RESEARCH ARTICLE DRUG MECHANISM

NPC1L1 is a key regulator of intestinal vitamin K absorption and a modulator of warfarin therapy Tappei Takada,*† Yoshihide Yamanashi,* Kentaro Konishi,* Takehito Yamamoto, Yu Toyoda, Yusuke Masuo, Hideaki Yamamoto, Hiroshi Suzuki† Vitamin K (VK) is a micronutrient that facilitates blood coagulation. VK antagonists, such as warfarin, are used in the clinic to prevent thromboembolism. Because VK is not synthesized in the body, its intestinal absorption is crucial for maintaining whole-body VK levels. However, the molecular mechanism of this absorption is unclear. We demonstrate that Niemann-Pick C1-like 1 (NPC1L1) protein, a cholesterol transporter, plays a central role in intestinal VK uptake and modulates the anticoagulant effect of warfarin. In vitro studies using NPC1L1-overexpressing intestinal cells and in vivo studies with Npc1l1-knockout mice revealed that intestinal VK absorption is NPC1L1-dependent and inhibited by ezetimibe, an NPC1L1-selective inhibitor clinically used for dyslipidemia. In addition, in vivo pharmacological studies demonstrated that the coadministration of ezetimibe and warfarin caused a reduction in hepatic VK levels and enhanced the pharmacological effect of warfarin. Adverse events caused by the coadministration of ezetimibe and warfarin were rescued by oral VK supplementation, suggesting that the drug-drug interaction effects observed were the consequence of ezetimibe-mediated VK malabsorption. This mechanism was supported by a retrospective evaluation of clinical data showing that, in more than 85% of warfarin-treated patients, the anticoagulant activity was enhanced by cotreatment with ezetimibe. Our findings provide insight into the molecular mechanism of VK absorption. This new drug-drug interaction mechanism between ezetimibe (a cholesterol transport inhibitor) and warfarin (a VK antagonist and anticoagulant) could inform clinical care of patients on these medications, such as by altering the kinetics of essential, fat-soluble vitamins.

INTRODUCTION Vitamin K (VK) is a fat-soluble micronutrient that facilitates blood coagulation by activating clotting factors such as prothrombin and factors II, VII, IX, and X in the liver (1, 2). Thus, VK antagonists, such as warfarin, are clinically used to prevent thromboembolism. Recently, in addition to these clotting factors, several proteins involved in bone metabolism, signal transduction, and cell proliferation have been reported to be under VK-dependent regulation (3). VK, like many other vitamins, is not synthesized in the body and must therefore be obtained by intestinal absorption from exogenous sources, such as the daily diet and products from intestinal bacteria. In patients treated with warfarin, the intake of VK-rich foods, like chlorella and spinach, is restricted because of the potential for attenuating the anticoagulant effect of warfarin. These facts suggest that the intestinal absorption of VK is a crucial process for the maintenance of whole-body VK levels and for the regulation of blood coagulation. Despite the importance of this vitamin, the molecular mechanism(s) of VK absorption are not clear. We aimed to identify the physiological key regulator(s) in intestinal VK absorption. We focused on the absorption of phylloquinone, also known as vitamin K1 (VK1), because about 90% of dietary VK is VK1 (4). We hypothesized that Niemann-Pick C1-like 1 (NPC1L1) functions as a physiological VK1 importer in the small intestine because of the following: (i) intestinal absorption of VK1 depends on bile (5), similar to that of cholesterol and vitamin E, both of which are physiological substrates of NPC1L1 (6–10); (ii) VK1 is mainly absorbed in the upper Department of Pharmacy, The University of Tokyo Hospital, Faculty of Medicine, The University of Tokyo, Tokyo 113-8655, Japan. *These authors contributed equally to this work. †Corresponding author. E-mail: [email protected] (T.T.); [email protected] (H.S.)

intestine, where NPC1L1 is highly expressed (6, 11); and (iii) anticoagulant activity enhancement was reported in a patient administered with warfarin in combination with ezetimibe (12), an NPC1L1-selective inhibitor clinically used for dyslipidemia; on the basis of this case report, the ezetimibe package insert now warns that caution should be exercised when ezetimibe is coadministered with warfarin (13). However, the mechanism of the warfarin-ezetimibe interaction is unclear. The present study describes findings of physiological, pharmacological, and clinical importance. A series of in vitro uptake studies and in vivo absorption studies in rats and mice revealed that VK absorption is mediated by NPC1L1. In addition, pharmacological studies with rats demonstrated that the coadministration of ezetimibe and warfarin enhances the anticoagulant effect of warfarin and that this drug-drug interaction can be accounted for by ezetimibe-mediated VK malabsorption. Consistent with the results in the rat model, retrospective surveys of clinical records revealed that the anticoagulant effect of warfarin was enhanced in the majority (more than 85%) of warfarin-treated patients after coadministration of ezetimibe. These results indicate the importance of NPC1L1 as a key regulator in the intestinal VK absorption and as a modulator of warfarin therapy, with broad implications for any class of therapy altering the blood clotting system and for the possibility that the actions of VK on other systems, such as atherogenesis, may be a consequence of ezetimibe therapy.

RESULTS NPC1L1 mediates the ezetimibe-sensitive transport of VK1 To investigate whether VK1 is taken up by an NPC1L1-mediated pathway, we first examined the time profile of VK1 uptake in human NPC1L1overexpressing colorectal adenocarcinoma Caco-2 cells (“human NPC1L1 cells”) (8). The uptake of VK1 by human NPC1L1 cells was about

