RESEARCH ARTICLE CELL BIOLOGY

Npr2 inhibits TORC1 to prevent inappropriate utilization of glutamine for biosynthesis of nitrogen-containing metabolites Sunil Laxman,* Benjamin M. Sutter, Lei Shi, Benjamin P. Tu†

INTRODUCTION

Metabolism is closely regulated according to nutrient availability. During nutrient sufficiency, metabolism provides anabolic substrates and energy for growth, whereas during starvation, processes such as autophagy provide a nutrient salvaging function (1, 2). Imbalanced metabolic regulation can result in unchecked cell growth, as in cancer (3–5). In eukaryotes, the target of rapamycin complex 1 (TORC1) pathway is a central nutrient-sensitive regulator of cell growth that responds to the abundance of amino acids (6–10). The conserved Rag family of guanosine triphosphatases (GTPases) (11–13), called Gtr1 and Gtr2 in yeast (13), regulate cell growth by activating TORC1. Rag GTPases are closely associated with the lysosome or vacuole as part of larger amino acid–sensing systems (11, 13). A conserved protein complex consisting of Iml1, Npr2, and Npr3 (called the Npr2 complex or SEACIT in yeast, or GATOR1 in mammals) is at the hub of amino acid sensing and regulation of cell growth. Npr2 and Npr3 were first identified in Saccharomyces cerevisiae yeast as inhibitors of TORC1 activity that respond to changes in the abundance of available nitrogen and amino acids (14–16). The Npr2 complex is part of a larger, vacuole-associated complex (called the SEA complex) (17, 18). Studies from yeast and mammalian cells show that the SEA complex, through the Npr2 complex, inhibits the Gtr1 and Gtr2 or RagA and RagB GTPases, which then inhibit TORC1 (19, 20). Previously, we observed that wild-type yeast induce autophagy when switched from rich media to minimal media containing lactate as the sole carbon source (18). Yeast lacking any component of the Npr2 complex escape autophagy induced by minimal media with lactate and instead proliferate at a faster rate (18, 21). This observation is consistent with the idea that the mammalian ortholog of Npr2, Nprl2, may be a tumor suppressor (22–24). Department of Biochemistry, The University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390–9038, USA. *Present address: Institute for Stem Cell Biology and Regenerative Medicine, National Center for Biological Sciences Campus, GKVK, Bellary Road, Bangalore 560065, India. †Corresponding author. E-mail: [email protected]

Here, we characterized metabolic differences in Npr2-deficient yeast that enable them to continue proliferating in conditions in which wild-type yeast induce autophagy. Our results revealed the consequences of loss of this negative regulator of TORC1 in such a nutrient environment, which led to increased S-adenosyl methionine (SAM) availability and glutamine consumption for the synthesis of nitrogenous metabolites. These findings begin to explain how the Npr2 complex regulates the TORC1 pathway to alter metabolic homeostasis in response to particular nutrient limitations.

RESULTS

Wild-type and npr2D yeast grown in minimal lactate media have different metabolic profiles To understand the role of the Npr2 complex in governing metabolic changes in response to nutrient deprivation, we profiled metabolites in wild-type and Npr2-deficient yeast (npr2D yeast) switched from a rich medium containing lactate as the carbon source (YPL) to minimal medium without amino acids and containing lactate (SL). Ammonium sulfate was the sole nitrogen source in SL. These conditions require increased oxidative metabolism for growth, and therefore may help reveal the contributions of regulatory pathways that may be subject to glucose repression (25, 26). Wild-type and npr2D yeast grow at comparable rates in YPL (21). However, as previously shown (21), npr2D yeast grew faster than wild-type yeast when switched from YPL to SL (Fig. 1A), suggesting that npr2D yeast bypassed autophagy. Integration of Npr2-FLAG into npr2D yeast inhibited growth in SL (Fig. 1A), suggesting that unchecked proliferation was not due to the accumulation of suppressor mutations. In contrast, npr2D yeast grew slower than wild-type yeast when cultured in typical minimal media with glucose and ammonium (SD) (fig. S1), consistent with published studies (14, 15). We measured the relative abundances of intracellular metabolites covering major metabolic pathways in wild-type and npr2D yeast at several

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

1

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Cells must be capable of switching between growth and autophagy in unpredictable nutrient environments. The conserved Npr2 protein complex (comprising Iml1, Npr2, and Npr3; also called SEACIT) inhibits target of rapamycin complex 1 (TORC1) kinase signaling, which inhibits autophagy in nutrient-rich conditions. In yeast cultured in media with nutrient limitations that promote autophagy and inhibit growth, loss of Npr2 enables cells to bypass autophagy and proliferate. We determined that Npr2-deficient yeast had a metabolic state distinct from that of wild-type yeast when grown in minimal media containing ammonium as a nitrogen source and a nonfermentable carbon source (lactate). Unlike wild-type yeast, which accumulated glutamine, Npr2-deficient yeast metabolized glutamine into nitrogen-containing metabolites and maintained a high concentration of S-adenosyl methionine (SAM). Moreover, in wild-type yeast grown in these nutrient-limited conditions, supplementation with methionine stimulated glutamine consumption for synthesis of nitrogenous metabolites, demonstrating integration of a sulfur-containing amino acid cue and nitrogen utilization. These data revealed the metabolic basis by which the Npr2 complex regulates cellular homeostasis and demonstrated a key function for TORC1 in regulating the synthesis and utilization of glutamine as a nitrogen source.

RESEARCH ARTICLE A

B

WT

npr2

Growth (normalized A600 )

npr2

WT

0 .5 1.5 3 4.5 0 .5 1.5 3 4.5

Time (h)

0 .5 1.5 3 4.5 0 .5 1.5 3 4.5

Time (h)

4

npr2

3

***

2

npr2 WT

Npr2-FLAG

1 0 0

5

10

15

Time in SL (h)

WT

npr2 Time (h)

–4.0 –2.7 –1.3 0.0 1.3 2.7 4.0

0 .5 1.5 3 4.5 0 .5 1.5 3 4.5

Log2 (signal)

time points after switching from YPL to SL using liquid chromatography and targeted tandem mass spectrometry (LC-MS/MS) (Fig. 1B and table S1). Both the direction and magnitude of changes of several metabolites were distinct in wild-type and npr2D yeast (Fig. 1B), with several clusters of metabolites being anticorrelated (Fig. 1B and table S1).

npr2D yeast increase nitrogen assimilation and glutamine consumption for metabolite biosynthesis We investigated which specific metabolites explained the absence of autophagy and increased proliferation of npr2D yeast. Leucine and isoleucine activate growth (13, 27). However, we found that the abundance of these amino acids was lower in npr2D yeast than in wild-type yeast (fig. S2 and table S1), suggesting that there are alternative growth-inducing metabolic signals in npr2D yeast. In contrast, the abundance of glutamine increased in wild-type yeast more than 50-fold after 3 hours in SL but remained low in npr2D yeast (Fig. 2A), suggesting that npr2D yeast either rapidly consumed glutamine or had reduced glutamine synthesis in SL. In yeast grown in media with poor carbon sources, such as lactate, Gdh2 promotes the conversion of glutamine to a-ketoglutarate for anaplerosis to replenish TCA (tricarboxylic acid) cycle intermediates or for oxidative ATP (adenosine triphosphate) synthesis (28, 29) (Fig. 2B). After switching yeast from YPL to SL, a-ketoglutarate initially became more abundant in npr2D yeast than in wild-type yeast (fig. S3), but at 4.5 hours

in SL, a-ketoglutarate was increased in wild-type yeast but decreased in npr2D yeast (fig. S3). npr2D yeast lacking Gdh2 grew at the same rate as npr2D yeast when cultured in SL (fig. S4). Thus, npr2D cells did not require glutamine-dependent anaplerosis for growth in SL. Glutamine is a critical nitrogen donor or substrate for nucleotide (30), glutathione (31), and nicotinamide adenine dinucleotide (NAD+) biosynthesis (32) (Fig. 2B), all of which may be important in proliferating cells (28). The abundances of glutathione and NAD+ were substantially higher in npr2D yeast than in wild-type yeast when grown in SL (Fig. 2C and table S1). Furthermore, whereas the abundances of nucleosides were decreased in npr2D yeast compared to wild-type yeast in SL, the abundances of nucleotides were substantially increased (Fig. 2C and table S1), consistent with the prediction that npr2D yeast consumed nucleosides to sustain nucleotide synthesis required for proliferation in SL. To test this prediction, we measured the growth of npr2D yeast with deletions of genes encoding proteins involved in nucleotide synthesis. Individual deletion of genes encoding two complementary de novo purine biosynthesis enzymes, Ade16 and Ade17, did not affect the growth of wild-type yeast (33) (fig. S5). However, npr2D ade16D, but not npr2D ade17D, yeast had reduced proliferation compared to npr2D yeast in SL (fig. S5). These data suggested that npr2D yeast grown in SL increased ammonium assimilation and conversion into glutamine as a precursor for the synthesis of nitrogenous metabolites. To directly test this hypothesis, we switched

