Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YMCPR1070_proof ■ 20 March 2014 ■ 1/7

Molecular and Cellular Probes xxx (2014) 1e7

Contents lists available at ScienceDirect

Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr

Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ Q3

Carolee T. Bull a, *, Polly H. Goldman a, Kendall J. Martin b a b

USDA/ARS, 1636 E. Alisal St., Salinas, CA 93905, USA Department of Biology, William Paterson University, Wayne, NJ 07470, USA

a r t i c l e i n f o

a b s t r a c t

Article history: Received 31 January 2014 Accepted 9 March 2014 Available online xxx

The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were developed from 16S rDNA sequences to be useful for the specific detection and quantification of S. suberifaciens. Quantitative PCR (qPCR) protocols specifically amplified DNA from the type strain of S. suberifaciens (LMG 17323) and other members of this species but not from other members of the Sphingomonadaceae. The detection limit was as little as 100 fg DNA (equivalent to 2 102 cells) in the qPCR. Detection was successful from soils inoculated with as little as 1 103 CFU/g soil. DNA isolated from naturally infested soils and diseased lettuce roots was amplified and sequenced fragments were identical or nearly identical to 16S rDNA sequences from S. suberifaciens. In growth chamber experiments, there was a positive correlation between disease severity and S. suberifaciens population levels in roots and soil, as detected by qPCR. Detection levels were below population levels of the pathogen necessary for disease development. Ó 2014 Published by Elsevier Ltd.

Keywords: Sphingomonas Rhizomonas Quantitative PCR Real time PCR

1. Introduction Corky root of lettuce (Lactuca sativa L) caused by Sphingobium suberifaciens (formerly Rhizomonas suberifaciens and Sphingomonas suberifaciens) is an economically important disease in lettuce growing areas worldwide [1e5]. Infected plant roots develop yellow to brown lesions, which can become longitudinal corky ridges that inhibit the flow of nutrients and water to the plant. In severely infested fields, yield losses can reach 30e70% due to the reduction in head size [6]. Crop rotation, irrigation and drainage management, rotation with cover crops, use of transplants, and limiting nitrogen applied can be used to reduce corky root severity [5,7e10]. However, growers rely primarily on genetic resistance to manage corky root for commercial production. Resistance is conferred by a recessive allele or tightly linked allele(s) at a single locus (cor) [11,12]. In other systems resistance based on single genes is easily overcome by shifts in the pathogen population [13]. Therefore, the structure and dynamics of naturally occurring pathogen populations must be

* Corresponding author. Tel.: þ1 831 755 2889; fax: þ1 831 755 2814. E-mail address: [email protected] (C.T. Bull).

understood in order to maintain the effectiveness of resistance based on single genes. The etiology of corky root long remained controversial with both fungi and bacteria implicated in the disease [14e17]. Finally, van Bruggen et al. [4,18] demonstrated definitively that corky root of lettuce was caused a gram-negative bacterium, Rhizomonas suberifaciens. The genus Rhizomonas is illegitimate and the pathogen was transferred to Sphingomonas suberifaciens within the family Sphingomonadaceae and the Alphaproteobacteria [19]. More recently, the pathogen was transferred by Chen et al. [20], from the genus Sphingomonas to Sphingobium as Sphingobium suberifaciens with Sphingobium boeckii its closest relative. Early on, it was recognized that members of several related species caused the disease [2,3,21,22], though no ecological or epidemiological distinctions were attributed to different species causing corky root. Recently, these were formally proposed as novel species and a new genus Rhizorhapis was proposed to be split from the genus Sphingbium for Sphingobium suberifaciens and other strains causing corky root of lettuce [23]. In the current paper we use the classification by Chen et al. [20] and the corresponding Sphingobium suberifaciens nomenclature. The corky root pathogen is difficult to culture from environmental samples, thus culture-based methods are inadequate for detection, quantification, and epidemiological studies of the

http://dx.doi.org/10.1016/j.mcp.2014.03.001 0890-8508/Ó 2014 Published by Elsevier Ltd.