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

1

RESEARCH ARTICLE fourfold higher than that of control Caco-2 cells after 3 hours (Fig. 1A). In addition, VK1 uptake was inhibited by ezetimibe in a concentrationdependent manner, with a median inhibitory concentration (IC50) of 6.3 ± 3.0 mM (Fig. 1B), which is similar to that observed for the inhibition of NPC1L1-mediated cholesterol uptake (8). For further in vitro analyses, we used ezetimibe at 40 mM because this concentration exhibited the greatest inhibition of NPC1L1-mediteded VK1 uptake. By using three kinds of Caco-2 cell lines (human NPC1L1 cells #1, #2, and #3) that expressed different levels of human NPC1L1, we confirmed that the ezetimibe-sensitive VK1 uptake (as well as the ezetimibesensitive cholesterol uptake; fig. S1) correlated with the expression level of human NPC1L1 (Fig. 1C). Furthermore, we analyzed the VK1 uptake activity of mutant NPC1L1 (L216A) (fig. S2, A and B) whose ezetimibesensitive cholesterol uptake activity was reduced (fig. S2C), as reported previously (14). Notably, the ezetimibe-sensitive VK1 uptake was also disrupted by the L216A mutation (fig. S2C). These results implicated human NPC1L1 as a mediator of VK1 uptake in vitro. The VK1 uptake activities of rat and mouse NPC1L1 were also examined using rat NPC1L1-overexpressing Caco-2 cells (“rat NPC1L1 cells”) (7) and mouse NPC1L1-overexpressing Caco-2 cells (“mouse NPC1L1 cells”). Consistent with our previous studies of human and rat NPC1L1 cells (7, 8), the overexpression, the apical localization, and the ezetimibe-sensitive cholesterol uptake activity of mouse NPC1L1 protein were confirmed in mouse NPC1L1 cells (fig. S3). Similar to

human NPC1L1 cells, VK1 uptake by rat and mouse NPC1L1 cells was significantly higher than that of control cells after 3 hours of incubation (Fig. 2A). In addition, the uptake activities of rat NPC1L1 and of mouse NPC1L1 were reduced to about 28 and 36% of normal conditions by ezetimibe, respectively (Fig. 2A). Thus, these data suggested that the uptake of VK1 by rat and mouse NPC1L1 occurs by a process similar to that mediated by human NPC1L1. NPC1L1 regulates intestinal VK1 absorption in rodents To examine whether VK1 absorption is NPC1L1-dependent in vivo, an intestinal absorption study was performed using Wistar rats and Npc1l1-knockout (Npc1l1−/−) mice (fig. S4) administered ezetimibe. The amount of VK1 absorbed in plasma and liver from the intestine of healthy rats and mice was significantly reduced by ezetimibe treatment (Fig. 2, B and C), suggesting that ezetimibe inhibits VK1 absorption in vivo as well as in vitro. In addition, VK1 absorption from the intestine was significantly reduced in Npc1l1−/− mice to about 16% (plasma) and 26% (liver) of that in wild-type mice (Fig. 2C). Cholesterol uptake was similarly abrogated in Npc1l1−/− mice compared with wild-type animals (fig. S5). In Npc1l1−/− mice, ezetimibe did not alter plasma or hepatic VK1 absorption compared with mock treatment (Fig. 2C), indicating that ezetimibe inhibits NPC1L1-mediated VK1 absorption with little effect on other kinetic processes, such as VK1 metabolism.

Fig. 1. VK1 uptake by human NPC1L1-overexpressing intestinal cells. (A) VK1 uptake by Caco-2 cells stably transfected with human NPC1L1-overexpressing vectors (human NPC1L1 cells) or empty vectors (“control cells”) over time. Data are means ± SEM (n = 3). *P < 0.05, **P < 0.01, compared with control cells at respective time point, Student’s t test. (B) Inhibitory effect of ezetimibe on the uptake of VK1. Data are means ± SEM (n = 6 to 9). **P < 0.01 versus untreated human NPC1L1 cells, ANOVA (analysis of variance) followed by Dunnett’s test. (C) Expression of human NPC1L1 protein, as assessed by Western blot, and the uptake of VK1 in three human NPC1L1-overexpressing Caco-2 cell lines and in control cells by VK1 uptake assay. The uptake of VK1 was examined after 3 hours in the presence or absence of 40 mM ezetimibe. Cell line #3 is identical to the human NPC1L1 cells in (A) and (B). Data are means ± SEM (n = 3). P values were determined by Student’s t test. Raw data are shown in table S4. All in vitro uptake assays were performed at least in duplicate. www.ScienceTranslationalMedicine.org

Coadministration of ezetimibe and warfarin reduces hepatic VK1 level and enhances anticoagulant activity in rats Clotting factors are activated in the liver through a cyclic conversion of hepatic VK (15). Owing to our data in Fig. 2, we hypothesized that inhibiting NPC1L1-mediated VK absorption by ezetimibe would enhance the inhibitory effect of warfarin on the clotting factors (Fig. 3A). To test this hypothesis, Wistar rats were treated with different combinations of ezetimibe and warfarin, and time to clotting and VK1 concentrations were analyzed. The anticoagulant effect of warfarin was reflected in the extension of prothrombin time from 11 ± 1 s in untreated rats to 61 ± 23 s in rats treated with warfarin alone (Fig. 3B). Prothrombin time in rats cotreated with warfarin and ezetimibe was increased significantly compared with rats treated with warfarin alone (Fig. 3B), whereas prothrombin time was unaffected by ezetimibe in untreated, healthy rats. In all rats used in the above pharmacological studies, hepatic VK1 was detectable (Fig. 3C), although plasma VK1 was undetectable (1.0) (Fig. 5B). More than 25% of patients (11 of 42) required a warfarin dose adjustment (specifically, a decrease). This increase in PT-INR could not be attributed to the direct effect of ezetimibe on PT-INR because administration of ezetimibe did not affect PT-INR in patients who were not treated with warfarin (Fig. 5, C and D). Collectively, our results suggest that the extension of PT-INR caused by the coadministration of ezetimibe in most warfarin-treated patients may occur as a nonidiosyncratic reaction via the NPC1L1-mediated mechanism, further supporting mechanistic

Fig. 4. Effects of VK1 supplementation on prothrombin time and hepatic VK concentration in rats cotreated with ezetimibe and warfarin. (A to F) Hepatic VK1 concentration (A), prothrombin time (B), hepatic warfarin concentration (C), plasma warfarin concentration (D), hepatic ezetimibe concentration (E), and hepatic ezetimibe-glucuronide concentration (F) of Wistar rats after 1 week of daily oral coadministration of warfarin (0.2 mg/kg per day) and ezetimibe (1 mg/kg per day) with the indicated dose of VK1. Data are means ± SEM (n = 5 to 13). P values were determined by Mann-Whitney test. N.D., not detected. Raw data are shown in table S8. www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