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

2

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Fig. 1. Wild-type and npr2D yeast grown in SL have different metabolic states. (A) Graph of the growth of wild-type (WT) or npr2D yeast or npr2D yeast with FLAG-tagged Npr2 (Npr2-FLAG) integrated into the endogenous NPR2 locus in SL. Data are means ± SD of three independent experiments. ***P < 0.001, unpaired t tests. (B) Heat maps of hierarchical clustering of the abundances of the indicated metabolites in WT and npr2D yeast switched from YPL to SL and collected at the indicated times. The data are representative of two independent time courses. Numerical data are presented in table S1.

RESEARCH ARTICLE yeast compared to wild-type yeast (Fig. 2D). We simultaneously measured unlabeled WT metabolites, enabling estimates of the ratio Nucleotide npr2 40 +PRPP +cys (TCA cycle) biosynthesis of newly synthesized to existing pools. In Gdh1/ contrast to wild-type yeast, a large fraction Gln1 Gdh3 20 -ketoglutarate of the total abundances of these metabolites Glutamate Glutamine Gdh2 were 15N-labeled in npr2D yeast (Fig. 2E). 0 NH3 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 NH3 Thus, npr2D yeast grown in SL increased Glt1 Time in SL (h) ammonium assimilation to synthesize niNADH Qns1 trogenous metabolites important for growth. + C NAD 10 WT To directly determine if npr2D yeast conbiosynthesis 8 npr2 E D sumed glutamine for synthesis of nitrogeWT npr2 6 150 nous metabolites, we switched yeast from 4 100 YPL to SL supplemented with 15N glutaGSH 2 mine. We measured the abundances of 0 50 15 0 .5 1.5 3 4.5 0 .5 1.5 3 4.5 N labeled metabolites in which nitrogen 2 GSSG 0 was directly donated by glutamine, and ex1.5 4.5 h 3h cluded metabolites in which nitrogen was 500 1 indirectly derived from glutamine (fig. S6). NAD+ 400 0.5 The abundance of 15N-containing species for 300 200 these metabolites was markedly increased 0 IMP+AMP 0 .5 1.5 3 4.5 0 .5 1.5 3 4.5 100 in npr2D yeast relative to wild-type yeast in 5 0 these conditions (Fig. 3A). 4 4.5 h 3h Thus, we tested whether the growth of 3 GMP 3000 npr2D yeast in SL was dependent on glu2 tamine synthesis and consumption. The glu1 All nitrogens 14N (unlabeled) 2000 All nitrogens 15N (labeled) tamate dehydrogenase enzymes Gdh1 and 0 0 .5 1.5 3 4.5 0 .5 1.5 3 4.5 1000 Gdh3 convert a-ketoglutarate to glutamate, Time in minimal medium (h) Fig. 2. npr2D yeast grown in SL which is then converted to glutamine (Fig. 0 increase utilization of glutamine 2B) (34, 35). Deletion of GDH1 (gdh1D) alnpr2 WT 4.5 h 3h 0 .5 1.5 3 4.5 0 .5 1.5 3 4.5 Time (h) as a nitrogen donor for biosyn3000 most completely blocked proliferation of thesis of nitrogen-containing menpr2D yeast in SL (Fig. 3B), whereas dele2000 tabolites. (A) Graph of the relative tion of GDH1 only led to a statistically sigabundance of intracellular glutamine nificant but small reduction in growth of 1000 in WT and npr2D yeast switched wild-type yeast during the period measured 0 from YPL to SL and collected at (Fig. 3C). Deletion of GDH3 (gdh3D) slowed 4.5 h 3h the indicated times. The data are the growth of npr2D yeast in SL to a lesser 6000 representative of two indepen- degree than did deletion of GDH1 (fig. S7A). 4000 dent time courses. (B) Schematic Supplementing SL with glutamine, but not representation of metabolic path2000 cell-permeable a-ketoglutarate, increased the ways involving glutamine. Glutarate of growth of npr2D gdh1D yeast (Fig. 0 mine can serve as a nitrogen donor 3B), presumably enabling proliferation until 4.5 h 3h or substrate for nucleotide, glutathe glutamine in the medium was depleted. Log2 (signal) WT npr2 thione, and NAD+ synthesis, or In contrast, supplementing SL with glutareplenish TCA cycle intermedimine did not increase the growth of wildates through anaplerosis. (C) Graphs (top) or heat map (bottom) of the relative amounts of reduced glutype yeast in SL (fig. S7), suggesting that tathione (GSH), oxidized glutathione (GSSG), NAD+, or the indicated nucleosides and nucleotides in WT the ability to consume glutamine and not and npr2D yeast switched from YPL to SL and collected at the indicated times. The data are representative glutamine availability controls cell proliferof two independent time courses. (D) Graphs of the abundances of the indicated metabolites with incoration in these conditions. poration of 15N from 15N-ammonium sulfate (40 mM) as the nitrogen source in SL in WT and npr2D yeast The glutamate synthase Glt1 converts collected at the indicated times. Abundances are normalized to WT at 3 hours. (E) Fractions of the indi- a-ketoglutarate and glutamine to glutamate cated metabolites with all nitrogens unlabeled (14N) or 15N-labeled (newly synthesized) as shown in (D). (36, 37). Deletion of GLT1 (glt1D) proFor (D) and (E), the data are representative of two independent experiments. duced a small but statistically significant decrease in the growth of npr2D yeast in SL wild-type and npr2D yeast from YPL to SL containing 15N-ammonium (fig. S3B), suggesting that Glt1 only plays a small role in the proliferation sulfate as the only nitrogen source and measured the relative amounts of npr2D yeast in these conditions. of 15N-labeled glutathione, NAD+, and nucleotides [IMP (inosine monoYeast cells adapt to nitrogen availability by altering gene expression. In phosphate), AMP (adenosine monophosphate), and GMP (guanosine media with preferred nitrogen sources, such as glutamine, yeast repress the monophosphate)] (Fig. 2D and fig. S6). The relative abundances of these expression of genes encoding enzymes associated with the use of nonpre15 N-labeled metabolites were increased more than 1000-fold in npr2D ferred nitrogen sources through a process known as nitrogen catabolite A

B

Relative increase 15 N NAD+

Relative increase 15 N GSSG

Relative increase 15 N GSH

.....

Glutathione Folate +gly biosynthesis

Relative increase 15 N GMP

–3.0 –2.0 –1.0 0.0 1.0 2.0 3.0

Relative increase 15 N IMP + AMP

Relative amount NAD +

Other amino acids

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

3

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Relative amount GSSG

Relative amount GSH

Relative amount glutamine

60

RESEARCH ARTICLE

Growth (normalized A600 )

8 6 4 2 0 25

10 8

npr2

6

npr2 gdh1 + glutamine

4

***

npr2 gdh1 npr2 gdh1 + -ketoglutarate

2 0

20

0

4

8

12

Time in SL (h)

15

C Growth (normalized A600)

10 5 0

300 200 100

2.0 WT

1.5

*

0.5 0 0

0

4

300 200 100 0

2000

8

12

Time in SL (h)

D

400

3.0

***

WT npr2

2.5

*

2.0

***

1.5 1.0 0.5 0.0

1500

Relative protein amount

1000 500 0

h 5 SL

h

5 1.

3 SL

SL

pa

0.

