Vol. 11, No. 10

MOLECULAR AND CELLULAR BIOLOGY, OCt. 1991, p. 5197-5205

0270-7306/91/105197-09$02.00/0 Copyright © 1991, American Society for Microbiology

Novel Protein-DNA Interactions Associated with Increased Immunoglobulin Transcription in Response to Antigen Plus Interleukin-5 CAROL F. WEBB,'* CHHAYA DAS,2 SUZANNE EATON,3 KATHRYN CALAME,4 AND PHILIP W. TUCKER2 Department of Immunobiology, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 731041; Department of Microbiology, Southwestern Medical Center at Dallas, Dallas, Texas 752352; Department of Biochemistry and Biophysics, University of California at San Francisco, San Francisco, California 941433; and Department of Microbiology, Columbia University, New York, New York 100324 Received 13 February 1991/Accepted 24 July 1991

Although much has been learned about basal levels of immunoglobulin (Ig) transcription, the regulatory effects of cytokines and antigen (Ag) upon Ig expression in lymphocytes have not been fully characterized. We previously reported that Ag plus interleukin-5 (IL-5) caused increased steady-state Ig mRNA levels in Ag-specific cell lines. In this study, we have identified a region between -250 and -125 bp 5' of the Ig transcription start site that is necessary for the induction of increased IL mRNA levels by Ag plus IL-5. Mobility shift and UV cross-linking studies indicated that IL-5 plus Ag induced increased protein binding to this region. Furthermore, this sequence was found to be closely related to another A+T-rich sequence at-525 bp 5' of the transcription start site. Both sequences exhibited similar B-cell-specific and inducible protein binding. Our data suggest that treatment with IL-5 plus Ag induces several DNA-binding proteins, some of which may participate in increasing Ig transcription above basal levels by binding to sequences 5' of the octamer motif.

kines, and T-cell contact (reviewed in reference 38). Previstudies demonstrated that Ag and the cytokine interleukin-5 (IL-5) can increase Ag-specific Ig secretion in B cells (1, 37). Using an Ag-specific transfectant, we demonstrated that the Ag phosphocholine-conjugated keyhole limpet hemocyanin in combination with IL-5 caused increased levels of steady-state ,u Ig mRNA as well as increased Ig secretion (39). These studies also suggested that the accumulation of increased steady-state mRNA in IL-5-plus-Agtreated cells was due, at least in part, to increased transcription of the Ig genes. In order to study this effect further, we asked whether sequences in the promoter region were necessary for the induction of transcription over its basal level. Our experiments showed that sequences 150 bases 5' of the octamer and heptamer regulatory motifs were required for increased transcription in response to IL-5 plus Ag. Induction with IL-5 plus Ag also caused increased binding of a B-cellspecific protein complex to this sequence. Furthermore, a second A+T-rich regulatory region that bound to IL-5-plusAg-inducible proteins was identified further 5' from this sequence and showed similar B-cell-specific protein interactions after induction. Octamer binding was not affected by IL-5 plus Ag. Thus, induction of Ig transcription above basal levels with IL-5 plus Ag appears to involve proteins that bind to sequences 5' of the octamer and other known regulatory motifs.

Immunoglobulin (Ig) heavy chain genes are expressed in a B-lymphocyte lineage-specific manner and as such have provided an excellent model system for the study of celltype-specific transcriptional regulation. Several DNA sequences that are important for the expression of these genes have already been identified. Perhaps the best characterized of these is the octamer sequence ATTTGCAT, located 50 to 60 bp upstream of the mRNA start site in variable (V)-region Ig gene promoters (23, 36). Nuclear extracts prepared from B cells contain several different octamer-binding proteins, two of which are thought to be expressed only in B cells (33, 34, 40). In addition to the octamer sequence, several other sequences that contribute to basal VH transcription have been identified, some of which bind to the IgH enhancer that resides in the intron between the rearranged V- and constant-region coding sequences (3, 4, 6, 13, 15, 20, 28, 30, 35). It is becoming increasingly evident that protein-protein interactions must exist to connect the basal transcriptional apparatus to distal binding regulatory proteins (reviewed in reference 25). Many studies to date have used B-cell lines that constitutively express Ig or that can be induced to differentiate with the polyclonal mitogen lipopolysaccharide (LPS) to study Ig transcription and B-cell differentiation. While LPS clearly induces Ig transcription in normal B cells (42), the polyclonal stimulation observed in these cases may not accurately represent normal antigen (Ag)-specific responses that occur in vivo. Differences in mitogenic and cytokine activation of DNA-binding proteins have been noted in the induction of light chain transcription (5). B-cell differentiation in vivo is brought about by a cascade of regulatory events that are still incompletely understood. Terminal differentiation into Ig-secreting plasma cells requires presentation of specific Ag, T-cell-produced cyto*