Please cite this article in press as: Bull CT, et al., Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.03.001

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65


2

C.T. Bull et al. / Molecular and Cellular Probes xxx (2014) 1e7

pathogens and antibodies used in previous studies are not available [24]. Thus, PCR based protocols were designed to specifically detect and quantify Sphingobium suberifaciens strains. We followed the same strategy we used in developing conventional PCR and qPCR protocols for the detection and quantification of Myxococcus xanthus from environmental samples [25]. This is the first step in unraveling the ecology and epidemiology of this pathogen and moving towards a more complete understanding of the roles of various species in disease development. 2. Materials and methods 2.1. Media, bacterial isolates, and culture conditions Strains used in this study and accession numbers for previously published 16S rDNA sequences are listed in Table 1. Strains were obtained from the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen, Zellkulturen GmbH (DSMZ), Laboratorium voor Microbiologie University of Gent (LMG), National Collection of Plant Pathogenic Bacteria (NCPPB), and UC-Davis. DNA from S. boeckii was gratefully received from J. Overmann. Sphingobium suberifaciens and related organism were routinely grown on R2A agar, S-Agar or S-Broth [26,27]. The bacteria were stored at 80 C in a solution of 50% glycerol and 50% Smedium broth. 2.2. DNA extraction and 16S rDNA sequencing For 16S rDNA sequencing, genomic DNA was isolated from single colonies of 4e8 day-old S-Agar cultures using the NucleoSpinÒ Tissue Kit (MachereyeNagel, USA). A PTC-200 DNA Engine thermal cycler (MJ Research, Waltham, MA) with a heated lid in the ‘calculated’ mode was used for all standard polymerase chain reactions (PCR). Universal primers 27F and 1492R [28] and published reaction conditions [29] were used to amplify 16S rDNA sequences. After visually checking for amplification by gel electrophoresis, amplicons were sequenced directly in both the forward and reverse direction by outside vendors (McLab, South San Francisco, CA; TACGen, Richmond, CA). In cases in which there were discrepancies between our sequencing results and published sequences, DNA was isolated again and resequenced to verify sequence results. 2.3. PCR and qPCR protocol development CLC Main Workbench 6 (Cambridge, MA) was used to align sequences from forward and reverse strands, generate consensus sequences, and align sequences. A multiple sequence alignment of 16S rDNA sequences was developed from S. suberifaciens LMG 17323T (CA1), 32 additional pathogenic strains of S. suberifaciens, the type strains of species of Sphingobium, and additional strains reported to cause corky root on lettuce. The multiple sequence alignment was analyzed using the Jukes Cantor substitution model for neighbor joining phylogeny and a tree was developed based on this analysis. Sequences unique to the S. suberifaciens strains were selected from several different variable regions and primers were tested empirically (Fig. 1). Primers were designed to exclude other Sphingobium species including unnamed species of Sphingobium that contain other corky root pathogens. Two of the primers, Ss731F (50 e GCGGCTCACTGGACCAGA e 30 ) and Ss860R (50 e TGCGCCACCTAAGTTCTAAGAA e 30 ) (named for the corresponding positions of their 50 ends on the E. coli 16S gene), were selected for further study. Ss731F and Ss860R primers were synthesized by Eurofins MWG Operon, Inc. (Huntsville, AL) and IDT (Chicago, IL) and incorporated at 0.4 mM into a PCR reaction mix that also

Table 1 16S rDNA sequence accession numbers for strains causing corky root of lettuce. Organism Sphingobium S. suberifaciens CA1c

Sequivara

Strain numbers

16S rDNA accession numbersb

ATCC 49355T KJ372021 KJ372022 LMG 17323T T KJ372023 BS0349 KJ372024 S. suberifaciens 1 LMG 12532 (CA3) KJ372025 CA4 KJ372026 LMG 12533 (CA5) KJ372027 CA6 KJ372028 CA7 KJ372029 CA8 KJ372030 CA9 KJ372014 CA10 KJ372015 CA11 KJ372016 CA13 KJ372017 LMG 12534 (CA14) KJ372019 CA18 KJ372020 LMG 12548 (CA19) S. suberifaciens 2 CA17 KJ372026 KJ372037 S. suberifaciens 3 LMG 9832 (FL3) KJ372036 LMG 11023 (FL2) KJ372038 LMG 11025 (FL4) KJ372034 LMG 11117 (FL1) KJ372031 LMG 12535 (FL12) KJ372032 LMG 12536 (FL14) KJ372033 LMG 12537 (FL16) KJ372035 LMG 12538 (FL20) KJ372009 LMG 12540 (AU17) KJ372012 LMG 12541 (AU24) KJ372013 LMG 12543 (AU44) LMG 12545 (AU107) KJ372010 KJ372003 S. suberifaciens 4 LMG 9833 (NY10) KJ372004 LMG 9834 (NY11) KJ372005 LMG 9837 (WI3) KJ372008 LMG 12539 (AU2) S. suberifaciens 5 LMG 11024 (NY12) KJ372006 S. suberifaciens 6 LMG 12546 (AU116) KJ372011 Additional corky root pathogens from the Sphingomonadacae 7 LMG 12551 (CA33) KJ371992 8 LMG 11032 (WI4) KJ371989 9 LMG 12558 (NL1) KJ371998 10 LMG 12556 (NY7) KJ371997 11 LMG 12562 (GR1) KJ372000 LMG 12563 (GR3) KJ372001 12 LMG 11031 (PF513) KJ371988 LMG 12555 (FL24) KJ371996 13 LMG 12554 (FL22) KJ371995 14 LMG 12553 (FL21) KJ371994 LMG 12560 (NL9) KJ371999 15 LMG 12549 (CA20) KJ371990 16 LMG 12552 (FL18) KJ371993 17 LMG 11030 (TT2) KJ372007 ATCC 51290 (CA15) KJ371987 18 LMG 12550 (CA26) KJ371991 LMG 12564 (GR4) KJ372002 1

