell Rev and Rep Fig. 2 Validation of DPB novel gene signature a RT-qPCR analysis. Bex1, Nepn, Pcbd1, Prdxdd1, Rnf160, Slc2a1, Tff3 were significantly enriched in DPB at stage E10.5. b Nepn and Prdxdd1 Isoform1 were exclusive of the DPB, while the others gene candidates were specific but not exclusive. These results were obtained by qualitative RT-PCR. c The Prdxdd1 isoform1 has 3 exons meanwhile the isoforms2 is missing the exon2. We verified the expression specificity of isoform1 by RT-PCR and RTqPCR. DPB dorsal pancreatic bud, SwDPB section without dorsal pancreatic bud

step-wise ESCs differentiation protocol [31]: first, ESCs were differentiated to the definitive endoderm (DE) as confirmed by the reduced expression of pluripotency markers (Nanog and Oct4) and the simultaneous up-regulation of two key DE determinants such as Sox17 (Sry -related HMG box ) and Foxa2 (Forkhead homeobox A2); second, the DE was induced to the posterior foregut (PF) endoderm marked by the expression of Hnf6 (Hepatic nuclear factor 6); third, the PF was directed to PPCs marked by the expressions of Nkx6.1, Ptf1a and Sox9 (Fig. 4). At this point, we analysed the expressions of Bex1 , Nepn , Pcbd1 , Prdxdd1 , Rnf160 , Slc2a1, and Tff3 in function of the sequential differentiation of ESCs by RT-qPCR. The expressions of Bex1, Nepn , Pcbd1 , had a bell shape picking at the PF endoderm stage (D8) (Fig. 4b). Notably, the expression of Nepn was upregulated 100 fold compared to DE. The expressions of Prdxdd1, Rnf160 and Tff3 were slightly upregulated during differentiation of ESCs towards PF endoderm, and were strongly upregulated during the transition from PF endoderm to PPCs transition (D12) (Fig. 4b). The expression of Slc2a1 was not significantly enriched in any step-wise ESCs differentiation. Noticeably, these results suggested that our candidates could be specific of different cellular steady states of pancreatic organogenesis.

Nepn + Cells Molecular Characterization We focused our attention on Nepn, because of the intriguing expression that transiently marked early pancreas development stage both in vivo and in vitro. In order to acquire meaningful data from Nepn expression during step-wise ESCs differentiation it was necessary to collect a homogeneous sample of Nepn positive cells (Nepn + ). For this aim we used genetically modified ESCs in which the reporter gene lacZ substitutes the Nepn coding DNA sequence (CDS) in heterozygous, thus allowing us to follow endogenous expression of Nepn through the lacZ activity (Fig. 5a, left) [14]. The correct DNA recombination was confirmed by Southern blot hybridization (Fig. 5a, right). Since X-gal product is toxic for cells, we used CMFDG live staining (hereafter Nepn+) to follow lacZ activity [32], and then to sort viable Nepn + cells at D8 of ESCs Nepn+/lacZ differentiation (Fig. 5b). Fluorescence activated cell sorting (FACS) analysis indicated that in average 13 % of cell culture on day 8 (D8) were Nepn +, although the number varied slightly (7–16 %) between different culture differentiations (Fig. 5b). Cells were then FACSsorted into Nepn + cells and Nepn − cells, and subsequently analysed by RT-PCR, which confirmed a positive correlation between the CMFDG fluorescent staining and Nepn

Stem Cell Rev and Rep Fig. 3 RNA in situ hybridization during early pancreas organogenesis. RNA in situ hybridization (ISH) validation of DPB enriched genes at E10.5. The Bex1 RNA ISH: revealed a strong enrichment in the epithelium of DPB as well as in the foregut epithelium and hepatic primordium from E9.5 to E12.5. The Nepn RNA ISH showed a strong expression in the epithelium of the DPB and foregut epithelium of embryos at E9.5 as well as at E10.5, the signal was reduced in DPB at E11.5, no signal was detected in pancreatic structure at E12.5 except the stomach. Sagittal sections. DPB epithelium is outlined by dotted lines. Scale bar=50 μm

endogenous expression (Fig. 5c, d). To selectively define the pancreatic specification stage of Nepn + cells, we performed a RT-PCR qualitative analysis for multiple developmental steady state markers. Nepn + cells were negative for ectoderm (NeuroD) and mesoderm (Gata2) markers and positive for endoderm marker (Foxa2), posterior gut marker (Hnf6) and

early pancreatic epithelium markers (Rpbj , and Hes1 ) confirming their endodermic nature. Moreover, Nepn + cells expresses early PPC markers (Pdx1, Ptf1a, and Sox9), and were negative for early foregut endoderm such (Gata4, and Gata6), negative for early endocrine progenitors (Ngn3), and acinar cells (Rpbjl) [33, 34] (Fig. 5c and Fig. S4). Nepn + cells