ous

MATERIALS AND METHODS

Cell culture and transfectants. The BCg3R-ld transfected cell line was described previously (39) and contains genomic and K Ig chains with S107 V regions. sequences encoding It produces antibody of a T15 idiotype with a phosphocholine-binding Ag specificity. Constructs containing the C,u S107 VH genes with deletions in the 5'-flanking sequences have been described elsewhere (13). Since these constructs

Corresponding author. 5197

5198

WEBB ET AL.

did not contain the K light chain gene segments required for phosphocholine-binding activity, we established a stable transfected clone, BCSV4-2, that expressed the K S107 light chain gene for use with the deletion constructs. Briefly, BCL1B1 was transfected with 10 ,ug of linearized pSV2 neoS107K plasmid DNA (27) by electroporation, as previously described (8). Stable transfectants were obtained by selection in medium containing 1 p.g of neomycin per ml and were cloned by limiting dilution. BCSV4-2 was selected for further transfections because immunofluorescence staining with anti-K antibodies (Southern Biotechnology Associates, Birmingham, Ala.) indicated that it expressed high levels of intracellular K protein. Double transfectants containing the ,u heavy chain deletion constructs were selected with mycophenolic acid. Surface Ig reactive with the anti-T15 idiotype antibody, AB1-2, was assessed as previously described (39). Stimulation of cells with IL-5, phosphocholine-conjugated keyhole limpet hemocyanin, or LPS was performed as previously described (39) by using 0.5 ng of recombinant IL-5 (graciously provided by R. L. Coffman, DNAX, Palo Alto, Calif.) per ml, 50 ng of phosphocholine-conjugated keyhole limpet hemocyanin per ml, or 10 p.g of LPS per ml. After 20 to 24 h, cells were washed and harvested for RNA and/or protein extraction. RNase protection assays. Total cellular RNA was isolated from induced or uninduced cells with guanidinium and hot phenol (14). Linearized DNA plasmids were used as templates for the synthesis of ot-32P-CTP internally labeled RNA probes by SP6 or T7 polymerase. Labeled RNA probes were isolated on 6% polyacrylamide denaturing gels, resuspended in 80% formamide-0.4 M NaCl-0.04 M piperazine-N,N'bis(2-ethanesulfonic acid) (PIPES) (pH 6.7)-0.1 mM EDTA, and allowed to hybridize to 4 to 6 pLg of cellular RNA for 12 to 18 h (17). Single-stranded RNA was digested, and samples were analyzed on 8% polyacrylamide denaturing gels. The plasmids used were as follows: pG4KM/K contained exons 1 to 3 of the H-2Kd gene and was linearized with Notl (17), pBCL15' contained a 322-bp fragment of the BCL1 V region cloned into pGEM-4 and was linearized with Hinfl to produce a 65-bp protected fragment (21), and plO7pr was a 421-bp fragment containing the first exon of VH S107 in pGEM-4 and produced a 99-bp protected fragment (9) when linearized with XbaI. Hybridizations were carried out at 65°C for pBCL1 and pG4KM/K and at 37°C for plO7pr. Mobility shift assays. Nuclear extracts were prepared from induced and uninduced cells (12). Protein concentrations were quantitated with Bradford reagents (Bio-Rad Laboratories, Richmond, Calif.). Mobility shift assays were performed as described elsewhere (23). Briefly, 0.5 to 1.0 ng of 'y-32P-labeled DNA probe per lane and 5 pLg of extract were incubated at 37°C for 15 min in 20 1Ld of 20 mM N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) (pH 7.9)-20% (vol/vol) glycerol-0.1 M KCl-0.2 mM EDTA-5 mM dithiothreitol-5 mM phenylmethylsulfonyl fluoride with 1 p,g of poly(dI-dC). Samples were loaded onto a 4% polyacrylamide gel, electrophoresed at 10 V/cm, dried, and autoradiographed. Competition experiments were performed by incubating unlabeled fragments or duplexed oligomers with extracts for 5 min before the addition of labeled probe. Duplexed oligomers were annealed from complimentary strands in 0.4 M NaCl by heating to 70°C and cooling slowly to room temperature. The DNA probes used were a 150-bp BamHI-FokI fragment from -574 to -424 cloned into pUC19 and a 125-bp fragment from -251 to -124 of the VH S107 promoter region