a Among the strains causing corky root on lettuce that were evaluated here, there are at least 18 different 16S rDNA sequences. For many of the clades multiple corky root strains have identical sequences and belong to the same sequivar. b Accessions XeX are being reported for the first time in this manuscript and all other accession given in Figs. 1 and 2 are available through GenBank. c Three different clones of the type strain of CA1 from LMG, ATCC, and UC-Davis culture collections were sequenced. All sequences were identical and different than CA1 accession D13737 which is not included in our analyses.

included 10 mM TriseHCl (pH 8.3), 1.0 mM MgCl2, 500 mM dNTPs, 0.5 U GoTaq Flexi DNA Polymerase (Promega, Madison, WI), and 1 ml of a 10 ng/ml DNA template (or whole bacterial cells) in a 20 ml reaction volume. A touchdown thermocycler protocol was developed for DNA amplification: following an initial denaturation step of 3 min at 94 C, the cycle consisted of 30 s denaturation (94 C) and 30 s annealing for which the annealing temperature started at


66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65



3

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 Fig. 1. Polymorphisms between Sphingobium suberifaciens and closely related species in the 16S rDNA gene. This multiple alignment shows published sequences from Sphingobium 92 species and close relatives and mismatches with the primers used in the specific amplification of Sphingobium suberifaciens. The reverse primer is the complementary sequence of 93 that displayed, with the 30 end consequently to the left. A dot (C) or dash () indicate, respectively, sequence homology with or a deletion relative to S. suberifaciens LMG 17323T, and other letters indicate mismatches with that strain. Boxed areas indicate sequences expected to bind to the F and R primers. Sequences were retrieved from EMBL by FastA search 94 Q4 and aligned using Main Workbench (CLC Bio, Cambridge, MA). 95 96 97 products. DNA was isolated from lettuce roots using Nucleospin 68 C and dropped by 2 C every two cycles until it reached 62 C, at 98 Plant II kits (MachereyeNagel, Bethlehem, PA) after lyophilizing which temperature 12 additional cycles were carried out. A final 99 plant tissue. PowerSoil DNA Isolation kits (MO BIO Laboratories, 5 min 72 C extension step was performed at the end of the reac100 Inc., Carlsbad, CA) were used to isolate DNA from soil associated tion. PCR products were visualized on a 3% agarose gel as a 130-bp 101 with lettuce roots. DNA was further purified using Agencourt band. 102 AMPure XP magnetic beads (BeckmaneCoulter, Indianapolis, IN). The same primers were used to develop a quantitative PCR 103 Bead-cleaned root and soil DNA samples were amplified by qPCR, (qPCR) protocol. For qPCR, iQ SYBR Green 2X Supermix (Bio-Rad 104 and a subset of the samples was then amplified by conventional Laboratories, Hercules, CA), 4 mM of each primer, and 3 ml of tem105 PCR for cloning. PCR fragments were then cloned using the Zeroplate DNA were combined in a 15 ml reaction volume and assayed 106 Blunt TOPO PCR Cloning Kit (Invitrogen/Life Technologies, NY) and using a CFX96 Real-Time PCR Detection System (Bio-Rad Labora107 clones were sequenced using the M13 primer set. Thirty-two clones tories). Amplification was done using a simplified touchdown 108 derived from soil associated with the corked roots of lettuce culprotocol consisting of an initial 1.5 min 95 denaturation step fol109 tivars Salinas (13 clones) and Darkland (nine clones) and with the lowed by 8 cycles of 95 for 30 s and 66 for 30 s, after which the 110 un-corked roots of lettuce cultivar Glacier (ten clones), plus fourannealing temperature was decreased to 62 for 24 additional cy111 teen clones derived from lettuce roots of the cultivars Salinas 88 (3 cles. A melt curve, beginning at 55 C and increasing by 0.5 C every 112 clones), Green Forest (3 clones), and Glacier (8 clones) were 5-s cycle, was conducted at the end for fragment size analysis. 113 sequenced. Sequences from cloned Ss731F/860R amplicons from 114 soil and lettuce roots were aligned with the region from base po115 2.4. Specificity of PCR protocols sition 731 to 860 of the 16S rDNA gene from each of the Sphin116 gobium spp. type strains. Tree constructed using CLC Main 117 Specificity of the PCR protocols was tested empirically using Workbench with Sphingomonas paucimobilis used as a root. 118 purified DNA from S. suberifaciens LMG 17323T, 32 additional 119 pathogenic strains of S. suberifaciens, the type strains of Sphin120 2.5. Sensitivity and relevance of limits of detection gobium species, and additional strains reported to cause corky root 121 on lettuce (Table 1; Fig. 2). Purified DNA (20 ng) was used as a 122 The sensitivity and efficiency of detection of S. suberifaciens in template in the reactions described above. For conventional PCR, 123 soil were determined by artificially inoculating twice-autoclaved products were visualized on a 3% agarose gel as a 130-bp band. For 124 soil (fine-loamy, mixed, thermic Typic Argixeroll) with a dilution qPCR, the final melt curve was used for fragment size estimation, 125 series of S. suberifaciens LMG 17323T at final concentrations of 109, the results of which were confirmed in multiple experiments by 126 documenting the presence of a 130-bp band on a 3% agarose gel. 107, 105, 104, 103 and 102 CFU/g soil. Concentrations were deter127 Specificity of these protocols with environmental samples was mined via spectroscopy followed by serial dilution, with an 128 evaluated by amplifying PCR products directly from the roots and OD600nm of 0.600 treated as a concentration of 109 cfu/ml; this 129 surrounding soil of eight cultivars of mature lettuce grown in a relationship was confirmed by dilution plating. Following inocu130 naturally infested field, followed by cloning and sequencing of PCR lation, soils were incubated for 1 h at room temperature and then Please cite this article in press as: Bull CT, et al., Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.03.001