Stem Cell Rev and Rep

Fig. 4 ESCs differentiation toward pancreatic lineage. a ESCs were cultured for 4 days treated with activin A (30 ng/ml), the definitive endoderm cells were cultured for another 4 days in the presence of both retinoid acid (RA) and FGF10. Following the posterior foregut endodermal stage, the cells were cultured in the presence of combined RA, cyclopamine (CYC), and N-N-(3,5-difluorophenacetyl)-L-

alanylsphenylglycinet-butylester (DAPT) to give rise to pancreatic progenitors. b RT-qPCR of pluripotency markers (Nanog and Oct4), definitive endoderm markers (Sox17 and Foxa2), posterior foregut tube marker (Hnf6), pancreatic progenitor cell markers (Nkx6.1, Ptf1a and Sox9), and DPB enriched genes (Bex1 , Nepn , Pcbd1, Prdxdd1 Isoform1 , Rnf160 and Tff3). D days. Values are shown mean ± SD

were specifically positive for the expressions of Bex1, Pcbd1, Prdxdd1, Slc2a1, were exclusive for Pdx1, Rbpj, Gm10785, Hspd1 , and Rnf160. The co-expression of multiple PPCs markers suggested that Nepn + derived cells resembled PPClike specification occurring between embryonic developmental stages between E9.5 and E12.5.

through ESCs programming. In particular, we characterized the global expression profile of DPB at stage E10.5 following an accurate laser microdissection, confirming that the pancreatic primordium at E10.5 is characterized by the presence of endocrine markers (such as: glucagon , peptide YY, and ghrelin ). Beyond to confirm previous works [35], our microarray data analysis allowed the identification of a novel cohort of genes specific (Bex1, Pcbd1, Rnf160, Slc2a1, and Tff3), and exclusive (Nepn, and Prdxdd1) to DPB at E10.5. Several candidates were previously associated to pancreas related biology: Bex1 is known to be involved in triggering regeneration [21]; Pcbd1 nicely correlates with ESC derived Pdx1/ Sox17 positive cells although was not known the function

Discussion In our study we aim to elucidate the intrinsic factors specific of pancreas development at the embryonic stage E10.5 and to implement the investigation of pancreatic cell generation

Stem Cell Rev and Rep

Fig. 5 Molecular characterization of Nepn positive cells. a Nepn +/lacZ cell line. Nepn +/lacZ modified ESCs shows the reporter gene lacZ that substitutes the Nepn coding DNA sequence in heterozygous, thus allowing to follow endogenous expression of Nepn through the lacZ expression. Confirmation of the correct DNA recombination by Southern Blot using restriction enzymes SacII and AccI. b In LacZ-positive cells (Nepn + cells) derived from differentiated ESCs at day 8, the CMFDG was converted to a bright green fluorescent product and sorted through a GFP

channel. The background auto-fluorescence compensation was set with unstained cells. c Characterization of Nepn + cells by RT-PCR. Nepn + cells were negative for ectoderm (NeuroD) and mesoderm (Gata2), early foregut endoderm (Gata4, Gata 6), early endocrine progenitors (Ngn3), and acinar cells (Rpbjl) markers. Nepn + cells were positive for endoderm (Foxa2), posterior gut (Hnf6), early pancreatic epithelium (Rpbj, Hes1), early PPC (Pdx1, Sox9) markers

[24]; Slc2a1 is a key element of the glucose-sensing apparatus facilitating glucose transporter [36]; Nepn is primarily restricted to the base of the developing epithelial glands [23]; Tff3 stimulates pancreatic islet β-cell replication [29]. Although the expression levels of those genes were low, we were able to nicely detect Bex1, and Nepn expressions starting from developmental stages E9.5 through E12.5. Intriguingly, Nepn was transiently expressed between E9.5 and E11.5 also known as pancreas primary transition, critical for endocrine progenitor competence, resulting a bona fide marker of pancreas organogenesis with no expression in the hepatic primordium and in the surrounding mesenchyme. The conjugation of microarray data together with pancreatic step-wise differentiating ESCs sheds light on the cellular transition occurring during differentiation. In particular, Bex1, Nepn and Pcbd1 were significantly enriched at D8 corresponding to posterior foregut endoderm, and Prdxdd1, Rnf160 and Tff3 expressions