MOL. CELL. BIOL.

prepared by polymerase chain amplification and cloned into pUC19. Footprinting and methylation interference. Protein-DNA interactions were detected with methidiumpropyl-EDTAiron(II) [MPE-Fe(II)-dithiothreitol] (provided by P. Dervan, Palo Alto, Calif.) as described elsewhere (24). Briefly, 5'end-labeled DNA fragments were incubated for 15 min at 37°C with crude extracts, MPE-Fe(II)-dithiothreitol was added for 5 min at room temperature, and samples were loaded onto a 4% polyacrylamide gel. Mobility-shifted protein-DNA species were excised, eluted overnight in 0.3 M ammonium acetate with 10 ,ug of proteinase K per ml, phenol extracted, precipitated, and loaded onto 8% denaturing gels. The products of adenine- and guanine-specific modificationcleavage reactions (26) were coelectrophoresed to identify protected nucleotides. Methylation interference of 5'-endlabeled DNA fragments was measured as described previously (18, 41). UV cross-linking of protein-DNA complexes. Cross-linking of nuclear extract proteins was carried out as described elsewhere (7). Five micrograms of extract was incubated with labeled oligomers for 20 min at 37°C, after which samples were subjected to UV irradiation for 45 min at a distance of 4.5 cm. Samples were digested for 30 min at 37°C with 40 U of DNase I and 1.0 U of micrococcal nuclease to digest unprotected DNA, were heated for 5 min at 95°C under reducing conditions, and were electrophoresed in 12% sodium dodecyl sulfate (SDS)-polyacrylamide gels. The gels were dried and autoradiographed at -70°C. Labeled oligomers to the protein-binding sites were prepared by annealing 100 ng of the single-stranded 46-bp oligomer spanning -515 to -476 to 25 ng of a 20-bp oligomer complementary to the 3' end of the 46-mer. This complex was internally labeled with both Br-dUTP and (x-32P-dATP for detection by autoradiography. The A and B oligomers were complimentary to the region from -515 to -476, while the C and D oligomers were complementary to the region from -218 to -173 of the S107 VH 5'-flanking sequence. The A and C oligomers were labeled on the noncoding strand, while the B and D oligomers were labeled on the coding strand. Thus, the internally labeled sequences available for cross-linking were as follows: A, 3' ATTCATATTTATAC ACGTT 5'; B, 5' CTTGTTTATTAACTTATTTATCTTA 3'; C, 3' ACAATTTAGTGTATTTTATAACTT 5'; and D, 5' TATTGAAGTGTTATCACATACACATACA 3'. DNA sequence analyses and densitometry. DNAstar comparison programs were used to align the fragments, and GenBank was searched for homologies to these sequences by using the Snucscan program. Densitometry was performed with an LKB 2202 Laser Densitometer. Hybridizations were quantitated and normalized to the H-2Kd control, and increases were calculated as the ratio of stimulated to unstimulated RNA. Results were reported as the mean + standard deviation from four representative experiments with each vector and both V-region probes. RESULTS Sequences 5' of the octamer are necessary for induction with IL-5 plus Ag. In an earlier study, we demonstrated by Northern (RNA) blot analyses that IL-5 plus Ag caused increases in steady-state ,. mRNA levels of both the transfected S107 V region and the endogenous BCL1 V region in the Ag-specific transfectant BCg3R-ld (39). To determine the molecular basis for the increased mRNA levels, we

ANTIGEN-PLUS-INTERLEUKIN-5-INDUCED PROTEINS

VOL. 11, 1991

a -2000

Wild

;

i-\

Type

B1 Ba

Pl 9 251 ~ ~

~

-574

-424

Ba

F

-~

_BaL

-710

b

Bl

S107

+~-25 " E1

5199

1 2 3 4 56 7

I

N

S

~~~oD

2 81

BCL1 pig 125

81

Kd

-57

B:

pIg57 p1g125 a 0

C

m a.

E