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65


4


Fig. 2. Relationships between corky root pathogens and other Sphingobium species. Phylogenetic tree constructed using Neighbor Joining Algorithm and Jukes-Cantor substitution model. Single representative strains for common sequences are included, with the number of strains with identical sequences in parentheses. Bold font indicates strain groups amplified with Ss731F/Ss860R primer set. Sequences of three sibling cultures of Sphingobium suberifaciens CA1 from various culture collections were found to be identical and are designated here as Sphingobium suberifaciens CA1 (3) to indicate the number of strains represented by the sequence. Numbers indicate genetic distance.

lyophylized. DNA extracted from these lyophylized samples was then quantified by qPCR. For each treatment there were four replications and the experiment was conducted three times. Data were analyzed according to a completely randomized design using JMP 10.0 (SAS Institute, Inc., Cary, North Carolina). To determine the relationship between inoculum concentration in roots and disease development, the susceptible cultivar Salinas was planted in twice-autoclaved vermiculite, fertilized with autoclaved Peter’s Solution (20-20-20), and grown in a growth chamber with a 14:10 L:D cycle. Two weeks after planting, the seedlings were inoculated with 5 ml/plant of S. suberifaciens LMG 17323T at 1010, 107, or 104 CFU/ml (equivalent to CFU/g soil) and incubated at 28 C:20 C day:night temperatures in a growth chamber. Three weeks after inoculation the plant roots were rated visually, using the Brown and Michelmore [11] rating scale. For each replicate, the

plants that had individual ratings that most closely matched the average rating of the rep were selected for root DNA isolation. Root DNA samples were then assessed by PCR and qPCR as described above. The experiment was conducted twice with each experiment consisting of 9 seedlings per replicate and 5 replicates per treatment. The experiment was analyzed according to a completely randomized design. 3. Results 3.1. Specificity of conventional and quantitative PCR in vitro Two primers, Ss731F and Ss860R, designed for their selectivity for S. suberifaciens (Fig. 1), were tested in silico on an additional group of 16S rDNA sequences from 21 strains of S. suberifaciens and