were strongly enriched at D12 that corresponds to pancreatic progenitor specification. The gene Slc2a1 was constantly expressed in all the stages and did not show any significant enrichment. A more meaningful data came from a qualitative and quantitative molecular analysis of FACS-sorted Nepn + cells upon ESCs differentiation. Nepn + cells expressed simultaneously key multipotent PPCs genes (such as: Pdx1, Ptf1a, Rpbj, Hes1, and Sox9) and do not express the “secondary transition” progenitor endocrine cell identity markers (such as: Ngn3 and Nkx6.1). We speculated that Nepn + cells represent a naïve pancreatic metastate of the first transition of pancreas development, thus to refine the map of the ontogenetic transitional states of ESC pancreatic differentiation. Noticeably, Nepn was also transiently detected during early ESCs plate adhesion, and it was required for ESC colony formation (Fig. S3B, and Fig. S3C). Further experiments should be performed to understand whether there are

Stem Cell Rev and Rep

commonalities between the role of Nepn during ESC plate adhesion and DPB formation. In conclusion, our data improve the comprehension of the molecular network underlining the pancreatic specification both in vivo and in vitro, and we speculate that they will improve the programming or reprogramming of both ESCs and induced Pluripotent Stem cells [37]. Our future experiments will be aimed to test new hypotheses to define mechanisms of specification, and lineage allocation of Nepn + cells. Acknowledgments We would like to thank members of Dr. Falco Geppino laboratory for discussion; Prof. Di Lauro R. for his suggestions; A. Fierro, M. Marotta, for technical assistance, for discussion and useful advices. A particular thanks goes to Dr. Alison Cole and Dr. Rachele De Felice for their useful writing advices. Conflict of interest The authors attest to not have undisclosed financial or other relationships that could be construed as a conflict of interest.

References 1. Carter, M. G., Stagg, C. A., Falco, G., et al. (2008). An in situ hybridization-based screen for heterogeneously expressed genes in mouse ES cells. Gene Expression Patterns, 8(3), 181–198. 2. Zhu, Z., & Huangfu, D. (2013). Human pluripotent stem cells: an emerging model in developmental biology. Development, 140(4), 705–717. 3. Bhushan, A., Itoh, N., Kato, S., et al. (2001). Fgf10 is essential for maintaining the proliferative capacity of epithelial progenitor cells during early pancreatic organogenesis. Development, 128, 5109–5117. 4. Hebrok, M., Kim, S. K., St Jacques, B., McMahon, A. P., & Melton, D. A. (2000). Regulation of pancreas development by hedgehog signaling. Development, 127, 4905–4913. 5. Martin, M., Gallego-Llamas, J., Ribes, V., et al. (2005). Dorsal pancreas agenesis in retinoic acid-deficient Raldh2 mutant mice. Developmental Biology, 284, 399–411. 6. Molotkov, A., Molotkova, N., & Duester, G. (2005). Retinoic acid generated by Raldh2 in mesoderm is required for mouse dorsal endodermal pancreas development. Developmental Dynamics, 232, 950–957. 7. Yang, Y. P., & Wright, C. (2009). Chemicals turn human embryonic stem cells towards beta cells. Nature Chemical Biology, 5, 195–196. 8. D’Amour, K. A., Bang, A. G., Eliazer, S., et al. (2006). Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nature Biotechnology, 24, 1392–1401. 9. Kroon, E., Martinson, L. A., Kadoya, K., et al. (2008). Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nature Biotechnology, 26, 443–452. 10. Gu, G., Dubauskaite, J., & Melton, D. A. (2002). Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development, 129, 2447–2457. 11. Irizarry, R. A., Hobbs, B., Collin, F., et al. (2003). Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics, 4(2), 249–264. 12. Livak, K. J., & Schmittge, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt. Methods, 25, 402–408. 13. Little, M. H., Brennan, J., Georgas, K., et al. (2007). A highresolution anatomical ontologyof the developing murine genitourinary tract. Gene Expression Patterns, 7, 680–699.