5

Ra SL

L+ YP

YP L

h

E

4h

h

1.5 h

_

_

gdh1

1.0

Relative protein amount

Relative increase in 15 N GMP Relative increase in 15 N IMP

B

npr2

WT

10

_

Gdh1-FLAG

_

Total protein

_

Gln1-FLAG

_

Total protein

2.0 ***

1.5

***

*

1.0 0.5 0.0

Gln3-FLAG 0 npr2 Gln3-FLAG

0.5

1.5

3.0

4.5

6

Time in SL (h)

Fig. 3. npr2D yeast grown in SL use glutamine as a nitrogen donor to support growth. (A) Graphs of the abundances of the indicated metabolites with incorporation of 15N from 15N-glutamine (1 mM) in SL, in WT and npr2D yeast collected at the indicated times. Abundances are normalized to WT at 1.5 hours. Data are representative of two independent experiments. (B) Graph of the growth of yeast with the indicated genotypes cultured in SL with or without supplemental glutamine (0.5 mM) or a-ketoglutarate (cell-permeable ester, 2 mM). n =3; means ± SD. ***P < 0.001, unpaired t tests. (C) Graph of the growth of WT and gdh1D yeast in SL. Data are means ± SD of three experiments. *P < 0.05, unpaired t test. (D) Representative Western blots of lysates from WT or npr2D yeast expressing Gdh1-FLAG or Gln1-FLAG switched from YPL to SL for the specified times. Graphs represent the means ± SD of three blots from independent experiments. Proteins were normalized to total protein (Commassie stain) and then to WT at 0. *P < 0.05, ***P < 0.001, multiple t tests. (E) Western blot of WT or npr2D yeast expressing Gln3-FLAG grown in YPL with or without rapamycin (100 nM) for 20 min or switched to SL and collected at the indicated times. Increased apparent molecular weight indicates increased phosphorylation. The blot is representative of three independent experiments.

www.SCIENCESIGNALING.org

repression (30, 34, 38). In media with poor nitrogen sources, such as ammonium, yeast increase glutamine by increasing the expression of genes encoding enzymes involved in glutamine metabolism, including Gdh1 and Gln1 (30, 34, 38, 39). Therefore, we directly monitored the abundance of Gdh1 or Gln1 tagged with a FLAG epitope at the endogenous locus in wild-type and npr2D yeast. The abundance of Gdh1-FLAG and Gln1-FLAG increased in npr2D yeast, but not in wild-type yeast, switched from YPL to SL (Fig. 3D). We also examined the regulation of the transcription factor Gln3, which is activated during nitrogen starvation (10, 38, 40). The responses of Gln3 to changes in nitrogen availability are complex (40, 41), but in media containing preferred nitrogen sources, Gln3 is typically inactivated by hyperphosphorylation, which occurs in part by a TORC1dependent mechanism (10, 30, 38, 40–44). We therefore monitored gel mobility of Gln3-FLAG as an indicator of phosphorylation state. In YPL, the apparent molecular weight of Gln3 in both wild-type and npr2D yeast was decreased by inhibition of TORC1 with rapamycin (Fig. 3E), suggesting a high degree of basal phosphorylation of Gln3 in YPL. Moreover, when wild-type yeast were switched to SL, Gln3 phosphorylation immediately decreased and then recovered (Fig. 3E), suggesting that Gln3 became hyperphosphorylated as glutamine concentrations increased. In contrast, in npr2D yeast, Gln3 phosphorylation did not increase to the same extent over time in SL (Fig. 3E). Thus, these data suggest that npr2D yeast bypass normal nitrogen-sensing mechanisms in SL owing to changes in proteins involved in glutamine biosynthesis.

Methionine promotes glutamine consumption for nitrogenous metabolite biosynthesis Previously, we reported that wild-type yeast grown in SL have limited ability to synthesize sulfur-containing amino acid metabolites (21). The addition of either methionine or its downstream metabolite SAM is sufficient to inhibit autophagy in SL (21). Here, we found that the abundances of SAM and cysteine were increased in npr2D yeast relative to wild-type yeast when switched from YPL to SL (Fig. 4A and table S1). Furthermore, addition of methionine increased the proliferation of wild-type yeast in SL (Fig. 4B), suggesting that methionine might promote glutamine consumption for nitrogen.

16 December 2014

Vol 7 Issue 356 ra120

4

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Relative increase in 15 N AMP

Relative increase in 15 N NAD+

Relative increase in 15 N GSH

A

RESEARCH ARTICLE WT npr2

2.5

WT + met + gln WT + met

Relative increase 15 N GSSG

YPL SL SL SL-N SL-N YPL SL SL

Growth (normalized A600 )

Relative increase 15 N NAD+

Relative increase 15 N GMP

Relative increase 15 N IMP + AMP

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

5

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Relative increase 15 N GSH

Relative amount cysteine

Relative amount SAM

B

2.5

Growth (normalized A600)

those in media without supplemental methionine (Fig. 4C), and large fractions of 2.0 the total pools of these metabolites were 2.0 1.5 *** newly synthesized (Fig. 4D). Similarly, in WT + gln 1.5 WT 1.0 SL with 15N-glutamine, the abundances 1.0 of 15N-containing metabolites that are di0.5 0.5 rect recipients of nitrogen from glutamine 0.0 0.0 were increased in yeast grown with supple1.5 0 2 4 6 8 10 mental methionine (fig. S8). Time in SL (h) WT WT + Met D We also compared the ability of methi1.0 onine and glutamine to inhibit autophagy GSH in wild-type and npr2D yeast. We evalu0.5 ated autophagy by measuring the abunGSSG dance of low–molecular weight (“free”) 0.0 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 green fluorescent protein (GFP) in yeast Time in SL (h) NAD+ expressing GFP fused to Idh1 (Idh1-GFP), C which is cleaved during autophagy (18, 45). 150 50 IMP + 40 AMP Culturing wild-type yeast in SL medium 100 30 increased the cleavage of Idh1-GFP, and this GMP 20 50 effect was inhibited by adding methionine, 10 All nitrogens 14N (unlabeled) but not glutamine (Fig. 4E). However, sup0 0 15 All nitrogens N (labeled) plementation with glutamine or methionine 4.5 h 4.5 h 3h 3h 800 E 600 WT npr2 WT npr2 alone did not inhibit Idh1-GFP cleavage in – – M – Q – – M – Q M MQ M MQ Amino acid 600 wild-type yeast grown in SL lacking any 400 Idh1 400 nitrogen source (SL-N) (Fig. 4E), suggest-GFP 200 200 ing both methionine and nitrogen deficits 0 0 under SL-N conditions. In contrast, in npr2D 4.5 h 4.5 h 3h 3h yeast, increased Idh1-GFP cleavage indicaGFP 2500 tive of increased autophagy was observed WT 2000 only in SL-N, which was partially rescued WT + Met SL-N 1500 by adding glutamine or methionine alone 1000 F 12.5 npr2 and almost completely rescued by adding 500 both glutamine and methionine (Fig. 4E). 0 10.0 npr2 4.5 h 3h These data suggest that even when a preppm1 7.5 ** ferred nitrogen source such as glutamine WT 5.0 Fig. 4. Methionine promotes glutamine consumption for is present, wild-type cells need sufficient *** biosynthesis of nitrogenous metabolites and growth. methionine and SAM to avoid inducing au2.5 ppm1 (A) Graphs of the relative abundances of intracellular tophagy, and that yeast lacking Npr2 have 0.0 SAM and cysteine in WT and npr2D yeast switched increased SAM and can bypass autophagy 0 5 10 15 20 25 Time in SL (h) from YPL to SL and collected at the indicated times. with a less favorable nitrogen source such Data are representative of two independent time as ammonium. courses. (B) Graph of the growth of WT yeast grown in SL in the presence or absence of methionine Previously, we found that methionine (0.5 mM) with or without supplemental glutamine (2 mM). Data are means ± SD of three experiments. ***P < inhibits autophagy by promoting the meth0.001, unpaired t test. (C) Graphs of the abundances of the indicated metabolites with incorporation of ylation of the phosphatase PP2A by the 15 N from 15N-ammonium sulfate (40 mM) as the nitrogen source in SL in the presence or absence of methyltransferase Ppm1 (21). Methylated methionine (0.5 mM) in WT and npr2D yeast collected at the indicated times. Abundances are normalized to PP2A dephosphorylates Npr2 and thereby WT at 3 hours. (D) Fractions of the indicated metabolites with all nitrogens unlabeled (14N) or 15N-labeled (newly inhibits the Npr2 complex (21). In addisynthesized) as shown in (C). For (C) and (D), the data are representative of two independent experiments. tion, PP2A targets many other substrates, in(E) Western blot for GFP in lysates of WT or npr2D yeast expressing Idh1-GFP and grown in YPL, SL, or SL cluding components of TORC1 (10). Thus, without a nitrogen source (SL-N) with or without glutamine (2 mM) or methionine (0.5 mM) supplementation. we tested the extent to which methylated GFP cleavage from Idh1-GFP is indicative of the activation of autophagy. The blot is representative of three PP2A contributes to growth of cells lacking independent experiments. (F) Graph of the growth of yeast with the indicated genotypes cultured in SL. Npr2. We observed that double mutant Data are means ± SD of three experiments. **P < 0.01, ***P < 0.001, unpaired t test. npr2D ppm1D yeast proliferated slower than npr2D yeast in SL (Fig. 4F). ppm1D yeast also proliferated slower than wildTo test this hypothesis, we switched wild-type yeast from YPL to SL type yeast in SL (Fig. 4F). Thus, because PP2A is the primary substrate containing 15N-ammonium sulfate or 15N-glutamine in the presence or ab- of Ppm1 (21, 46), these data suggest that methylated PP2A dephossence of supplemental methionine. In 15N-ammonium sulfate–containing phorylates substrates other than Npr2 that contribute to growth in SL media in the presence of methionine, the abundances of 15N-labeled glu- (Fig. 4F). The rewiring of metabolism in npr2D yeast promoted growth tathione, NAD+, and nucleotides were substantially increased compared to in SL media through the combined effects of increased SAM, which A