4

RESEARCH ARTICLE

Fig. 5. Effects of ezetimibe administration on PT-INR values in patients taking warfarin. (A) Changes in PT-INR values before and after the administration of ezetimibe in warfarin-treated patients (n = 42; table S1) were determined by analyzing medical records. (B) Fold changes of PTINR values in warfarin-treated patients were generated by normalizing to PT-INR values obtained before the administration of ezetimibe. (C) Changes in PT-INR values before and after the administration of ezetimibe in patients not treated with warfarin (n = 57; table S1) were determined by analyzing medical records. (D) Fold changes of PT-INR values in patients not treated with warfarin were generated by normalizing to PT-INR values obtained before the administration of ezetimibe. Each dot represents the average PT-INR value (A and C) and its fold change (B and D) in a patient. Averages were calculated in three, two, or one data set(s) of PT-INR values before or after starting ezetimibe administration. P values were determined using paired t test. N.S., not significantly different.

findings in animal models (Figs. 3 and 4) and in vitro in human NPC1L1 cells and liver microsomes (figs. S6 and S7).

DISCUSSION Intestinal absorption of VK is thought to be mediated by specific proteins mostly in the upper intestine (5, 11). However, there is little information about which proteins are physiologically involved in the intestinal VK1 absorption. Here, in vitro experiments using NPC1L1overexpressing cells and in vivo studies in healthy rats and Npc1l1−/− mice, with or without ezetimibe, identify NPC1L1 as a physiological regulator of intestinal VK1 absorption. Although we reveal that NPC1L1 is a key regulator in the intestinal VK1 absorption, the detailed mechanism of NPC1L1-mediated VK1

uptake remains unclear. It has been reported that the N-terminal domain of NPC1L1 binds cholesterol and plays essential roles in cholesterol uptake by promoting interactions between NPC1L1 and its recently identified cofactors flotillins and Numb (14, 16, 17). Indeed, a mutation (L216A) at the N-terminal domain of NPC1L1 that disrupts the cholesterol-binding activity of NPC1L1 also reduced its potential to uptake cholesterol (14). Because ezetimibe-sensitive VK1 uptake was also disrupted by the L216A mutation (fig. S2C), the N-terminal domain of NPC1L1 should be essential for VK1 uptake. On the basis of this result, we propose that the NPC1L1-mediated VK1 uptake may occur through similar molecular mechanisms as those identified in the cholesterol uptake process (17). A plausible hypothesis is that NPC1L1 binds not only cholesterol but also VK1 at the N-terminal domain. In vitro binding assays between VK1 and N terminus of NPC1L1 would be helpful to address this possibility, although such binding assays are not yet possible owing to the unavailability of radiolabeled VK1. Another intriguing possibility is that VK1 uptake may be regulated by not only NPC1L1 but also other cofactors, such as flotillins and Numb, which are involved in the NPC1L1-mediated cholesterol uptake (16, 17). Further studies with various flotillin- or Numb-knockdown cells or mice deficient in these cofactors will also benefit the elucidation of the detailed molecular mechanism of NPC1L1-mediated VK1 uptake. From a pharmacological point of view, our study demonstrates that the ezetimibe-mediated reduction in hepatic VK1 level could account for the stronger anticoagulant effect of warfarin in rats cotreated with ezetimibe and warfarin. In the liver, the recycling of VK1 regulates hepatic VK robustness and its blood coagulation activities. Therefore, if the VK cycle is functional, inhibition of intestinal VK absorption should not directly affect blood coagulation. Indeed, administration of ezetimibe alone did not significantly affect prothrombin time (PT-INR) in rats or in humans. However, partial inhibition of the VK cycle by warfarin should disrupt the control of hepatic VK robustness, which increases response to the supply of VK from the small intestine. Under warfarin treatment, the decrease in VK absorption may directly lead to a reduction in hepatic VK levels and, thus, the enhancement of anticoagulant activities. We demonstrated in vivo in rats that when the hepatic VK cycle is inhibited by warfarin, an adequate, exogenous supply of VK can control blood coagulation. This observation has broad implications for any class of therapy altering the blood clotting system. Clinically, warfarin therapy is known to be associated with substantial interindividual differences in the dosage necessary to achieve an appropriate anticoagulant response. To solve this problem, several factors have been proposed as determinants of warfarin dosage. The genotypes of vitamin K epoxide reductase complex subunit 1 (VKORC1), which is a pharmacological target of warfarin (18), and those of the cytochrome P450 subfamily IIC polypeptide 9 (CYP2C9), which is a primary enzyme in the metabolism of warfarin (19), have been proposed to be useful for the determination of the warfarin dose (20, 21). In addition, VK-related factors should also influence the efficacy of warfarin therapy. McDonald et al. revealed that polymorphisms of CYP4F2, a VK1 oxidase, are associated with hepatic VK1 levels and suggested the CYP4F2 genotype as an important factor for the determination of warfarin dose (22). Moreover, from our results, it can be assumed that the efficacy of intestinal VK absorption is another important factor for the design of anticoagulant therapy. Considering that VK1 absorption is primarily mediated by NPC1L1

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

5

RESEARCH ARTICLE and that certain NPC1L1 mutations affect the expression and/or the activity of the NPC1L1 protein (23, 24), information on genetic variations of NPC1L1, as well as those of other genes including the recently identified VK1-converting enzyme UbiA prenyltransferase containing 1 (25), may be useful for the design of personalized therapies. Human studies to reveal the relationship between NPC1L1 polymorphisms and the pharmacological activity of warfarin will be essential to define NPC1L1 as a clinically relevant determinant of warfarin dose. Several drugs have been reported to influence the anticoagulant effect of warfarin. For example, rifampicin and carbamazepine induce CYP2C9 expression, and therefore, coadministration of these drugs with warfarin weakens the warfarin effect through the decrease in hepatic warfarin levels (26, 27). Conversely, the package insert of warfarin states that benzbromarone and cimetidine may strengthen the effect of warfarin by inhibiting CYP2C9 (13). Unlike these drugs, ezetimibe enhances the pharmacological effect of warfarin by reducing the liver VK concentration—not by altering the pharmacokinetics of warfarin. Because hepatic VK is essential for the regulation of blood coagulation activities, changes in hepatic VK level would affect the pharmacology of not only warfarin but also other anticoagulant drugs. These findings propose an important drug-drug (ezetimibe-warfarin) interaction mediated by the alteration of the kinetics of vitamins, which are physiologically indispensable nutrients in humans. Our data support additional investigation into the molecular mechanisms of intestinal vitamin absorption and promotes careful adjustments to warfarin therapy for patients also on ezetimibe.