14. Stryke, D., Kawamoto, M., Huang, C. C., et al. (2003). BayGenomics: a resource of insertional mutations in mouse embryonic stem cells. Nucleic Acids Research, 31(1), 278–281. 15. Poot, M., & Arttamangkul, S. (1997). Verapamil inhibition of enzymatic product efflux leads to improved detection of betagalactosidase activity in lacZ transfected cells. Cytometry, 28, 36–41. 16. Yamanaka, S., Zhang, X. Y., Maeda, M., et al. (2000). Essential role of NAT1/p97/DAP5 in embryonic differentiation and the retinoic acid pathway. EMBO Journal, 19, 5533–5541. 17. Pictet, R. L., Clark, W. R., Williams, R. H., & Rutter, W. J. (1972). An ultrastructural analysis of the developing embryonic pancreas. Developmental Biology, 29, 436–467. 18. Herrera, P. L. (2000). Adult insulin- and glucagon-producing cells differentiate from two independent cell lineages. Development, 127, 2317–2322. 19. Kesavan, G., Sand, F. W., Greiner, T. U., et al. (2009). Cdc42 mediated tubulogenesis controls cell specification. Cell, 139, 791–801. 20. Villasenor, A., Chong, D. C., Henkemeyer, M., & Cleaver, O. (2010). Epithelial dynamics of pancreatic branching morphogenesis. Development, 137, 4295–4305. 21. Alvarez, E., Zhou, W., Witta, S. E., & Freed, C. R. (2005). Characterization of the Bex gene family in humans, mice, and rats. Gene, 357(1), 18–28. 22. Mochida, Y., Parisuthiman, D., Kaku, M., et al. (2006). Nephrocan, a novel member of the small leucine-rich repeat protein family, is an inhibitor of transforming growth factor-beta signaling. Journal of Biological Chemistry, 281(47), 36044–36051. 23. Li, X., Udager, A. M., Hu, C., Qiao, X. T., Richards, N., & Gumucio, D. L. (2009). Dynamic patterning at the pylorus: formation of an epithelial intestine-stomach boundary in late fetal life. Developmental Dynamics, 238(12), 3205–3217. 24. Ogaki, S., Harada, S., Shiraki, N., Kume, K., & Kume, S. (2011). An expression profile analysis of ES cell-derived definitive endodermal cells and Pdx1-expressing cells. BMC Developmental Biology, 11, 13. 25. Ivanov, I., Lo, K. C., Hawthorn, L., Cowell, J. K., & Ionov, Y. (2007). Identifying candidate colon cancer tumor suppressor genes using inhibition of nonsense-mediated mRNA decay in colon cancer cells. Oncogene, 26, 2873–2884. 26. Suazo, J., Pardo, R., Castillo, S., et al. (2013). Family-based association study between SLC2A1, HK1, and LEPR polymorphisms with myelomeningocele in Chile. Reproductive Sciences. doi:10.1177/ 1933719113477489. 27. Taupin, D., & Podolsky, D. K. (2003). Trefoil factors: initiators of mucosal healing. Nature Reviews Molecular Cell Biology, 4, 721–732. 28. Hernández, C., Santamatilde, E., McCreath, K. J., et al. (2009). Induction of trefoil factor (TFF)1, TFF2 and TFF3 by hypoxia is mediated by hypoxia inducible factor-1: implications for gastric mucosal healing. British Journal of Pharmacology, 156, 262–272. 29. Fueger, P. T., Schisler, J. C., et al. (2008). Trefoil factor 3 stimulates human and rodent pancreatic islet β-cell replication with retention of function. Molecular Endocrinology, 22(5), 1251–1259. 30. Fagman, H., Amendola, E., Parrillo, L., et al. (2011). Gene expression profiling at early organogenesis reveals both common and diverse mechanisms in foregut patterning. Developmental Biology, 359(2), 163–175. 31. Sui, J., Mehta, M., Shi, B., Morahan, G., & Jiang, F.-X. (2012). Directed differentiation of embryonic stem cells allows exploration of novel transcription factor genes for pancreas development. Stem Cell Reviews, 8, 803–812. 32. Hu, J., Xie, C., Ma, H., Yang, B., Ma, P. X., & Chen, Y. E. (2012). Construction of vascular tissues with macro-porous nano-fibrous scaffolds and smooth muscle cells enriched from differentiated embryonic stem cells. PLoS One, 7(4), e35580. 33. Decker, K., Goldman, D. C., Grasch, C. L., & Sussel, L. (2006). Gata6 is an important regulator of mouse pancreas development. Developmental Biology, 298, 415–429.

Stem Cell Rev and Rep 34. Watt, A. J., Zhao, R., Li, J., & Duncan, S. A. (2007). Development of the mammalian liver and ventral pancreas is dependent on GATA4. BMC Developmental Biology, 7, 37. 35. Bonal, C., & Herrera, L. P. (2008). Genes controlling pancreas ontogeny. International Journal of Developmental Biology, 52, 823–835.

36. Richardson, C. C., Hussain, K., Jones, P. M., et al. (2007). Low levels of glucose transporters and K+ ATP channels in human pancreatic beta cells early in development. Diabetologia, 50(5), 1000–1005. 37. Higuchi, Y., Shiraki, N., & Kume, S. (2011). In vitro models of pancreatic differentiation using embryonic stem or induced pluripotent stem cells. Congenit Anom (Kyoto), 51(1), 21–25.