66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65



other Sphingobium species. According to in silico analyses, these primers were predicted to bind to all 33 of the S. suberifaciens strains but none of the corky root or type strains from other species (Fig. 1). PCR amplifications from isolated DNA produced single, strong bands in all S. suberifaciens strains but not in other Sphingobium species, other genera from the Sphingomonadaceae and other microorganisms tested (Fig. 3). The detection limit for purified DNA from S. suberifaciens LMG 17323T in this PCR reaction was 5 pg/ml, equivalent to approximately 1.1 104 cells. The sensitivity of the conventional PCR was not further optimized. We used the results from the conventional PCR to develop a qPCR protocol which was also specific to S. suberifaciens strains. The qPCR did not amplify DNA isolated from other Sphingobium species (Sphingobium rhizovicinum DSMZ 19845T, S. vermicomposti DSMZ 21299T, S. yanoikuyae DSMZ 7462T, S. ummariense DSMZ 22942T, S. qiguonii DSMZ 21541T, S. aromaticiconvetens DSMZ 12677T, and S. boeckii DSMZ 25079T), plant pathogens or colonists from related genera (Sphingomonas melonis NCPPB 4320T, Agrobacterium tumefaciens ATCC 33970), lettuce roots (cvs. ‘Salinas’ and ‘Green Lake’), any of the organisms used as negative controls (lettuce pathogens Xanthomonas campestris pv. vitians BS339, Pseudomonas cichorii NCPPB 943PT, and Pseudomonas marginalis pv. marginalis LMG 2210PT); or two additional organisms that are found in agricultural production fields (Pseudomonas cannabina pv. alisalensis NCPPB 4438PT and Myxococus xanthus DK1622). Using this protocol, the limit of detection of purified DNA from S. suberifaciens LMG 17323T in qPCR was 100 fg/ml. This corresponds to approximately 17e 30 cells/reaction.

Fig. 3. Amplification of 16S rDNA sequences from Sphingobium suberifaciens but not related species. Row I Lanes 1-16: Sphingobium suberifaciens strains LMG 17323T (CA1), CA3, LMG 12547, LMG 9832, LMG 9833, LMG 11024, LMG 12546; Sphingobium sp. strains LMG 12556, LMG 12558, LMG 11032, LMG 12551, LMG 12550, LMG 11030, LMG 12552, LMG 12549, negative control; Row II Lanes 1-15: Sphingobium suberifaciens strain LMG 17323T; Sphingobium sp. strains LMG 12553, LMG 12554, LMG 11031, LMG 12562; Sphingomonas melonis NCPPB 4320T, Sphingobium rhizovicinum DSMZ 19845T, S. vermicomposti DSMZ 21299T, S. yanoikuyae DSMZ 7462T, S. ummariense DSMZ 22942, S. qiguonii DSMZ 21541T, S. aromaticiconvertens DSMZ 12677T, and S. boeckii DSMZ 25079T; Agrobacterium tumefaciens ATCC 33970, negative control. Row III Lanes 1-8: S. suberifaciens strain LMG 17323T, Pseudomonas cannabina pv. alisalensis NCPPB 4438PT, Xanthomonas campestris pv. vitians BS339, Myxococcus xanthus DK1622, Pseudomonas marginalis pv. marginalis LMG 2210PT, P. cichorii LMG 2162T, Lactuca sativa cv ‘Salinas’, negative control. “T” and “PT” indicate type or pathotype strains. Lanes on far left and right of each row are DNA size standards (New England BioLabs, Ipswich, MA), with the size of each band indicated.