RESEARCH ARTICLE Wild-type yeast expressing constitutively active Gtr1 mimic the growth and metabolic phenotypes of npr2D yeast

increased methylation of PP2A, and increased utilization of glutamine as a nitrogen donor.

Changes in metabolism in npr2D yeast require TORC1 activity Because the Npr2 complex negatively regulates TORC1 (14, 19, 20), we tested if the metabolic differences in npr2D yeast required TORC1 activity. We found that the differences in the abundances of most metabolites between wild-type and npr2D yeast switched from YPL to SL were largely abolished by exposure to a sublethal concentration of rapamycin (Fig. 5A). Unlike in the absence of rapamycin (Fig. 2A), in the presence of rapamycin, the abundance of glutamine steadily increased in npr2D yeast in SL, in a manner similar to wild-type yeast (Fig. 5B). Furthermore, the abundance of SAM, which was increased in the absence of rapamycin in npr2D yeast (Fig. 4A), remained similar to or lower in npr2D yeast than in wild-type yeast in rapamycin-containing SL (Fig. 5B). Thus, these data suggest that most metabolic differences caused by the absence of Npr2 were TORC1-dependent. A

SL + rapamycin npr2 WT

SL + rapamycin npr2 WT

0 .5 1.5 3 4.5 0 .5 1.5 3 4.5 Time

0 .5 1.5 3 4.5 0 .5 1.5 3 4.5

Time

–4.0 –2.7 –1.3 0.0 1.3 2.7 4.0

Sch9 controls proliferation in npr2D cells

Log2 (signal)

B 1.5 Relative amount SAM

Relative amount glutamine

100 80 60 40 20 0

0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5

Time in SL (h) WT

npr2 + rapamycin WT

1.0 0.5 0

0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5

Time in SL (h)

npr2 + rapa

Fig. 5. Changes in the metabolism of npr2D yeast depend on TORC1 activity. (A) Heat maps of hierarchical clustering of the abundances of the indicated metabolites obtained by LC-MS/MS analyses from WT or npr2D yeast measured at different times after switching the media from YPL to SL with rapamycin (40 nM). Numerical data are presented in table S2. (B) Graphs (top) or heat map (bottom) of the relative amounts of the indicated metabolites in WT yeast grown in SL or npr2D yeast grown in SL with rapamycin (40 nM) and collected at the indicated times. Data in (A) and (B) are representative of two independent time-course experiments.

www.SCIENCESIGNALING.org

TORC1 increases translation and proliferation by activating the ribosomal S6 kinase (8), known as Sch9 in yeast (48). To determine if Sch9 was required for proliferation of npr2D yeast in SL, we measured the growth of yeast with a deletion of SCH9 (sch9D yeast). We found that double mutant npr2D sch9D yeast grew slower than wild-type, npr2D, or sch9D yeast in SL (Fig. 7A). Phosphorylation by TORC1 promotes Sch9 activity (48); thus, we tested if phosphorylation of Sch9 differed between wildtype and npr2D yeast in SL. We measured the amounts of endogenous Sch9 protein tagged on the C terminus with hemagglutinin (HA). We found that HA immunoreactivity correlated with the phosphorylation state of Sch9 (fig. S10). Moreover, exposing wildtype or npr2D yeast grown in YPL to rapamycin decreased the HA immunoreactivity of full-length Sch9 (Fig. 7B), consistent with inhibition of TORC1 decreasing phosphorylation of Sch9. In addition, we performed chemical cleavage of protein lysates to generate a C-terminal fragment of Sch9 that has previously been used to estimate TORC1dependent phosphorylation (48). Rapamycin decreased both the HA immunoreactivity and apparent molecular weight of the C-terminal fragment of Sch9 in wild-type or

16 December 2014

Vol 7 Issue 356 ra120

6

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

The Npr2 complex functions as a GTPase-activating protein (GAP) for the Rag GTPase Gtr1 (19), and the GTP-bound form of Gtr1 activates TORC1 (13). To determine whether activation of Gtr1 was sufficient to induce metabolic and proliferative changes in SL similar to deletion of NPR2, we stably expressed constitutively active, GTP-bound Gtr1 (Gtr1Q65L), which promotes constitutive activation of TORC1 (13, 47). Expressing Gtr1-Q65L in wild-type yeast increased proliferation in SL (Fig. 6A), whereas expressing Gtr1-Q65L in npr2D yeast did not further enhance proliferation in SL (Fig. 6A). Moreover, the abundance of glutamine was decreased (Fig. 6B) and the abundances of NAD+ and glutathione were increased (Fig. 6C) by Gtr1-Q65L expression in wild-type yeast in SL. Likewise, Gtr1-Q65L expression increased the rate of recovery of the abundances of SAM and cysteine in wild-type yeast when switched from YPL to SL (fig. S9A), but not to the same degree as in npr2D yeast (Fig. 4). Finally, there was no evidence of cleavage of Idh1-GFP in wild-type yeast expressing Gtr1-Q65L incubated in SL (fig. S9B), suggesting that yeast did not activate autophagy. Thus, genetic activation of Gtr1 produced phenotypes similar to deletion of NPR2 in yeast in SL, suggesting that the metabolic and proliferative changes in npr2D yeast under these conditions depend on Gtr1.