MATERIALS AND METHODS Study design This study was designed to reveal the involvement of NPC1L1 in the intestinal VK1 absorption and to clarify the effect of NPC1L1 inhibition on warfarin pharmacology. We examined VK1 uptake in vitro in NPC1L1-overexpressing Caco-2 (intestinal) cell lines treated with or without ezetimibe (an NPC1L1 inhibitor). VK1 absorption in the liver and plasma was evaluated in vivo in rats or mice (wild type and Npc1l1−/−) treated with or without ezetimibe. To examine the effect of ezetimibe on the pharmacological activity of warfarin, blood coagulation in rats treated with ezetimibe and/or warfarin was determined by measuring prothrombin time. In animal studies, all animals were randomized before the experiment, and investigators were blinded to group allocation during collection of the data. The drug-drug interaction between ezetimibe and warfarin in humans was assessed by comparing the PT-INR values before and after ezetimibe administration in both warfarin-treated and nontreated patients. Clinical data were collected by retrospective surveys of medical records at The University of Tokyo Hospital. Power analysis revealed that the number of warfarin-untreated patients was sufficient to detect changes in PT-INR values observed in warfarin-treated patients (a = 0.05, SD = 0.36). Quantification of VK1, warfarin, 7-hydroxywarfarin, ezetimibe, and ezetimibe-glucuronide using UPLC Ezetimibe-glucuronide was synthesized according to (28). Ezetimibe was purchased from Sequoia Research Products Ltd. The UPLC system consisted of the ACQUITY UPLC sample manager and binary solvent manager (Waters). Separations were performed with a VanGuard BEH

C18 (1.7 mm) as the precolumn (Waters) and an ACQUITY UPLC BEH C18 (1.7 mm, 2.1 × 100 mm) Column (Waters) as the main column. VK1 was detected with the ACQUITY UPLC fluorescence detector (Waters) after postcolumn reduction using a platinum reduction column (GL Science Inc.). Sample temperature was kept at 4°C, and column temperature was kept at 40°C. The mobile phase was a mixture of Milli-Q water (solvent A) and liquid chromatography–grade methanol (Nacalai Tesque) (solvent B). The UPLC conditions are shown in table S2. The excitation and emission wavelengths of the fluorescence detector were set to 244 and 430 nm, respectively. Warfarin (Wako), 7-hydroxywarfarin (BD Biosciences), ezetimibe, and ezetimibe-glucuronide were detected with the ACQUITY UPLC Quattro Premier XE tandem quadrupole mass spectrometer (Waters). Sample temperature was kept at 4°C, and column temperature was kept at 40°C. The mobile phases were 5 mM ammonium acetate solution (solvent A) and liquid chromatography–grade acetonitrile (Nacalai Tesque) (solvent B). The UPLC conditions are shown in table S2. The mass spectrometer conditions are shown in table S3. Data analyses were performed using MassLynx NT software version 4.1 (Waters). Generation and culture of NPC1L1-overexpressing Caco-2 cells The complete mouse NPC1L1 complementary DNA (cDNA) (GenBank accession no. AY437866) was amplified with the Hind III site at the 5′-end, with hemagglutinin (HA) tag (YPYDVPDYA) sequence and the Not I site attached at the 3′-end by polymerase chain reaction (PCR), and then inserted into pcDNA3.1(+) vector plasmid (Invitrogen, Life Technologies). The human NPC1L1-HA cDNA-expressing plasmid (8) was mutated at the L216 site of the NPC1L1 cDNA using sitedirected mutagenesis techniques to construct an L216A NPC1L1-HA cDNA-expressing plasmid. Using the constructed plasmids, mouse NPC1L1-overexpressing Caco-2 cells (mouse NPC1L1 cells) and L216A NPC1L1-overexpresing Caco-2 cells (“L216A NPC1L1 cells”) were generated as described previously (7). The protein expression (figs. S2A and S3A), the apical localization (figs. S2B and S3B), and the cholesterol uptake activity (figs. S2C and S3C) of mouse NPC1L1 and L216A NPC1L1 in the generated cell lines were confirmed by Western blot, immunohistochemical staining, and micellar cholesterol uptake assay, respectively. Rat and human NPC1L1-overexpressing Caco-2 cells were engineered in our previous studies by stably transfecting with an empty vector [pcDNA3.1(+)] (control cells) or vectors carrying rat NPC1L1-HA cDNA (7) or human NPC1L1-HA cDNA (8, 23, 29). All cells were cultured in Eagle’s minimum essential medium (Nacalai Tesque) with 10% fetal bovine serum (Biological Industries), penicillin and streptomycin (100 U/ml) (Nacalai Tesque), 1% nonessential amino acids (Gibco), and G418 sulfate (500 mg/ml) (Nacalai Tesque) at 37°C in an atmosphere supplemented with 5% CO2. Micellar preparation and uptake assay Cholesterol (Wako) diluted in ethanol (1 mM), phosphatidylcholine (Sigma-Aldrich) diluted in methanol (50 mM), sodium taurocholate (Sigma-Aldrich) diluted in 96% ethanol (2 mM), and either VK1 (Nacalai Tesque) diluted in ethanol (20 mM) (for VK1-containing micelles), [3H]cholesterol (American Radiolabeled Chemical Inc.) diluted in ethanol (0.04 mCi/ml) (for [3H]cholesterol-containing micelles), or warfarin diluted in ethanol (1 mM) (for warfarin-containing micelles) were mixed with [or without (for mock control)] ezetimibe diluted