5

66 67 68 Pathogen populations as measured by qPCR were between 69 1 105 to 8 105 CFU/g in the field soil from which root and soil 70 samples were taken. Of the thirty-two clones derived from soil 71 associated with the corked roots of lettuce twenty-two of these 72 130-bp sequences were identical to S. suberifaciens LMG 17323T and 73 the ten remaining sequences differed by one (nine clones) or two 74 (one clone) bases. Phylogenetic analysis placed all clone sequences 75 in S. suberifaciens (Supplemental Fig. 1). All fourteen clones suc76 cessfully sequenced from DNA isolated from asymptomatic and 77 symptomatic roots of lettuce from cultivars Glacier (resistant), 78 Salinas (susceptible), and Green Forest (susceptible) were identical 79 to the sequence of S. suberifaciens LMG 17323T. 80 81 3.3. Determination of relevance of limits of detection 82 83 In experiments conducted in growth chambers there was a 84 linear relationship (R2 ¼ 0.98, P < 0.0001; experiment repeated 85 three times) between bacterial inoculum levels (as determined by 86 absorbance and confirmed by dilution plating) and qPCR quantifi87 cation, with consistent detection at inoculum levels at and above 88 104 CFU/g soil but in some experiments as low as 103 CFU/g soil. 89 Likewise a positive correlation was found between disease severity 90 and concentration of S. suberifaciens LMG 17323T DNA in both the 91 root samples (R2 ¼ 0.545, P ¼ 0.0002) and the soil samples 92 (R2 ¼ 0.67, P ¼ 0.0021). Disease development was significantly 93 greater in the two highest inoculum concentrations, 107 and 94 1010 CFU/ml than in the pathogen free control (ANOVA, Dunnett95 Hsu multiple comparison test, P < 0.05), and not significantly 96 different from that in the control for the 104 CFU/ml (approximately 97 104 CFU/g) treatment. 98 99 4. Discussion and conclusions 100 101 Members of the Sphingomonadaceae that cause corky root on 102 lettuce are genetically diverse and may represent multiple species 103 [2,3,21e23]. In addition to being the most extensively studied 104 species of corky root pathogens, the taxonomy of Sphingobium 105 suberifaciens has been clarified [19,20,23] and most pathogenic 106 strains from the US belong to this species [2]. Unfortunately, 107 S. suberifaciens and the other pathogens are difficult to isolate from 108 environmental samples, thus impeding research on the ecology of 109 the pathogen and epidemiology of the disease under natural 110 conditions. 111 Here we report conventional PCR and qPCR methods, based on a 112 single primer pair, that are specific for S. suberifaciens strains. Pu113 rified DNA of the type strain of the closest relative of S. suberifaciens, 114 S. boekii, and type strains of other species were not amplified by 115 these methods. The protocols were designed with the intention of 116 investigating relationships between population levels in environ117 mental samples and disease development. Therefore, it was critical 118 to demonstrate that only sequences identical to S. suberifaciens 119 were amplified from environmental samples, including diseased 120 roots and soil. All of the amplicons cloned and sequenced from soil 121 and roots were identical or nearly identical to the type strain of S. suberifaciens (Section 3.2). Q1 122 123 In previous studies the interactions between lettuce plants and 124 S. suberifaciens were evaluated by monitoring pathogen population 125 levels in the roots of lettuce plants grown in fumigated field or 126 sterilized greenhouse soil artificially inoculated with a rifampicin 127 resistant variant of S. suberifaciens [24]. These studies provided 128 valuable data on the population dynamics of the pathogen in the 129 rhizospheres of host and non-host plants. However, this method 130 precludes the monitoring of naturally established populations. An 3.2. Specificity of quantitative PCR in environmental samples


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65


6


indirect, double monocolonal-polyclonal antibody sandwich ELISA technique was also used. The ELISA method was not specific for pathogens and was not useful as an initial screening of potential pathogens isolated from soil or field grown roots [30]. Although the limit of detection for the ELISA was slightly lower (4 103 CFU/gm fresh root) than that of the qPCR method reported here (1 104 CFU/g soil; 3.3), it was not specific for S. suberifaciens and was not efficient for the detection and quantification of the pathogen from seedlings [24]. In contrast, the qPCR method reported here is specific for S. suberifaciens and is able to amplify and quantify populations of S. suberifaciens from environmental samples. In addition, the antibodies needed for the ELIZA method are not universally available whereas the primers and other materials needed for the S. suberifaciens specific PCR and qPCR protocols are easily procured. Because of the relatively high limit of detection, it was critical to determine whether the PCR and qPCR protocols described here are sufficient to detect S. suberifaciens in environmental samples at levels that are at and below those required for disease development. Drenching the planting medium with 1 104 CFU/ml did not result in significant levels of disease in greenhouse studies, though some disease occurred. This indicates that the limits of detection for the qPCR methods developed are below the threshold needed for detection at biologically relevant levels. There are additional primers and protocols available for detection and quantification of strains in the Sphingomonadaceae [31,32]. DNA sequences from a broad range of Sphingomonas and Sphingobium species including S. suberifaciens are amplified by published methods. With slight modifications to the published primers and protocols, DNA from all members of the Sphingomonadaceae known to cause corky root on lettuce are amplified (Bull et al., unpublished). These broad methods lack the specificity needed to study the ecology and epidemiology of pathogens causing corky root on lettuce. However, combining these broader assays with the specific assay reported here (2.3) should permit evaluation of changing S. suberifaciens population levels in relation to changes in population levels of a larger group of Sphingomonads. These tools will allow us to ask specific questions about the effects of management processes on natural populations of S. suberifaciens. Role of authors C.T.B conceived of and directed the research, interpreted data and wrote the manuscript; P.H.G. designed the primers, performed lab work, analyzed data and co-wrote the manuscript; K.J.M. developed the primer design and testing strategy, assisted in data interpretation and edited the manuscript. Data accessibility DNA Sequence: GenBank accessions are KJ371987 e KJ372038. Acknowledgments