RESEARCH ARTICLE A

B

phenotypes observed in npr2D yeast (Fig. 4). This regulation of nitrogen and sulfur WT npr2∆+Gtr1 WT amino acid metabolism appears to be critical Gtr1-Q65L npr2∆+Gtr1-Q65L 60 for switching between proliferation and *** 2 autophagy. WT +Gtr1 40 Our studies reveal that the role of the Npr2 complex in regulating nitrogen me1 20 tabolism, glutamine utilization, and TORC1 activity depends on nutritional context, in0 0 cluding the carbon source used by the cells. 0 4 8 12 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 Previous studies of the yeast Npr2 complex Time in SL (h) Time in SL (h) and TORC1 are limited to glucose-rich medium (14, 15, 19, 51). Under these conditions, C 3 10 5 npr2D yeast are not adapted to environ8 4 ments where the nitrogen source quality 2 6 is poor (14), but grow more normally in 3 4 the presence of the preferred nitrogen source 2 1 2 glutamine (14). Our investigations were 1 performed in media with a nonfermenta0 0 0 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 0 0.5 1.5 3 4.5 ble carbon source (lactate), and not glucose. Time in SL (h) Time in SL (h) Time in SL (h) Npr2 is degraded by the F-box ubiquitin liWT gase Grr1 (glucose repression resistant 1) Gtr1-Q65L (15). Grr1 is known to function primarily Fig. 6. Activation of Gtr1 mimics the increased proliferation and glutamine metabolism of npr2D yeast. (A) in glucose catabolite repression (52, 53), Graph of the growth of WT or npr2D yeast expressing exogenous wild-type Gtr1 or constitutively active suggesting that the function of Npr2 becomes more important upon glucose depleGtr1 (GTR1-Q65L) cultured in SL. Data are means ± SD of three experiments. ***P < 0.001, unpaired t tion or in conditions requiring oxidative tests. (B and C) Graphs of the relative abundances of the indicated metabolites in WT yeast or WT yeast metabolism. In such conditions, the absence expressing GTR1-Q65L switched from YPL to SL and collected at the indicated times. Data are representof Npr2 leads to increased nitrogen conative of two independent time-course experiments. sumption and unchecked growth. These diverse observations suggest distinct roles npr2D yeast in YPL (Fig. 7B). Furthermore, the HA immunoreactivity of both and modes of regulation for Npr2 depending on the nature of the carbon full-length Sch9 and the C-terminal fragment of Sch9 was increased in npr2D source. Nonetheless, a consensus model emerges in which the Npr2 yeast relative to wild-type yeast in both YPL and SL (Fig. 7B), suggestive of complex functions to inactivate TORC1 to slow down glutamine conincreased phosphorylation. The abundance of Sch9 transcripts did not differ sumption and promote glutamine accumulation. In media containing glubetween wild-type and npr2D yeast grown in YPL or SL (Fig. 7C). Thus, these cose and ammonium, loss of Npr2 function may cause dysregulation of data suggest that the yeast deficient for Npr2 have hyperactive TORC1 in both glutamine synthesis and utilization at the expense of other metabolic prorich and minimal media with lactate. cesses, thus leading to slower growth. There is considerable interest in the interplay between TORC1 and glutamine in growth regulation. Glutamine, in conjunction with leucine, reDISCUSSION portedly activates TORC1 by increasing leucine transport (54) or through As a key regulator of metabolism, the TORC1 pathway balances cell glutaminolysis (51, 55–57), although the precise mechanisms remain ungrowth with survival (49). Here, we defined a metabolic and mechanistic clear. We showed that in minimal lactate conditions, TORC1 activation basis of how the Npr2 complex, through TORC1, regulates cell growth in through the loss of NPR2 increased glutamine metabolism to synthesize a nonfermentable, oxidative carbon source (lactate). The loss of Npr2 re- nitrogen-containing metabolites, despite lower intracellular leucine (Fig. 2). sulted in a hyperproliferative metabolic state (Fig. 1), switching from glu- Furthermore, accumulation of glutamine did not correlate with increased tamine accumulation to consumption, thereby supplying cells with TORC1 activity (Figs. 2 and 7), and supplementation of glutamine did nitrogenous metabolites required for proliferation (Figs. 2 and 3). Npr2- not increase proliferation in wild-type yeast (Fig 4B, fig. S7). Thus, gludeficient yeast had increased SAM (Fig. 4), which can drive cell growth tamine metabolism appears to be downstream of Npr2 complex–Gtr1– and proliferation through the action of Ppm1-mediated methylation of TORC1 during such nutrient limitations. We propose a central function PP2A (21), and increased transfer RNA thiolation (50). Our data are of TORC1 in increasing the synthesis and utilization of glutamine as a consistent with a model in which the loss of Npr2 disrupts the Npr2 nitrogen donor for biosynthesis, with a key role of the Npr2 complex in complex, relieving Gtr1 inhibition and activating TORC1. TORC1 activa- modulating TORC1 activity according to the metabolic need. Finally, stution alters both nitrogen and sulfur metabolism to provide building blocks dies of cancer cell lines have focused on the utilization of glutamine as a for proliferation, and the increased methylation of PP2A due to high con- carbon source (28, 58, 59). However, our results reiterate the importance centrations of SAM drives a feed-forward loop by further inhibiting Npr2 of glutamine as a nitrogen source for biosynthesis of numerous important and activating TORC1, thereby promoting growth (Fig. 7D). Moreover, in metabolites including amino acids, nucleotides, glutathione, and NAD+ wild-type yeast grown in amino acid–free lactate medium, methionine (34, 38, 39, 60) that promote cell proliferation. Therefore, lack of Npr2 supplementation promoted nitrogen assimilation and consumption of function in certain nutritional contexts may cause dysregulations in metabglutamine for nitrogen, recapitulating the metabolic and proliferative olism that promote transformation. 80

Relative amount GSSG

Relative amount GSH

Relative amount glutamine

Gtr1-Q65L

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

7

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Relative amount NAD +

Growth (normalized A 600 )

3

RESEARCH ARTICLE B 12 npr2 8

Sch9-3HA (C terminus) WT sch9 ***npr2 sch9

4

Sch9-3HA (full length)

0 0

4

8

12

16

20

D

0.5 h 1.5 h 3 h SL

Ppm1 SAM

1.5

CH3

PP2A

1.0 Npr2

0.5

Npr3

Iml1

r2

Nucleotides, glutathione, NAD +

np

W

Glutamine consumption

Gtr1 Gtr2 EGO

TORC1

Sch9

Vacuole

Translation, proliferation

Autophagy

Fig. 7. Sch9 is required for the growth of npr2D yeast in SL. (A) Graph of the growth of yeast with the indicated genotypes in SL. Data are means ± SD of three experiments. ***P < 0.001, unpaired t tests. (B) Western blot for HA in lysates of WT or npr2D yeast expressing C-terminally HA-tagged Sch9 (Sch9-3HA) grown in YPL in the presence or absence of rapamycin (40 nM) for 20 min or switched from YPL to SL and collected at the indicated times. In the top panel, lysates were incubated with 2-nitro-5-thiocyanobenzoic acid (NTCB), which results in cleavage of the C terminus of Sch9. Increased apparent molecular weight or increased signal intensity (fig. S10) is indicative of increased phosphorylation. Total protein (Coomassie stain) was used as a loading control. The blots are representative of three independent experiments. (C) Graph of the relative abundance of SCH9 transcripts determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) from WT and npr2D yeast grown in YPL or switched from YPL to SL for 1.5 hours. Data are normalized to the abundance of actin (ACT1) and to WT in YPL. Data are means ± SD of three independent experiments. (D) Model depicting Npr2 and TORC1-mediated regulation of metabolism and cell proliferation. The absence of Npr2 increases TORC1 activity and proliferation by increasing glutamine consumption for nitrogen and the abundance of SAM. Increased SAM promotes proliferation (at least in part) through the methylation of PP2A by Ppm1, which may further increase TORC1 activity.

MATERIALS AND METHODS

Yeast strains, gene deletion, tagging, and mutagenesis The prototrophic CEN.PK strain background was used in all experiments. Strains used in this study are listed in table S3. Gene deletions or tagging was performed using a PCR-based strategy as described (61). The GTR1 coding sequence and TEF1 promoter for overexpression were amplified and inserted into the Sma I site in HO-poly-HygroMX4-HO plasmid (62). The HO-TEF1p-GTR1 Q65L-HygroMX4-HO plasmid was subsequently made by Site-Directed Mutagenesis, and these constructs were stably expressed at the HO locus in wild-type or npr2D yeast. Standard formulations for rich medium (yeast extract, peptone) or synthetic minimal medium (yeast nitrogen base and ammonium sulfate without amino acids) with 2% concentrations of the specified carbon source were used. The supplemented amino acids were methionine and glutamine (0.5 mM each or as specified), a-ketoglutarate (dimethyl-a-KG, 2 mM), and non-sulfur amino acid (Non-S) mixture containing 1 mM of each amino acid (except Met, Cys, Tyr) or as specified in the text. Unless specified, cells were grown in rich medium with lactate as the carbon source (YPL)

Total RNA from yeast cells was isolated using a MasterPure Yeast RNA kit (Epicentre). Reverse transcription was performed on 1 mg of purified total RNA, using SuperScript II reverse transcriptase (Invitrogen). Quantitative PCR was performed using SYBR Green, validated primers, and template complementary DNA. Transcript abundance was normalized to that for ACT1. The primer sequences used were SCH9: ACTGTCACAAGAGGGGAGGTand TCAAGGCCTCCCAGTCGATA, and ACT1: TCGTTCCAATTTACGCTGGTT and CGGCCAAATCGATTCTCAA.

Cell collection, protein extraction, and detection

Equal numbers of cells were collected from respective cultures; flash-frozen in liquid nitrogen; and lysed in 50 mM NaCl, 100 mM tris (pH 7.5), 1 mM EDTA, 1 mM EGTA, 10% glycerol, 0.5% Triton X-100, 2 mM b-mercaptoethanol, protease inhibitors, and phosphatase inhibitors (50 mM sodium fluoride, 2 mM sodium orthovanadate) by bead-beating with glass beads. Protein concentrations from extracts were measured using a bicinchoninic acid assay. Equal amounts of samples were resolved on 12% or 4 to 12% bis-tris gels and detected as specified. Coomassie blue–stained gels or Western blots for glucose-6-phosphate dehydrogenase (G6PD) were used as loading controls. We used the following primary antibodies: monoclonal FLAG M2 (Sigma), G6PD (Sigma), HA (12CA5, Roche), and GFP (Roche). Horseradish peroxidase–conjugated secondary antibodies (mouse and rabbit) were obtained from Sigma. For Western blotting, standard enhanced chemiluminescence methods were used, with reagents from Thermo Scientific.

Detection of phosphorylated Sch9 by NTCB cleavage The Sch9 gel mobility shift assay was modified from (48). Cultures were grown in the specified medium to an A600 of ~1, quenched in 10% trichloroacetic acid, and rapidly harvested by centrifugation. The pellets were flash-frozen and lysed in 300 ml of buffer containing 50 mM tris (pH 7.5), 5 mM EDTA, 6 M urea, 1% SDS, 1 mM phenylmethylsulfonyl fluoride, and protein phosphatase inhibitors (50 mM sodium fluoride, 2 mM sodium orthovanadate) by bead-beating with glass beads, with subsequent heating (10 min, 65°C). Lysates were collected after centrifugation, and protein concentrations were measured and equalized. The chemical cleavage assay with NTCB was performed as described (48). Further analysis was done by SDS–polyacrylamide gel electrophoresis separation and immunoblotting with the HA antibody.

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

8

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

YP L W T SL np r2

0.0

TY PL

Relative amount Sch9 transcript

YPL 2.0

RNA purifications and RT-qPCR

Total protein

24

Time in SL (h)

C

for ~36 hours with repeated dilutions, to acclimatize cells to growth in lactate, and were subsequently switched to YPL, minimal medium with lactate (SL), or as indicated. Cell proliferation curves in different media used cultures started at an absorbance at 600 nm (A600) of ~0.15 to 0.2.

WT WT + np Rap r2 np r2 WT + Ra p np r2 WT np r2 WT np r2

Growth (normalized A600)

A

RESEARCH ARTICLE Cells for metabolite extractions Cells were grown in YPL for ~36 hours with repeated dilutions, diluted in YPL (A600, 0.01), and grown to an A600 of ~1.0; the cells were then collected for metabolite extractions or rapidly harvested and transferred to SL and then collected for metabolite extractions at specified times. Metabolites were extracted in 75% ethanol as described earlier (50, 63). Acidic extractions (to preserve oxidation-sensitive metabolites) were done in 75% ethanol with 0.1% formic acid.

Metabolite analysis by LC-MS/MS

15

N-Ammonium sulfate or glutamine labeling and metabolic flux analysis

15

N-labeled ammonium sulfate [( 15 NH 4 ) 2 SO 4 ] and glutamine [H215NCOCH2CH2CH(15NH2)CO2H] were obtained from Cambridge Isotope Laboratories Inc. Cells were grown in YPL and switched to SL where all the ammonium sulfate (sole nitrogen source) was 15N-labeled or to SL that was supplemented with 1 mM 15N-glutamine. 15N-labeled metabolites were detected by LC-MS/MS, with the targeted parent and daughter ions specific to the 15N form of the metabolites, as illustrated in fig. S6.

Hierarchical clustering analysis and heat maps For hierarchical clustering analysis, the normalized abundances of metabolite were log2-transformed, centered about the mean, and clustered by Spearman rank correlation with Cluster software (64, 65). The data were visualized as heat maps with Java TreeView. SUPPLEMENTARY MATERIALS www.sciencesignaling.org/cgi/content/full/7/356/ra120/DC1 Fig. S1. Wild-type and npr2D yeast growth in SD medium. Fig. S2. Changes in branched-chain amino acid abundances. Fig. S3. Changes in a-ketoglutarate abundance. Fig. S4. Growth of wild-type, npr2D, and gdh2D yeast in SL. Fig. S5. Roles of nucleotide biosynthesis enzymes. Fig. S6. Description of 15N-labeled metabolites. Fig. S7. Altered glutamine metabolism in npr2D yeast. Fig. S8. Direct consumption of glutamine in wild-type yeast grown in SL with methionine.

REFERENCES AND NOTES 1. J. D. Rabinowitz, E. White, Autophagy and metabolism. Science 330, 1344–1348 (2010). 2. H. X. Yuan, Y. Xiong, K. L. Guan, Nutrient sensing, metabolism, and cell growth control. Mol. Cell 49, 379–387 (2013). 3. D. Hanahan, R. A. Weinberg, Hallmarks of cancer: The next generation. Cell 144, 646–674 (2011). 4. R. J. Deberardinis, N. Sayed, D. Ditsworth, C. B. Thompson, Brick by brick: Metabolism and tumor cell growth. Curr. Opin. Genet. Dev. 18, 54–61 (2008). 5. R. J. DeBerardinis, J. J. Lum, G. Hatzivassiliou, C. B. Thompson, The biology of cancer: Metabolic reprogramming fuels cell growth and proliferation. Cell Metab. 7, 11–20 (2008). 6. S. Wullschleger, R. Loewith, M. N. Hall, TOR signaling in growth and metabolism. Cell 124, 471–484 (2006). 7. R. Loewith, M. N. Hall, Target of rapamycin (TOR) in nutrient signaling and growth control. Genetics 189, 1177–1201 (2011). 8. X. M. Ma, J. Blenis, Molecular mechanisms of mTOR-mediated translational control. Nat. Rev. Mol. Cell. Biol. 10, 307–318 (2009). 9. J. L. Jewell, R. C. Russell, K. L. Guan, Amino acid signalling upstream of mTOR. Nat. Rev. Mol. Cell. Biol. 14, 133–139 (2013). 10. J. R. Broach, Nutritional control of growth and development in yeast. Genetics 192, 73–105 (2012). 11. Y. Sancak, L. Bar-Peled, R. Zoncu, A. L. Markhard, S. Nada, D. M. Sabatini, RagulatorRag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 141, 290–303 (2010). 12. E. Kim, P. Goraksha-Hicks, L. Li, T. P. Neufeld, K. L. Guan, Regulation of TORC1 by Rag GTPases in nutrient response. Nat. Cell Biol. 10, 935–945 (2008). 13. M. Binda, M. P. Péli-Gulli, G. Bonfils, N. Panchaud, J. Urban, T. W. Sturgill, R. Loewith, C. De Virgilio, The Vam6 GEF controls TORC1 by activating the EGO complex. Mol. Cell 35, 563–573 (2009). 14. T. K. Neklesa, R. W. Davis, A genome-wide screen for regulators of TORC1 in response to amino acid starvation reveals a conserved Npr2/3 complex. PLOS Genet. 5, e1000515 (2009). 15. N. Spielewoy, M. Guaderrama, J. A. Wohlschlegel, M. Ashe, J. R. Yates III, C. Wittenberg, Npr2, yeast homolog of the human tumor suppressor NPRL2, is a target of Grr1 required for adaptation to growth on diverse nitrogen sources. Eukaryot. Cell 9, 592–601 (2010). 16. G. Rousselet, M. Simon, P. Ripoche, J. M. Buhler, A second nitrogen permease regulator in Saccharomyces cerevisiae. FEBS Lett. 359, 215–219 (1995). 17. S. Dokudovskaya, F. Waharte, A. Schlessinger, U. Pieper, D. P. Devos, I. M. Cristea, R. Williams, J. Salamero, B. T. Chait, A. Sali, M. C. Field, M. P. Rout, C. Dargemont, A conserved coatomer-related complex containing Sec13 and Seh1 dynamically associates with the vacuole in Saccharomyces cerevisiae. Mol. Cell. Proteomics 10, M110.006478 (2011). 18. X. Wu, B. P. Tu, Selective regulation of autophagy by the Iml1-Npr2-Npr3 complex in the absence of nitrogen starvation. Mol. Biol. Cell 22, 4124–4133 (2011). 19. N. Panchaud, M. P. Peli-Gulli, C. De Virgilio, Amino acid deprivation inhibits TORC1 through a GTPase-activating protein complex for the Rag family GTPase Gtr1. Sci. Signal. 6, ra42 (2013). 20. L. Bar-Peled, L. Chantranupong, A. D. Cherniack, W. W. Chen, K. A. Ottina, B. C. Grabiner, E. D. Spear, S. L. Carter, M. Meyerson, D. M. Sabatini, A tumor suppressor complex with GAP activity for the Rag GTPases that signal amino acid sufficiency to mTORC1. Science 340, 1100–1106 (2013). 21. B. M. Sutter, X. Wu, S. Laxman, B. P. Tu, Methionine inhibits autophagy and promotes growth by inducing the SAM-responsive methylation of PP2A. Cell 154, 403–415 (2013). 22. J. Li, F. Wang, K. Haraldson, A. Protopopov, F. M. Duh, L. Geil, I. Kuzmin, J. D. Minna, E. Stanbridge, E. Braga, V. I. Kashuba, G. Klein, M. I. Lerman, E. R. Zabarovsky, Functional characterization of the candidate tumor suppressor gene NPRL2/G21 located in 3p21.3C. Cancer Res. 64, 6438–6443 (2004). 23. E. R. Zabarovsky, M. I. Lerman, J. D. Minna, Tumor suppressor genes on chromosome 3p involved in the pathogenesis of lung and other cancers. Oncogene 21, 6915–6935 (2002). 24. P. W. Schenk, M. Brok, A. W. Boersma, J. A. Brandsma, H. Den Dulk, H. Burger, G. Stoter, J. Brouwer, K. Nooter, Anticancer drug resistance induced by disruption of the Saccharomyces cerevisiae NPR2 gene: A novel component involved in cisplatin- and doxorubicinprovoked cell kill. Mol. Pharmacol. 64, 259–268 (2003).

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

9

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Extracted metabolites were measured using targeted LC-MS/MS methods, expanding methods described previously (50, 63). A library of common metabolites was constructed using standards, and metabolites were detected using an AB SCIEX 3200 QTRAP triple quadrupole–linear ion trap mass spectrometer for quantitative optimization detection of daughter ions upon collision-induced fragmentation of the parent ion [multiple reaction monitoring (MRM)]. For each metabolite, parameters for quantitation of the two most abundant daughter ions (that is, two MRMs per metabolite) were included. Metabolites were separated chromatographically using a Synergi Fusion column (150 × 2.0 mm, 4 m, Phenomenex), using a Shimadzu Prominence LC20/SIL-20AC HPLC (high-performance liquid chromatography) autosampler coupled to the mass spectrometer. Buffers for positive-mode analysis were buffer A: 99.9% H2O/0.1% formic acid and buffer B: 99.9% methanol/0.1% formic acid (T = 0 min, 0% B; T = 4 min, 0% B; T = 11 min, 50% B; T = 13 min, 100% B; T = 15 min, 100% B, T = 16 min, 0% B; T = 20 min, stop), or buffer A: 5 mM ammonium acetate in H2O and buffer B: 5 mM ammonium acetate in 100% methanol. Buffers for negative-mode analysis were 5 mM tributylamine (TBA) (buffer A) and 100% methanol (buffer B). The area under each peak was quantitated by using Analyst software, inspected for accuracy, and normalized against total ion count, after which relative amounts were measured, setting metabolite amounts from wild-type samples in the first time point to 1.

Fig. S9. Metabolite abundances and autophagy in wild-type, npr2D, and Gtr1-Q65L– expressing yeast. Fig. S10. Phosphorylated Sch9-HA detection by HA antibodies. Table S1. Relative metabolite abundances in wild-type and npr2D yeast in SL. Table S2. Relative metabolite abundances in wild-type and npr2D yeast in SL with rapamycin. Table S3. List of yeast strains. Reference (66)

RESEARCH ARTICLE 50. S. Laxman, B. M. Sutter, X. Wu, S. Kumar, X. Guo, D. C. Trudgian, H. Mirzaei, B. P. Tu, Sulfur amino acids regulate translational capacity and metabolic homeostasis through modulation of tRNA thiolation. Cell 154, 416–429 (2013). 51. D. Stracka, S. Jozefczuk, F. Rudroff, U. Sauer, M. N. Hall, Nitrogen source activates TOR (target of rapamycin) complex 1 via glutamine and independently of Gtr/Rag proteins. J. Biol. Chem. 289, 25010–25020 (2014). 52. J. S. Flick, M. Johnston, GRR1 of Saccharomyces cerevisiae is required for glucose repression and encodes a protein with leucine-rich repeats. Mol. Cell. Biol. 11, 5101–5112 (1991). 53. M. Johnston, J. S. Flick, T. Pexton, Multiple mechanisms provide rapid and stringent glucose repression of GAL gene expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 14, 3834–3841 (1994). 54. P. Nicklin, P. Bergman, B. Zhang, E. Triantafellow, H. Wang, B. Nyfeler, H. Yang, M. Hild, C. Kung, C. Wilson, V. E. Myer, J. P. MacKeigan, J. A. Porter, Y. K. Wang, L. C. Cantley, P. M. Finan, L. O. Murphy, Bidirectional transport of amino acids regulates mTOR and autophagy. Cell 136, 521–534 (2009). 55. R. V. Durán, W. Oppliger, A. M. Robitaille, L. Heiserich, R. Skendaj, E. Gottlieb, M. N. Hall, Glutaminolysis activates Rag-mTORC1 signaling. Mol. Cell 47, 349–358 (2012). 56. S. G. Kim, G. R. Hoffman, G. Poulogiannis, G. R. Buel, Y. J. Jang, K. W. Lee, B. Y. Kim, R. L. Erikson, L. C. Cantley, A. Y. Choo, J. Blenis, Metabolic stress controls mTORC1 lysosomal localization and dimerization by regulating the TTT-RUVBL1/2 complex. Mol. Cell 49, 172–185 (2013). 57. A. Csibi, S. M. Fendt, C. Li, G. Poulogiannis, A. Y. Choo, D. J. Chapski, S. M. Jeong, J. M. Dempsey, A. Parkhitko, T. Morrison, E. P. Henske, M. C. Haigis, L. C. Cantley, G. Stephanopoulos, J. Yu, J. Blenis, The mTORC1 pathway stimulates glutamine metabolism and cell proliferation by repressing SIRT4. Cell 153, 840–854 (2013). 58. R. J. DeBerardinis, A. Mancuso, E. Daikhin, I. Nissim, M. Yudkoff, S. Wehrli, C. B. Thompson, Beyond aerobic glycolysis: Transformed cells can engage in glutamine metabolism that exceeds the requirement for protein and nucleotide synthesis. Proc. Natl. Acad. Sci. U.S.A. 104, 19345–19350 (2007). 59. C. T. Hensley, A. T. Wasti, R. J. DeBerardinis, Glutamine and cancer: Cell biology, physiology, and clinical opportunities. J. Clin. Invest. 123, 3678–3684 (2013). 60. M. A. Medina, Glutamine and cancer. J. Nutr. 131, 2539S–2542S; discussion 2550S–2551S (2001). 61. M. S. Longtine, A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, J. R. Pringle, Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961 (1998). 62. W. P. Voth, J. D. Richards, J. M. Shaw, D. J. Stillman, Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59 (2001). 63. B. P. Tu, R. E. Mohler, J. C. Liu, K. M. Dombek, E. T. Young, R. E. Synovec, S. L. McKnight, Cyclic changes in metabolic state during the life of a yeast cell. Proc. Natl. Acad. Sci. U.S.A. 104, 16886–16891 (2007). 64. M. B. Eisen, P. T. Spellman, P. O. Brown, D. Botstein, Cluster analysis and display of genomewide expression patterns. Proc. Natl. Acad. Sci. U.S.A. 95, 14863–14868 (1998). 65. M. J. de Hoon, S. Imoto, J. Nolan, S. Miyano, Open source clustering software. Bioinformatics 20, 1453–1454 (2004). 66. J. P. van Dijken, J. Bauer, L. Brambilla, P. Duboc, J. M. Francois, C. Gancedo, M. L. Giuseppin, J. J. Heijnen, M. Hoare, H. C. Lange, E. A. Madden, P. Niederberger, J. Nielsen, J. L. Parrou, T. Petit, D. Porro, M. Reuss, N. van Riel, M. Rizzi, H. Y. Steensma, C. T. Verrips, J. Vindelov, J. T. Pronk, An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26, 706–714 (2000). Funding: This work was funded by NIH grant R01GM094314, the Damon Runyon Cancer Research Foundation, and the Welch Foundation (I-1797) to B.P.T. Author contributions: The project was conceived by S.L. and B.P.T. Experiments were designed by S.L. and B.P.T. and executed by S.L., B.M.S., and L.S. The manuscript was written by S.L. and B.P.T. Competing interests: The authors declare that they have no competing financial interests. Data materials and availability: All noncommercial reagents and raw MS files are available from B.P.T. upon request. Submitted 25 September 2014 Accepted 25 November 2014 Final Publication 16 December 2014 10.1126/scisignal.2005948 Citation: S. Laxman, B. M. Sutter, L. Shi, B. P. Tu, Npr2 inhibits TORC1 to prevent inappropriate utilization of glutamine for biosynthesis of nitrogen-containing metabolites. Sci. Signal. 7, ra120 (2014).

www.SCIENCESIGNALING.org

16 December 2014

Vol 7 Issue 356 ra120

10

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

25. A. Fiechter, G. F. Fuhrmann, O. Käppeli, Regulation of glucose metabolism in growing yeast cells. Adv. Microb. Physiol. 22, 123–183 (1981). 26. O. Käppeli, Regulation of carbon metabolism in Saccharomyces cerevisiae and related yeasts. Adv. Microb. Physiol. 28, 181–209 (1986). 27. Y. Sancak, T. R. Peterson, Y. D. Shaul, R. A. Lindquist, C. C. Thoreen, L. Bar-Peled, D. M. Sabatini, The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science 320, 1496–1501 (2008). 28. R. J. DeBerardinis, T. Cheng, Q’s next: The diverse functions of glutamine in metabolism, cell biology and cancer. Oncogene 29, 313–324 (2010). 29. P. W. Coschigano, S. M. Miller, B. Magasanik, Physiological and genetic analysis of the carbon regulation of the NAD-dependent glutamate dehydrogenase of Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 4455–4465 (1991). 30. P. O. Ljungdahl, B. Daignan-Fornier, Regulation of amino acid, nucleotide, and phosphate metabolism in Saccharomyces cerevisiae. Genetics 190, 885–929 (2012). 31. J. M. Estrela, A. Ortega, E. Obrador, Glutathione in cancer biology and therapy. Crit. Rev. Clin. Lab. Sci. 43, 143–181 (2006). 32. P. Bieganowski, H. C. Pace, C. Brenner, Eukaryotic NAD+ synthetase Qns1 contains an essential, obligate intramolecular thiol glutamine amidotransferase domain related to nitrilase. J. Biol. Chem. 278, 33049–33055 (2003). 33. A. S. Tibbetts, D. R. Appling, Characterization of two 5-aminoimidazole-4-carboxamide ribonucleotide transformylase/inosine monophosphate cyclohydrolase isozymes from Saccharomyces cerevisiae. J. Biol. Chem. 275, 20920–20927 (2000). 34. B. Magasanik, Ammonia assimilation by Saccharomyces cerevisiae. Eukaryot. Cell 2, 827–829 (2003). 35. A. DeLuna, A. Avendano, L. Riego, A. Gonzalez, NADP-glutamate dehydrogenase isoenzymes of Saccharomyces cerevisiae. Purification, kinetic properties, and physiological roles. J. Biol. Chem. 276, 43775–43783 (2001). 36. S. M. Miller, B. Magasanik, Role of NAD-linked glutamate dehydrogenase in nitrogen metabolism in Saccharomyces cerevisiae. J. Bacteriol. 172, 4927–4935 (1990). 37. C. Cogoni, L. Valenzuela, D. González-Halphen, H. Olivera, G. Macino, P. Ballario, A. González, Saccharomyces cerevisiae has a single glutamate synthase gene coding for a plant-like high-molecular-weight polypeptide. J. Bacteriol. 177, 792–798 (1995). 38. T. G. Cooper, Nitrogen metabolism in Saccharomyces cerevisiae, in The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, J. N. Strathern, E. W. Jones, J. R. Broach, Eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1982), pp. 39–99. 39. B. Magasanik, C. A. Kaiser, Nitrogen regulation in Saccharomyces cerevisiae. Gene 290, 1–18 (2002). 40. T. G. Cooper, Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor proteins to the GATA factors: Connecting the dots. FEMS Microbiol. Rev. 26, 223–238 (2002). 41. J. J. Tate, T. G. Cooper, Five conditions commonly used to down-regulate tor complex 1 generate different physiological situations exhibiting distinct requirements and outcomes. J. Biol. Chem. 288, 27243–27262 (2013). 42. T. Beck, M. N. Hall, The TOR signalling pathway controls nuclear localization of nutrientregulated transcription factors. Nature 402, 689–692 (1999). 43. J. J. Tate, R. Rai, T. G. Cooper, Ammonia-specific regulation of Gln3 localization in Saccharomyces cerevisiae by protein kinase Npr1. J. Biol. Chem. 281, 28460–28469 (2006). 44. J. J. Tate, T. G. Cooper, Stress-responsive Gln3 localization in Saccharomyces cerevisiae is separable from and can overwhelm nitrogen source regulation. J. Biol. Chem. 282, 18467–18480 (2007). 45. T. Kanki, D. Kang, D. J. Klionsky, Monitoring mitophagy in yeast: The Om45-GFP processing assay. Autophagy 5, 1186–1189 (2009). 46. H. R. Kalhor, K. Luk, A. Ramos, P. Zobel-Thropp, S. Clarke, Protein phosphatase methyltransferase 1 (Ppm1p) is the sole activity responsible for modification of the major forms of protein phosphatase 2A in yeast. Arch. Biochem. Biophys. 395, 239–245 (2001). 47. N. Nakashima, E. Noguchi, T. Nishimoto, Saccharomyces cerevisiae putative G protein, Gtr1p, which forms complexes with itself and a novel protein designated as Gtr2p, negatively regulates the Ran/Gsp1p G protein cycle through Gtr2p. Genetics 152, 853–867 (1999). 48. J. Urban, A. Soulard, A. Huber, S. Lippman, D. Mukhopadhyay, O. Deloche, V. Wanke, D. Anrather, G. Ammerer, H. Riezman, J. R. Broach, C. De Virgilio, M. N. Hall, R. Loewith, Sch9 is a major target of TORC1 in Saccharomyces cerevisiae. Mol. Cell 26, 663–674 (2007). 49. M. Cornu, V. Albert, M. N. Hall, mTOR in aging, metabolism, and cancer. Curr. Opin. Genet. Dev. 23, 53–62 (2013).

Npr2 inhibits TORC1 to prevent inappropriate utilization of glutamine for biosynthesis of nitrogen-containing metabolites Sunil Laxman, Benjamin M. Sutter, Lei Shi and Benjamin P. Tu (December 16, 2014) Science Signaling 7 (356), ra120. [doi: 10.1126/scisignal.2005948]

The following resources related to this article are available online at http://stke.sciencemag.org. This information is current as of June 9, 2015.

Article Tools

Related Content

References Glossary Permissions

"Supplementary Materials" http://stke.sciencemag.org/content/suppl/2014/12/12/7.356.ra120.DC1.html The editors suggest related resources on Science's sites: http://stke.sciencemag.org/content/sigtrans/7/353/rs6.full.html http://stke.sciencemag.org/content/sigtrans/6/277/ra42.full.html http://stke.sciencemag.org/content/sigtrans/7/309/ra9.full.html http://stke.sciencemag.org/content/sigtrans/3/119/ra31.full.html http://stke.sciencemag.org/content/sigtrans/2/97/pe75.full.html http://stke.sciencemag.org/content/sigtrans/7/356/pc32.full.html http://stke.sciencemag.org/content http://stke.sciencemag.org/content/sigtrans/8/374/rs4.full.html This article cites 65 articles, 32 of which you can access for free at: http://stke.sciencemag.org/content/7/356/ra120#BIBL Look up definitions for abbreviations and terms found in this article: http://stke.sciencemag.org/cgi/glossarylookup Obtain information about reproducing this article: http://www.sciencemag.org/about/permissions.dtl

Science Signaling (ISSN 1937-9145) is published weekly, except the last December, by the American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Copyright 2015 by the American Association for the Advancement of Science; all rights reserved.

Downloaded from http://stke.sciencemag.org/ on June 9, 2015

Supplemental Materials

Visit the online version of this article to access the personalization and article tools: http://stke.sciencemag.org/content/7/356/ra120