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

6

RESEARCH ARTICLE in methanol and then evaporated to dryness with mild heating under N2 gas. Transport buffer (118 mM NaCl, 23.8 mM NaHCO3, 4.83 mM KCl, 0.96 mM KH2PO4, 1.2 mM MgSO4, 12.5 mM Hepes, 5 mM glucose, and 1.53 mM CaCl2 adjusted to pH 7.4) was then added to prepare the medium for uptake experiments. The micellar solution was thoroughly vortexed and stirred at 37°C for 2 to 3 hours. Cells were seeded on 12-well plates at a density of 1.2 × 105 cells per well and cultured for 14 days to allow them to differentiate. During this period, the medium was replaced every 2 or 3 days. After 14 days, cells were washed twice with the transport buffer and preincubated with the same buffer for 30 min. After preincubation, mixed micelles were added, and cells were incubated for the indicated periods. Cells were then washed with ice-cold transport buffer and disrupted with 0.2 N NaOH overnight. VK1 and warfarin in the cell lysate were measured with the UPLC systems to determine their cellular uptake. [3H]cholesterol in the cell lysate was measured with the liquid scintillation counter to determine the cellular cholesterol uptake. For normalization, the protein concentration of each well was determined with the BCA Protein Assay Kit (Thermo Scientific). The IC50 value for VK1 uptake was determined as described previously (8) to calculate the inhibitory effect of ezetimibe on NPC1L1-mediated VK1 uptake. Western blot analysis Caco-2 cells were lysed with radioimmunoprecipitation assay (RIPA) buffer (0.1% SDS, 0.5% deoxycholate, and 1% NP-40), and the cell lysate was stored at −80°C before use for Western blot analysis. For preparing crude membranes from intestinal epithelial cells, isolated mouse small intestine was homogenized with buffer A [50 mM trisHCl (pH 7.4) containing 2 mM EDTA, 2 mM EGTA, 2 mM PMSF (phenylmethylsulfonyl fluoride), leupeptin (5 mg/ml), pepstatin (1 mg/ml), and oprotinin (5 mg/ml)] and centrifuged at 1500g for 15 min. After the centrifugation, the supernatant was recentrifuged at 20,000g for 60 min. The precipitated crude membrane was resuspended in buffer A and stored at −80°C before use for Western blot analysis. The protein concentration of each specimen was measured by the method of Lowry using bovine serum albumin (BSA) as a standard. Total extracted cellular proteins (40 mg) and crude membrane proteins (70 mg) were diluted with 2× SDS loading buffer and subjected to Western blot analysis as described previously (7). An SDS– polyacrylamide gel (7%) was used to separate proteins in each specimen. The molecular weights were determined using a prestained protein marker (New England Biolabs). The primary antibodies used for experiments were 500-fold diluted rabbit anti-NPC1L1 antibody (NB400-128) (Novus Biologicals LLC) for human NPC1L1, 800-fold diluted rabbit anti-HA antibody [Y-11 (sc-805)] (Santa Cruz Biotechnology Inc.) for mouse NPC1L1-HA, 100-fold diluted rabbit anti-Npc1l1 antibody for endogenous mouse Npc1l1, 200-fold diluted rabbit anti–Na+/K+-ATPase [(Na+- and K+-dependent adenosine triphosphatase (ATPase)] a antibody [H-300 (sc-28800)] (Santa Cruz Biotechnology Inc.) for endogenous Na+/K+-ATPase a, and 1000-fold diluted rabbit anti–a-tubulin antibody (ab15246) (Cayman Chemical) for endogenous a-tubulin. For detection, the membrane was allowed to bind to 5000-fold diluted horseradish peroxidase–labeled anti-rabbit immunoglobulin G (IgG) antibody (NA934V) (GE Healthcare UK Ltd.) in TBS-T (tris-buffered saline containing Tween) containing 0.1% BSA for 1 hour at room temperature. Enzyme activity was assessed using an ECL Prime Western Blotting Detection Reagent (GE Healthcare UK Ltd.) with a luminescent image analyzer (Bio-Rad Laboratories).

Rabbit anti-Npc1l1 polyclonal antibody (anti-Npc1l1 antibody) was generated against keyhole limpet hemocyanin (KLH)–coupled mouse Npc1l1-specific peptides as follows: AFYQRSFAEKAYESC-(KLH); 158th to 172nd amino acid residues, (KLH)-C + YHKPLRNSQDFTEA; 1053rd to 1066th amino acid residues. Prepared antiserum from an immunized rabbit was further purified by the epitope-conjugated affinity column. Immunohistochemical staining Fourteen-day-old confluent L216A NPC1L1 cells and mouse NPC1L1 cells grown on 35-mm-diameter glass base dishes (Matsunami Glass Co.) were washed with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Cells were then permeabilized with PBS containing 1% (v/v) Triton X-100 for 5 min and incubated with anti-HA tag antibody diluted 100-fold in PBS containing 0.1% BSA for 1 hour at room temperature. Cells were washed three times with PBS, incubated with goat anti-rabbit IgG Alexa 488 (A-11008) (Invitrogen, Life Technologies) diluted 250-fold in PBS containing 0.1% BSA for 1 hour at room temperature, and mounted in Vectashield Mounting Medium with propidium iodide (Vector Laboratories Inc.). The cellular localizations of NPC1L1 and nuclei were visualized with a confocal laser microscope (Olympus). Animals Male Wistar rats were purchased from SLC Inc. Npc1l1−/− mice in C57BL/6 background were generated by an embryonic stem (ES) cell method. At first, targeted inactivation of Npc1l1 gene in mouse ES cells with the C57BL/6J genetic background was performed using an Npc1l1 targeting vector consisting of a Neo encoding cassette. A positive bacterial artificial chromosome clone was used as a template to amplify genomic DNA fragments of Npc1l1. An about 2.7-kb “short-arm” genomic fragment containing the promoter region of Npc1l1 and 5.6-kb “long-arm” genomic fragment containing exons 3 to 9 were inserted into the targeting vector. Homologous targeting replaced the complete exons 1 to 2 and partial promoter region with the Neo cassette (fig. S4A), resulting in the disruption of the expression of mouse Npc1l1. The targeting vector was linearized and electroporated into mouse ES cells derived from C57BL/6 mice. After a positive selection by antibiotic resistance, the selected ES cells were screened for homologous recombination using PCR with the forward primer, which was located outside the targeting construct, and reverse primer from the Neo cassette. Positively targeted ES cell clones were confirmed with Southern blotting, using Apa I/Spe I–digested DNA from ES cells and a Neo/3′ probe comprising the 668/472–base pair PCR fragment (fig. S4B). Positively targeted ES cells were microinjected into Balb/c blastocysts and transplanted into pseudopregnant recipients. Chimeric mice were isolated and crossed with C57BL/6 mice to generate F1 heterozygotes with disrupted Npc1l1 genes. After the confirmation of germline transmission, black F1 mice were intercrossed for the generation of Npc1l1−/− mice (B6-Npc1l1KO3TY/UT). For genotyping, mouse ear DNA was isolated using an alkaline boiling method. The products resulting from multiplex PCR reactions using three primers (forward: TCATGTGGCAGCAGTATCTGTAGAC, reverse 1 for wild-type allele: GGTTATTTGGAAGATGACTTCAGG, and reverse 2 for targeted allele: CTTCCTCGTGCTTTACGGTATC) were identified using 2% agarose gel electrophoresis (fig. S4C). The impaired intestinal expression of Npc1l1 protein in Npc1l1−/− mice was confirmed by Western blot analysis (fig. S4D).

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

7

RESEARCH ARTICLE All animals were housed in temperature- and humidity-controlled animal cages with a 12-hour dark-light cycle and with free access to water and standard animal chow (MF, Oriental Yeast). A diet without VK added was also obtained from Oriental Yeast. All experiments involving rats and mice were conducted using protocols approved by the Animal Studies Committee of The University of Tokyo. Emulsion preparation The emulsion was prepared as described previously with minor modifications (8, 28). Briefly, stock lipid solutions were mixed to give a final concentration of 13.3 mM triolein, 2.6 mM cholesterol, 3 mM L-a-phosphatidylcholine, and [3H]cholesterol (3 mCi/ml) (for [3H]cholesterol-containing emulsion) or 6.7 mM VK1 (for VK1-containing emulsion). The solvent was evaporated, and 19 mM sodium taurocholate (dissolved in PBS) was added to give the required lipid concentrations. The mixture was then sonicated three times for 3 min using an ultrasonic homogenizer (UP 200H) (Hielscher Ultrasonics). In vivo acute absorption study An in vivo acute absorption study was conducted as described previously (8, 28) with minor modifications. Ezetimibe ethanol solution was added directly to blank rat (or mouse) plasma to give a final concentration of 0.3 mg/ml. In a study with male Wistar rats (8 weeks old), rats fasted for 18 hours were anesthetized with urethane, and an intraduodenal cannula was inserted as described previously (8, 28). After cannulation, rats received an intravenous dose of 1 ml/kg blank plasma (for mock) or ezetimibe-containing plasma via the jugular vein. Immediately after drug administration, a VK1-containing emulsion (5 ml/kg) was delivered directly into the small intestine via the duodenal cannula. Three hours after the emulsion loading, rats were sacrificed, and plasma and liver were isolated to quantify the level of VK1. In a study with male C57BL/6 wild-type mice and Npc1l1−/− mice (10 to 12 weeks old), mice fasted for 18 hours were anesthetized with urethane and received an intravenous dose of 1.5 ml/kg blank plasma (for mock) or ezetimibecontaining plasma via the jugular vein. Immediately after drug administration, a [3H]cholesterol-containing emulsion (5 ml/kg) or a VK1 emulsion (7 ml/kg) was delivered directly into the small intestine via the duodenal cannula. Two hours after the emulsion loading, mice were sacrificed, and plasma and liver were isolated to quantify the level of [3H]cholesterol or VK1. The levels of [3H]cholesterol and VK1 in each specimen were measured with the liquid scintillation counter and the UPLC system, respectively. Data are expressed as the percent of administered dose per total plasma volume or total liver. The total plasma volume was assumed to be 4% of the body weight as described elsewhere (30). In male Wistar rats, mean values of endogenous VK1 levels correspond to 0.05% of the dose (plasma) and 0.16% of the dose (liver). In male C57BL/6 wild-type mice, the mean values correspond to 0.02% of the dose (plasma) and 0.64% of the dose (liver). In male Npc1l1−/− mice, the mean values are 0.02% of the dose (plasma) and 0.32% of the dose (liver). Measurement of prothrombin time and hepatic VK1 concentration in Wistar rats Male Wistar rats (7 weeks old) were fed a diet without the addition of VK, followed by the daily oral administration of warfarin (0.2 mg/kg per day), ezetimibe (1 mg/kg per day), and VK1 [500 ng (or 1000 ng)/200 g body weight per day] in 0.5% methylcellulose for 1 week. After the final administration of drugs and VK1, rats were fasted for 24 hours and then

sacrificed to collect 3.2% citrate plasma for prothrombin time measurements and to isolate the liver for the quantification of hepatic concentrations of VK1, warfarin, ezetimibe, and ezetimibe-glucuronide with the UPLC systems. The prothrombin time was measured by the Mitsubishi Chemical Medience Corporation. Evaluation of ezetimibe and ezetimibe-glucuronide as an inhibitor of warfarin metabolism Inhibitory effects of ezetimibe and ezetimibe-glucuronide on hepatic warfarin metabolism were evaluated by in vitro microsome incubation using RLMs, prepared as described previously (28), or pooled HLMs (BD Biosciences). Ezetimibe (0, 0.03, or 0.3 mM) or ezetimibe-glucuronide (0, 0.2, or 2 mM) was added to the incubation mixtures consisting of RLM or HLM (0.4 mg of protein/ml), warfarin (2, 5, 10, 20, 50, 100, and 300 mM), human serum albumin (1 mg/ml), EDTA (1 mM), and PBS (0.1 M, pH 7.4). The incubation mixtures were equilibrated for 5 min at 37°C, and the reaction was initiated by addition of a reduced form of nicotinamide adenine dinucleotide phosphate (NADPH)–generating system [4 mM MgCl2, glucose-6-phosphate dehydrogenase (1 U/ml), 2 mM glucose-6-phosphate, and 0.5 mM NADP] to yield a final volume of 40 ml. After 30 min of incubation at 37°C, reactions were stopped by addition of 120 ml of methanol and 20 ml of internal standard [4hydroxychalcone (50 mg/ml) (Wako) in 50% methanol]. Then, the mixtures were vortex-mixed and centrifuged (15,000 rpm for 15 min at 4°C), and the 4-ml aliquot of supernatant was subjected to the quantification of 7-hydroxywarfarin. The UPLC system described above was used for the quantification of 7-hydroxywarfarin, and the formation rate of 7-hydroxywarfarin (that is, metabolic rate of warfarin) was compared to evaluate the inhibitory effect of ezetimibe on hepatic warfarin metabolism. Analysis of clinical laboratory values before and after ezetimibe administration in humans The effect of ezetimibe administration on clinical laboratory values was examined using medical records of patients at The University of Tokyo Hospital. The institutional review board of the Graduate School of Medicine and Faculty of Medicine at The University of Tokyo approved the study protocol and waived the need for a written informed consent from each patient. The research period was from October 2007 to November 2012, and patients were selected using the following three criteria: (i) periodic PT-INR measurement, (ii) administration of ezetimibe (10 mg/day) during the research period, and (iii) stable plasma levels of aspartate aminotransferase and alanine transaminase, which are biomarkers of liver function, during the study period. Patient information is provided in table S1. The data are averages of three data sets of PT-INR values obtained before or after the initiation of ezetimibe administration in warfarintreated (n = 25) and nontreated patients (n = 29). When three independent data sets with the same warfarin dose could not be obtained, the average of two data sets from warfarin-treated (n = 6) and nontreated patients (n = 9) or one data set from warfarin-treated (n = 11) and nontreated patients (n = 19) was used. Each data set used for the analysis was obtained after achieving a steady state of warfarin therapy, because the first PT-INR data obtained in the study were corresponding to the data on 278 ± 58 days after the initiation of warfarin therapy. Other clinical laboratory values were also collected and analyzed using the same method as that for PT-INR values, if data set(s) could be acquired.

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

8

RESEARCH ARTICLE Statistical analysis Statistical analysis was performed with Prism software (GraphPad Software Inc). Two-tailed unpaired Student’s t test was used for analysis of in vitro assays and in vivo absorption studies (Figs. 1 and 2). MannWhitney test was used for analysis of pharmacological studies (Figs. 3 and 4). Paired t test was used for analysis of changes in PT-INR values (Fig. 5). Bonferroni-Holm adjusted P ≤ 0.05 was considered significant.

SUPPLEMENTARY MATERIALS www.sciencetranslationalmedicine.org/cgi/content/full/7/275/275ra23/DC1 Fig. S1. Cholesterol uptake by Caco-2 cells expressing different levels of human NPC1L1. Fig. S2. Characterization of L216A NPC1L1-overexpressing Caco-2 cells. Fig. S3. Characterization of mouse NPC1L1-overexpressing Caco-2 cells. Fig. S4. Generation of Npc1l1-knockout mice. Fig. S5. Validation of impaired cholesterol absorption in Npc1l1-knockout mice. Fig. S6. Ezetimibe does not affect warfarin uptake in rat or human NPC1L1 cells. Fig. S7. Effect of ezetimibe and ezetimibe-glucuronide on warfarin metabolism in rat and HLMs. Table S1. Summary of patient information. Table S2. UPLC conditions. Table S3. Mass spectrometer conditions. Table S4. Raw data in Fig. 1. Table S5. Raw data in Fig. 2 (A and B). Table S6. Raw data in Fig. 2C. Table S7. Raw data in Fig. 3. Table S8. Raw data in Fig. 4.

REFERENCES AND NOTES 1. B. Alexander, R. Goldstein, G. Landwehr, C. D. Cook, Congenital SPCA deficiency: A hitherto unrecognized coagulation defect with hemorrhage rectified by serum and serum fractions. J. Clin. Invest. 30, 596–608 (1951). 2. C. Hougie, E. M. Barrow, J. B. Graham, Stuart clotting defect. I. Segregation of an hereditary hemorrhagic state from the heterogeneous group heretofore called stable factor (SPCA, proconvertin, factor VII) deficiency. J. Clin. Invest. 36, 485–496 (1957). 3. P. V. Hauschka, J. B. Lian, D. E. Cole, C. M. Gundberg, Osteocalcin and matrix Gla protein: Vitamin K-dependent proteins in bone. Physiol. Rev. 69, 990–1047 (1989). 4. S. L. Booth, J. W. Suttie, Dietary intake and adequacy of vitamin K. J. Nutr. 128, 785–788 (1998). 5. M. J. Shearer, A. McBurney, P. Barkhan, Studies on the absorption and metabolism of phylloquinone (vitamin K1) in man. Vitam. Horm. 32, 513–542 (1974). 6. S. W. Altmann, H. R. Davis Jr., L. J. Zhu, X. Yao, L. M. Hoos, G. Tetzloff, S. P. Iyer, M. Maguire, A. Golovko, M. Zeng, L. Wang, N. Murgolo, M. P. Graziano, Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science 303, 1201–1204 (2004). 7. Y. Yamanashi, T. Takada, H. Suzuki, Niemann-Pick C1-like 1 overexpression facilitates ezetimibesensitive cholesterol and b-sitosterol uptake in CaCo-2 cells. J. Pharmacol. Exp. Ther. 320, 559–564 (2007). 8. K. Narushima, T. Takada, Y. Yamanashi, H. Suzuki, Niemann-Pick C1-like 1 mediates a-tocopherol transport. Mol. Pharmacol. 74, 42–49 (2008). 9. T. Takada, H. Suzuki, Molecular mechanisms of membrane transport of vitamin E. Mol. Nutr. Food Res. 54, 616–622 (2010). 10. L. Yu, S. Bharadwaj, J. M. Brown, Y. Ma, W. Du, M. A. Davis, P. Michaely, P. Liu, M. C. Willingham, L. L. Rudel, Cholesterol-regulated translocation of NPC1L1 to the cell surface facilitates free cholesterol uptake. J. Biol. Chem. 281, 6616–6624 (2006). 11. D. Hollander, E. Rim, K. S. Muralidhara, Vitamin K1 intestinal absorption in vivo: Influence of luminal contents on transport. Am. J. Physiol. 232, E69–E74 (1977). 12. S. R. Ritchie, D. W. Orr, P. N. Black, Severe jaundice following treatment with ezetimibe. Eur. J. Gastroenterol. Hepatol. 20, 572–573 (2008). 13. Merck/Schering-Plough Pharmaceutics, Zetia (ezetimibe) tablets prescribing information, http://www.accessdata.fda.gov/drugsatfda_docs/label/2006/021445s014lbl.pdf.

14. J. H. Zhang, L. Ge, W. Qi, L. Zhang, H. H. Miao, B. L. Li, M. Yang, B. L. Song, The N-terminal domain of NPC1L1 protein binds cholesterol and plays essential roles in cholesterol uptake. J. Biol. Chem. 286, 25088–25097 (2011). 15. J. Oldenburg, M. Marinova, C. Müller-Reible, M. Watzka, The vitamin K cycle. Vitam. Horm. 78, 35–62 (2008). 16. L. Ge, W. Qi, L. J. Wang, H. H. Miao, Y. X. Qu, B. L. Li, B. L. Song, Flotillins play an essential role in Niemann-Pick C1-like 1-mediated cholesterol uptake. Proc. Natl. Acad. Sci. U. S. A. 108, 551–556 (2011). 17. P. S. Li, Z. Y. Fu, Y. Y. Zhang, J. H. Zhang, C. Q. Xu, Y. T. Ma, B. L. Li, B. L. Song, The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1. Nat. Med. 20, 80–86 (2014). 18. T. Li, C. Y. Chang, D. Y. Jin, P. J. Lin, A. Khvorova, D. W. Stafford, Identification of the gene for vitamin K epoxide reductase. Nature 427, 541–544 (2004). 19. L. S. Kaminsky, Z. Y. Zhang, Human P450 metabolism of warfarin. Pharmacol. Ther. 73, 67–74 (1997). 20. G. M. Tan, E. Wu, Y. Y. Lam, B. P. Yan, Role of warfarin pharmacogenetic testing in clinical practice. Pharmacogenomics 11, 439–448 (2010). 21. S. Rost, A. Fregin, V. Ivaskevicius, E. Conzelmann, K. Hörtnagel, H. J. Pelz, K. Lappegard, E. Seifried, I. Scharrer, E. G. Tuddenham, C. R. Müller, T. M. Strom, J. Oldenburg, Mutations in VKORC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature 427, 537–541 (2004). 22. M. G. McDonald, M. J. Rieder, M. Nakano, C. K. Hsia, A. E. Rettie, CYP4F2 is a vitamin K1 oxidase: An explanation for altered warfarin dose in carriers of the V433M variant. Mol. Pharmacol. 75, 1337–1346 (2009). 23. Y. Yamanashi, T. Takada, H. Suzuki, In-vitro characterization of the six clustered variants of NPC1L1 observed in cholesterol low absorbers. Pharmacogenet. Genomics 19, 884–892 (2009). 24. J. C. Cohen, A. Pertsemlidis, S. Fahmi, S. Esmail, G. L. Vega, S. M. Grundy, H. H. Hobbs, Multiple rare variants in NPC1L1 associated with reduced sterol absorption and plasma low-density lipoprotein levels. Proc. Natl. Acad. Sci. U. S. A. 103, 1810–1815 (2006). 25. K. Nakagawa, Y. Hirota, N. Sawada, N. Yuge, M. Watanabe, Y. Uchino, N. Okuda, Y. Shimomura, Y. Suhara, T. Okano, Identification of UBIAD1 as a novel human menaquinone-4 biosynthetic enzyme. Nature 468, 117–121 (2010). 26. L. D. Heimark, M. Gibaldi, W. F. Trager, R. A. O'Reilly, D. A. Goulart, The mechanism of the warfarin-rifampin drug interaction in humans. Clin. Pharmacol. Ther. 42, 388–394 (1987). 27. R. H. Parrish, D. E. Pazdur, P. J. O'Donnell, Effect of carbamazepine initiation and discontinuation on antithrombotic control in a patient receiving warfarin: Case report and review of the literature. Pharmacotherapy 26, 1650–1653 (2006). 28. T. Yamamoto, K. Ito, M. Honma, T. Takada, H. Suzuki, Cholesterol-lowering effect of ezetimibe in uridine diphosphate glucuronosyltransferase 1A-deficient (Gunn) rats. Drug Metab. Dispos. 35, 1455–1458 (2007). 29. Y. Yamanashi, T. Takada, T. Yoshikado, J. Shoda, H. Suzuki, NPC2 regulates biliary cholesterol secretion via stimulation of ABCG5/G8-mediated cholesterol transport. Gastroenterology 140, 1664–1674 (2011). 30. C. T. Hawk, S. L. Leary, American College of Laboratory Animal Medicine, in Formulary for Laboratory Animals (Iowa State University Press, Ames, IA, ed. 1, 1995), pp. ix. Funding: Grants from the Japan Society for the Promotion of Science and Ministry of Education, Culture, Sports, Science and Technology of Japan including a Grant-in-Aid for Scientific Research on Innovative Areas “HD Physiology” (22136015). Author contributions: T.T., Y.Y., K.K., T.Y., and H.Y. were involved in acquisition, analysis, and interpretation of data. T.T., Y.Y., and H.S. were involved in the study concept and experimental design. Y.Y. and T.Y. were involved in the statistical analysis. T.Y. and Y.M. set up the conditions for measuring VK1 with UPLC systems. Y.T. was involved in the generation of Npc1l1-knockout mouse. H.S. supervised the study. T.T., Y.Y., K.K., T.Y., and H.S. wrote the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: Requests for Npc1l1−/− mice will be accommodated with material transfer agreements. Submitted 12 August 2014 Accepted 29 January 2015 Published 18 February 2015 10.1126/scitranslmed.3010329 Citation: T. Takada, Y. Yamanashi, K. Konishi, T. Yamamoto, Y. Toyoda, Y. Masuo, H. Yamamoto, H. Suzuki, NPC1L1 is a key regulator of intestinal vitamin K absorption and a modulator of warfarin therapy. Sci. Transl. Med. 7, 275ra23 (2015).

www.ScienceTranslationalMedicine.org

18 February 2015

Vol 7 Issue 275 275ra23

9