Q2

The authors thank Drs. Gilda Rauscher and Pedro Uribe for technical advice. Funding for this work was provided in part by the California Leafy Greens Research Program. The authors appreciate the gift of DNA for S. boekii from J. Overmann. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.mcp.2014.03.001. References [1] Patterson CL, Grogan RG, Campbell RN. Economically important diseases of lettuce. Plant Dis 1986;70:982e7. [2] van Bruggen AHC, Jochimsen KN. First report of Rhizomonas sp. causing corky root of lettuce in Europe. Neth J Plant Pathol 1992;98:45e56. [3] van Bruggen AHC, Jochimsen KN. First report of Rhizomonas suberifaciens causing corky root of lettuce in Australia. Australas Plant Pathol 1993;22:22e7. [4] van Bruggen AHC, Brown PR, Jochimsen KN. Corky root of lettuce caused by strains of a gram-negative bacterium from muck soils of Florida, New York, and Wisconsin. Appl Environ Microbiol 1989;55:2635e40. [5] van Bruggen AHC, Rubatzky VE. Use of transplants instead of direct seeding to reduce corky root severity and losses due to corky root in iceberg lettuce. Plant Dis 1992;76:703e8. [6] van Bruggen AHC. Corky root. In: Davis RM, Subbarao KV, Raid RN, Kurtz EA, editors. Compendium of lettuce diseases. St. Paul, MN: APS Press; 1997. pp. 28e9. [7] Alvarez J, Datnoff LE, Nagata ST. Crop rotation minimizes losses from corky root in Florida lettuce. HortScience 1992;27:66e8. [8] Subbarao KV, Hubbard JC, Schulbach KF. Comparison of lettuce diseases and yield under subsurface drip and furrow irrigation. Phytopathology 1997;87: 877e83. [9] van Bruggen AHC, Brown PR. Distinction between infectious and noninfectious corky root of lettuce in relation to nitrogen fertilizer. J Am Soc Hortic Sci 1990;115:762e70. [10] van Bruggen AHC, Brown PR, Shennan C, Greathead AS. The effect of cover crops and fertilization with ammonium nitrate on corky root of lettuce. Plant Dis 1990;74:584e9. [11] Brown PR, Michelmore RW. The genetics of corky root resistance in lettuce. Phytopathology 1988;78:1145e50. [12] Mou B, Bull CT. Screening lettuce germplasm for new sources of resistance to corky root. J Am Soc Hortic Sci 2004;129:712e6. [13] Vera Cruz CM, Bai J, Oña I, Leung H, Nelson RJ, Mew T-W, et al. Predicting durability of a disease resistance gene based on an assessment of the fitness loss and epidemiological consequences of avirulence gene mutation. Proc Natl Acad Sci U S A 2000;97:13501e5. [14] Coons GH. Diseases of field and vegetable crops in the U. S. for 1921. Plant Dis Rep Sup 1922;22:409. [15] Hoff JK, Newhall AG. Corky root rot of iceberg lettuce on the mucklands of New York. Plant Dis Rep 1960;44:333e9. [16] MacNeill BH. A botrytis root rot condition in lettuce. Plant Dis Rep 1953;37: 618e9. [17] Mix AJ. Aphanomyces root rot of lettuce, pepper and eggplant seedlings in Northern New Jersey. Plant Dis Rep 1945;29:649e50. [18] Van Bruggen AHC, Grogan RG, Bogdanoff GP, Waters GM. Corky root of lettuce in California is caused by a gram-negative bacterium. Phytopathology 1988;78:581e4. [19] Yabuuchi E, Kosako Y, Naka T, Suzuki S, Yano I. Proposal of Sphingomonas suberifaciens (van Bruggen, Jochimsen and Brown 1990) comb. nov., Sphingomonas natatoria (Sly 1985) comb. nov., Sphingomonas ursincola (Yurkov et al. 1997) comb. nov., and emendation of the genus Sphingomonas. Microbiol Immunol 1999;1999(43):339e49. [20] Chen H, Jogler M, Rohde M, Klenk H-P, Busse H-J, Tindall BJ, et al. Sphingobium limneticum sp. nov. and Sphingobium boeckii sp. nov., two freshwater planktonic members of the family Sphingomonadacae, and reclassification of Sphingomonas suberifaciens as Sphingobium suberifaciens comb. nov. Int J Syst Evol Microbiol 2013;63:735e43. [21] van Bruggen AHC, Jochimsen KN, Brown PR. Rhizomonas suberifaciens gen. nov., sp. nov., the causal agent of corky root of lettuce. Int J Syst Bacteriol 1990;40:175e88. [22] van Bruggen AHC, Jochimsen KN, Steinberger EM, Segers P, Gillis M. Classification of Rhizomonas suberifaciens, an unnamed Rhizomonas species, and Sphingomonas spp. in rRNA superfamily IV. Int J Syst Bacteriol 1993;43:1e7. [23] Francis IM, Jochimsen KN, De Vos P, van Bruggen AHC. Reclassification of rhizosphere bacteria including strains causing corky root of lettuce as Rhzorhapis suberifaciens gen. nov., Spingobium mellinum sp. nov., Sphingobium xanthum sp. nov., and Rhizorhabdus argentea gen. nov., sp. nov. Int J Syst Evol Microbiol; 2014. http://dx.doi.org/10.1099/ijs.0.058909-0. [24] O’Brien RD, van Bruggen AHC. Populations of Rhizomonas suberifaciens on roots of host and nonhost plants. Phytopathology 1991;81:1034e8. [25] Martin KJ, Bull CT. Novel primers for detection and quantification of Myxococcus species in situ. Mol Ecol; 2006. http://dx.doi.org/10.1111/j.14718286.2006.01339.x. [26] Reasoner DJ, Geldreich EE. A new medium for the enumeration and subculture of bacteria from potable water. Appl Environ Microbiol 1985;49:1e7. [27] Van Bruggen AHC, Grogan RG, Bogdanoff CP, Waters CM. Corky root of lettuce in California caused by a gram-negative bacterium. Phytopathology 1988;78: 1139e45.


66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6


C.T. Bull et al. / Molecular and Cellular Probes xxx (2014) 1e7 [28] Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, editors. Nucleic acid techniques in bacterial systematics. New York: John Wiley and Sons; 1991. pp. 115e75. [29] Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697e703. [30] van Bruggen AHC, Jochimsen KN, Benedict AA, Pollard LW. Monoclonal antibodies for the detection of Rhizomonas suberifaciens, causal agent of corky root of lettuce, with enzyme immunoassays. Food Agr Immunol 1992;4:27e40.

7

[31] Kim H, Nishiyama M, Kunito T, Senoo K, Kawahara K, Murakami K, et al. High population of Sphingomonas species on plant surface. J Appl Microbiol 1998;85:731e6. [32] Leys MEJ, Rygaert A, Bastiaens L, Verstraete W, Top EM. Occurrence and phylogenetic diversity of Sphingomonas strains in soils contaminated with polycyclic aromatic hydrocarbons. Appl Environ Microbiol 2004;70:1944e55.


7 8 9 10 11 12

Exploring specific primers targeted against different genes for a multiplex PCR for detection of Listeria monocytogenes.

AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment.

TM7 detection in human microbiome: Are PCR primers and FISH probes specific enough?

Specific oligonucleotide primers for detection of endoglucanase positive Bacillus subtilis by PCR.

Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish.

A novel colorimetric PCR-based biosensor for detection and quantification of hepatitis B virus.

Detection of mutation delta F508 in the cystic fibrosis gene using allele-specific PCR primers and time-resolved fluorometry.

Detection of major HPVs by a new multiplex real-time PCR assay using type-specific primers.

Amplification and detection of specific DNA sequences with fluorescent PCR primers: application to delta F508 mutation in cystic fibrosis.

PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera.

PCR-Based Serotyping of Streptococcus pneumoniae from Culture-Negative Specimens: Novel Primers for Detection of Serotypes within Serogroup 18.

Designing PCR primers painlessly.

Novel real-time PCR assays for the specific detection of human infective Cryptosporidium species.

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

The strains of Rhizorhapis and related genera isolated from lettuce roots that were used to develop specific primers for Rhizorhapis suberifaciens.

PRISE2: software for designing sequence-selective PCR primers and probes.

Development of human chromosome-specific PCR primers for characterization of somatic cell hybrids.

Evaluation of Different Primers for Detection of Brucella by Using PCR Method.

The use of europium (Eu3+) labelled primers in PCR amplification of specific target DNA.

Development of species-specific PCR primers and polyphasic characterization of Lactobacillus sanfranciscensis isolated from Korean sourdough.

Primers and probe design and precision assessment of the real time RT-PCR assay in Coxsackievirus A10 and enterovirus detection.

Improved detection of HIV-1 envelope sequences using optimized PCR and inosine-substituted primers.

Quantitative real-time PCR (qPCR)--based tool for detection and quantification of Cordyceps militaris in soil.

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum.