NSun2 Promotes Cell Growth via Elevating Cyclin-Dependent Kinase 1 Translation Junyue Xing,a Jie Yi,c Xiaoyu Cai,a Hao Tang,a Zhenyun Liu,a Xiaotian Zhang,a Jennifer L. Martindale,b Xiaoling Yang,b Bin Jiang,a Myriam Gorospe,b Wengong Wanga Department of Biochemistry and Molecular Biology, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, School of Basic Medical Sciences, Peking University Health Science Center, Beijing, People’s Republic of Chinaa; Laboratory of Genetics, National Institute on Aging, National Institutes of Health, Baltimore, Maryland, USAb; Department of Clinical Laboratory, Peking Union Medical College Hospital, Beijing, People’s Republic of Chinac
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while overexpression of NSun2 elevated it without altering CDK1 mRNA levels. Further studies revealed that NSun2 methylated CDK1 mRNA in vitro and in cells and that methylation by NSun2 enhanced CDK1 translation. Importantly, NSun2-mediated regulation of CDK1 expression had an impact on the cell division cycle. These results provide new insight into the regulation of CDK1 during the cell division cycle.
T
he mammalian cell division cycle is orchestrated by the timely activation and inactivation of cyclin-dependent kinases (CDKs). Among the major CDKs, CDK1 (also known as CDC2) plays a central role in the entry into and progression through mitosis (1, 2). Once activated, CDK1 phosphorylates various substrates controlling G2 and early mitosis and thereby promotes progression through the cell division cycle (1–3). Besides regulating the cell cycle, CDK1-mediated protein phosphorylation is also implicated in controlling transcription (4–7), translation (8), epigenetic events (9), and telomere maintenance (10). The activity of CDK1 is regulated by multiple cell cycle regulatory factors. It is well known that CDK1 activity is controlled by protein-protein interactions. For example, interaction of CDK1 with positive regulators, including cyclin A or cyclin B1, activates CDK1, while interaction of CDK1 with negative regulators, including CDK inhibitors (CKIs) p27KIP1 and p21CIP1, inhibits CDK1 activity (2, 11, 12). Both cyclins and CKIs are periodically synthesized and degraded during the cell cycle, regulating the activity of CDK1. However, the interaction with cyclins is not sufficient for the full activation of CDK1; instead, CDK1 activity is also regulated by phosphorylation. The CDK-activating kinase (CAK) phosphorylates CDK1 at T161 and activates it (13–15), while Wee1 and Myt1 inhibit CDK1 activity by phosphorylating CDK1 at T14 and T15 (16–18). Protein phosphatases are also important for CDK1 activity: CDC25C dephosphorylates the T14 and T15 phosphorylation, thereby activating CDK1, while PP2A counteracts CDK1 by dephosphorylating Wee1 and CDC25 (19). Interestingly, the RINGO/Speedy family of proteins, which were originally identified as regulators of meiotic cell cycle in Xenopus oocytes and lack sequence similarity to cyclins, can activate CDK1 by directly binding to CDK1 (20). In keeping with the fact that CDK1 levels fluctuate during the cell cycle, the expression of CDK1 is also tightly regulated during the cell division cycle. The adenovirus EIA protein mediates the transcriptional activation of CDK1 by inducing the expression and assembly of the complex formed by CBF/NY-F and a 110-kDa protein, which in turn interacts with the CCAAT motifs of the CDK1 promoter and activates CDK1 transcription (21). The p53 transcription factor may repress the transcription of CDK1
December 2015 Volume 35 Number 23
through binding to the cis-acting elements (CDE and CHR) located in the CDK1 promoter (22). In addition, the expression of CDK1 is also regulated at posttranscriptional levels. For example, DAP5 protein, which is an eIF4G family member, has been found to target the internal ribosome entry site (IRES) located in the 5= untranslated region (5=UTR) of CDK1 mRNA and regulates the translation of CDK1 (23, 24). Recently, microRNA 410 (miR410), miR-650, miR-490-3p, and miR-582-5p were found to interact with the 3=UTR of CDK1 mRNA, repressing the translation of CDK1 (25–27). The p16INK4 CDK4/6 inhibitor could repress the translation of CDK1 by inducing expression of miR-410 and miR-650 (25). The tRNA methyltransferase NSun2 (Misu) mediates Myc-induced cell proliferation. The levels of expression of NSun2 differ throughout the cell cycle, displaying the lowest expression in G1 phase and the highest in S phase (27). Phosphorylation of NSun2 at Ser-139 by Aurora-B inhibits the association of NSun2 with nucleolar protein NPM1 and activates NSun2 in mitotic cells (28). tRNA has been described as a key substrate of NSun2 (29, 30), and methylation of tRNA by NSun2 stabilizes tRNA and promotes protein synthesis (30). However, whether NSun2 regulates cell cycle progression by regulating specific cell cycle regulators remains to be studied. In the present study, we demonstrated a role for NSun2 in regulating CDK1 expression and cell cycle progression. By methylating the CDK1 mRNA at the 3=UTR, NSun2 enhances the
Received 29 July 2015 Returned for modification 5 September 2015 Accepted 14 September 2015 Accepted manuscript posted online 21 September 2015 Citation Xing J, Yi J, Cai X, Tang H, Liu Z, Zhang X, Martindale JL, Yang X, Jiang B, Gorospe M, Wang W. 2015. NSun2 promotes cell growth via elevating cyclindependent kinase 1 translation. Mol Cell Biol 35:4043–4052. doi:10.1128/MCB.00742-15. Address correspondence to Wengong Wang, [email protected]. J.X. and J.Y. contributed equally to this article. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Molecular and Cellular Biology
mcb.asm.org
4043
Xing et al.
FIG 1 NSun2 regulates CDK1 expression without influencing CDK1 mRNA levels. (A) At 48 h after transfection of HeLa cells with a vector expressing NSun2 (pNSun2) or with a siRNA targeting NSun2 (shSun2), lysates were prepared to assess the levels of NSun2, cyclin A, cyclin B1, PCNA, CDK1, CDC25A, CDC25C, and GAPDH by Western blotting. Ctrl., control. (B) The protein levels of CDK1 and CDC25C were quantified by densitometry and are represented as means ⫾ standard deviations (SD) of the results of 3 independent experiments; statistical significance is indicated. V, vector. (C) RNA isolated from the cells described for panel A was subjected to real-time qPCR analysis (normalized to GAPDH mRNA) to assess the levels of CDK1 mRNA. The real-time qPCR data are represented as the means ⫾ SEM of the results of 3 independent experiments.
translation of CDK1, thereby influencing entry into and the progression of the cell division cycle. Our results reveal a novel regulatory mechanism by which the cell cycle is regulated. MATERIALS AND METHODS Cell culture, synchronization, MTT assays, and FACS analysis. U2OS cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum and antibiotics at 37°C in 5% CO2. For synchronization studies, U2OS cultures were maintained in serum-free medium for 2 days and then released by serum addition; using this synchronization protocol, the G1-phase compartment, which generally constitutes 40% to 45% of the total population, was considerably enriched, reaching ⬎70%. MTT (methyl thiazolyldiphenyl-tetrazolium bromide) assays and fluorescence-activated cell sorter (FACS) analysis were performed as described previously (31). Antibodies and Western blot analysis. Western blot analysis was performed using standard procedures. Polyclonal anti-cyclin A, polyclonal anti-cyclin B1, polyclonal anti-PCNA, polyclonal anti-NSun2, and monoclonal anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase) were from Abcam. Monoclonal anti-CDK1, monoclonal antiCDC25A, and monoclonal anti-CDC25C were from Santa Cruz Biotechnology. RNA isolation and real-time qPCR. Total cellular RNA was prepared using an RNeasy minikit (Qiagen). For real-time quantitative PCR (qPCR) analysis of CDK1 mRNA, we used the following primer pair: AA ATGTGTGTAGGTCTCAC and ATGATTTAAGCCAACTCAAA. Transfections and RNA interference. All plasmid transfections were performed using Lipofectamine 2000 (Invitrogen). Unless otherwise indicated, cells were analyzed 48 h after transfection. To silence NSun2
4044
mcb.asm.org
transiently, cells were transfected with a small interfering RNA (siRNA) targeting NSun2 (GAGATCCTCTTCTATGATC) using Oligofectamine (Invitrogen). Constructs. pGL3-5=UTR, pGL3-CR (pGL3-coding region), pGL33=UTR, and pGL3-3=UTR⌬ was constructed by inserting the 5=UTR, CR, 3=UTR, and 3=UTR⌬ fragments of CDK1 into the pGL3-promoter vector (V) (Promega). The 5=UTR was amplified by PCR using primers CCCAA GCTTAGCGCGGTGAGTTTGAAACT and CCCAAGCTTATTTTCTC TATTTTGGTATAA and inserted into the HindIII site, the CR was amplified using primers GGACTAGTCCTACCTATGGAGTTGTGTATA and GGACTAGTCCTGATTGTCCAAATCATTAAA and inserted into the XbaI site, and the 3=UTR or 3=UTR⌬ was amplified by using primers GCTCTAGAGCGATTAAGAAGATGTAGCTTTCTGAC and GCTCTA GAGCAGTTTAATTCCCAAAGCTAG and inserted into the SpeI site. The pcDNA 3.1 vector and pET-28a(⫹) vector expressing NSun2 in cells (pcDNA 3.1) and bacteria [pET-28a(⫹)] were described previously (32). Preparation of transcripts. cDNA was used as a template for PCR amplification of RNA fragments of CDK1. All 5= primers contained the T7 promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA). To prepare templates for the 5=UTR (positions 1 to 143), CR (coding region; positions 143 to 1036), UR (5=UTR plus the CR; positions 1 to 1036), CR-A (positions 143 to 520), CR-B (positions 503 to 769), CR-C (positions 752 to 1036), 3=UTR (positions 1037 to 1900), 3=UTR-A (positions 1021 to 1320), 3=UTR-B (positions 1291 to 1660), 3=UTR-C (positions 1621 to 1900), 3=UTR-Ca (positions 1621 to 1720), 3=UTR-Cb (positions 1721 to 1830), and 3=UTR-Cc (positions 1751 to 1900), we used the following primer pairs: (T7)AGCGCGGTGAGTTTGAAACT and AT TTTCTCTATTTTGGTATAA for 5=UTR, (T7)TACCTATGGAGTTGTG TATA and TGATTGTCCAAATCATTAAA for CR, (T7)ATGGAAGATT
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 2 NSun2 methylates the CDK1 CR and 3=UTR. (A) Schematic presentation of the fragments of CDK1 mRNA used for in vitro methylation assays. (B) Incorporation of 3H-labeled SAM into CDK1 fragments 5=UTR, CR, CR-A, CR-B, CR-C, 3=UTR, 3=UTR-A, 3=UTR-B, and 3=UTR-C. The incorporation of 3 H-labeled SAM into CDK1 cDNA and the p16 3=UTR served as a negative control and a positive control, respectively. CPM, counts per minute. (C) U2OS cells were transfected with the pGL3 reporter vector or with the pGL3 reporter bearing the CDK1 5=UTR (pGL3-5=UTR), the CDK1 CR (pGL3-CR), or the CDK1 3=UTR (pGL3-3=UTR) plus the pRL-CMV control reporter. At 24 h later, cells were further transfected with a vector expressing NSun2 or with an NSun2 siRNA and cultured for an additional 48 h. Firefly luciferase activity relative to Renilla luciferase activity was analyzed. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test. ATACCAAAAT and GTGAAGAACTCTTCTAGAGTGACAAAACACA ATCCCCTGTAGGATTTGGTATAAATAAC for CR-A, (T7)CTAGAAG AGTTCTTCAC and TTCTGAATCCCCATGGAAAAGTGGTTTCTTAG TTGCTAGTTCAGCAAAT for CR-B, (T7)TTCCATGGGGATTCAG AAAT and CTACATCTTCTTAATCTGATTGTCCAAATCATTAAAAT ATGGATGATTCAGTGCCAT for CR-C, (T7)AGCGCGGTGAGTTTGA AACT and TGATTGTCCAAATCATTAAA for UR, (T7)GATTAAGAAG ATGTAGCTTTCTGAC and AGTTTAATTCCCAAAGCTAG for 3=UTR, (T7)GATTAAGAAGATGTAGCTTTCTGAC and ATGATTTAAGCCAA CTCAAA for 3=UTR-A, (T7)CAGGAAAAAATTTGAGTTGG and GAC AGCCCTTGATCTTTGTA for 3=UTR-B, (T7)TGCCAAAATTTGCTAA GTCT and AGTTTAATTCCCAAAGCTAG for 3=UTR-C, (T7)TGCCAA AATTTGCTAAGTCT and CAAAACCTACCTAAAAATAAGATATTCA TAAATTTTCAAAACTGTTCTT for 3=UTR-Ca, (T7)AAAGCTTTTTGT CTAAGTGAATTC and CACTATGTCAAAATGTGTAGTTTTAAACTC AGACTCGAAAGCCAAGATAAG for 3=UTR-Cb, and (T7)CTTGTCAG AGGTAATAACTG and TATTTGTTAAACAGTTTAATTCCCAAAGCT AGTAATTTTAGTTAAATATACA for 3=UTR-Cc. The mutants of 3=UTR (3=UTR⌬; C1733 to G1733) and 3=UTR-C (3=UTR-C⌬; C1733 to G1733) were generated by overlapping PCR. The p16 3=UTR fragment was described previously (32).
December 2015 Volume 35 Number 23
For preparing the luciferase, luciferase-CR, and luciferase-3=UTR transcripts used for in vitro translation assays, we used following primers: CCAAGCTTCTAATACGACTCACTATAGGGAGAATGGAAGACGCC AAAAACAT and TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACACGG CGATCTTTCCGCCCT for luciferase, CCAAGCTTCTAATACGACTCA CTATAGGGAGAATGGAAGACGCCAAAAACAT and TTTTTTTTTTT TTTTTTTTTTTTTTTTTTTCTACATCTTCTTAATCTGATTGTCCA for luciferase-CR, and CCAAGCTTCTAATACGACTCACTATAGGGAGAAT GGAAGACGCCAAAAACAT and TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTATTTGTTCCCAAAGC for luciferase-3=UTR. In vitro methylation assays. For in vitro methyltransferase assays, His-tagged NSun2 was expressed in Escherichia coli and purified using nickel-nitrilotriacetic acid (Ni-NTA)–agarose (Qiagen) following the manufacturer’s instructions. Reaction mixtures (50 l) containing 0.2 nM His-NSun2, 0.01 nM in vitro-transcribed fragments of mRNA, and 1 Ci of 3H-labeled S-adenosyl-L-methionine (SAM; Amersham Bioscience) in reaction buffer (5 mM Tris HCl [pH 7.5], 5 mM EDTA, 10% glycerol, 1.5 mM dithiothreitol, 5 mM MgCl2) supplemented with inhibitors (leupeptin [1 g/ml], aprotinin [1 g/ml], 0.5 mM phenylmethylsulfonyl fluoride, and RNasin [5 U/l]) were incubated for 60 min at
Molecular and Cellular Biology
mcb.asm.org
4045
Xing et al.
FIG 3 NSun2 regulates CDK1 expression by methylating the CDK1 3=UTR. (A) The CDK1 CR and 3=UTR fragments were methylated in vitro by NSun2 using nonisotopic SAM. The fragments were then subjected to MS-HPLC analysis to assess the presence of m5C, as described in Materials and Methods. (B) Fragments 3=UTR-C, 3=UTR-Ca, 3=UTR-Cb, and 3=UTR-Cc (left, schematic) were used for in vitro methylation assays (right). (C) Fragment 3=UTR-Cb was methylated in vitro using NSun2 and nonisotopic SAM and subjected to bisulfate RNA sequencing analysis to identify the methylation site (m5C). The proportions of methylation at C1733, C1757, and C1780 are indicated. (D) Fragment 3=UTR or 3=UTR-C mutating C1733 (C-G) (3=UTR⌬ or 3=UTR-C⌬) was used for in vitro methylation assays as described in the Fig. 2B legend. (E) In vitro-methylated CDK1 3=UTR was subjected to methylation-specific RT-PCR to assess the levels of methylated and unmethylated 3=UTR fragments (left), as described in Materials and Methods. The levels of total 3=UTR served as a loading control. RNA isolated from U2OS cells in which NSun2 was overexpressed or silenced was subjected to methylation-specific RT-PCR to assess the levels of methylated or unmethylated CKD1 mRNA (right). The levels of total CDK1 mRNA served as loading controls. (F) U2OS cells were transfected with pGL3-derived reporters bearing the 3=UTR (pGL3-3=UTR) or the 3=UTR mutating C1733 (pGL3-3=UTR⌬) together with a pRL-CMV control reporter. At 24 h later, cells were further transfected with a vector expressing NSun2 or with an NSun2 siRNA and cultured for an additional 48 h. Firefly luciferase activity was assayed relative to Renilla luciferase activity. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test.
37°C. E. coli tRNA (Sigma) (0.01 nM) and unmethylated DNA (CDK1 cDNA; 0.01 nM) were used as positive and negative controls, respectively. Unincorporated [3H]SAM was removed by using Microspin G25 columns, and the radioactivity associated with incorporation was measured by liquid scintillation counting. Nonisotopic methylated fragment B was prepared using cold SAM (Sigma) under the same conditions. LC-MS analysis. In vitro-methylated RNA fragments (1 g) were digested by the use of nuclease P1 (sigma) and alkaline phosphatase (Promega). The formation of m5C or m6A was analyzed by mass spectrometry– high-performance liquid chromatography (MS-HPLC) analysis at Tsinghua University Mass Spectrum Center (Beijing, China). Bisulfate RNA sequencing. This method can identify the methylation site (m5C) within a RNA fragment shorter than 100 nucleotides (⬍100 nt). Briefly, a 3=UTR fragment (positions 1701 to 1800) which was methylated by NSun2 was amplified by using primers (T7)TTATTTTTAGGT AGGTTTTG and CCTCCATTCCCAACAAACAGACTCGAAAGCCAA GATAAGCAAC. This fragment (1 g) was in vitro transcribed and
4046
mcb.asm.org
methylated by using nonisotopic SAM. Samples were then dissolved in 10 l of RNase-free water, mixed with 42.5 l of 5 M sodium bisulfate (Epitect) and 17.5 l of DNA protection buffer (Epitect), and incubated in 70°C for 5 min and 60°C for 60 min, repeating for 3 to 5 cycles. After desalting was performed by the use of Micro Bio-spin6 columns, samples were desulfonated by 1 M Tris (pH 9.0; 1/1 [vol/vol]) at 37°C for 1 h, followed by ethanol precipitation. The bisulfate-converted fragments (0.2 g) were reverse transcribed by the use of a RevertAid First Strand cDNA synthesis kit (Thermo) and primer GTCGTATCCAGTGCAG GGTCCGAGGTATTCGCACTGGATACGACCCTCCATTCCCAACA AAC. The reverse-transcribed products (cDNAs) were amplified by PCR by using primers GGGAGATTATTTTTAGGTAGGTTTT and GCAGGGTCCGAGGTATTC. The PCR products were inserted into a pGEM-T Easy Vector system (Promega). The plasmids purified from single clones were sequenced. The sequences were aligned with the corresponding CDK1 mRNA sequence, and the maintained cytosines were considered the sites to be methylated.
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 4 Methylation by NSun2 enhances the translation of CDK1. (A) U2OS cells were transfected with a siRNA targeting NSun2. At 48 h later, polysomes were fractionated by centrifugation through sucrose gradients and RNA was prepared from each of 11 fractions for analysis of the distribution of CDK1 and -actin mRNAs. (B) In vitro-methylated (Met.) or unmethylated (Non-met.) linear pGL3, pGL3-CR, pGL3-3=UTR, and pGL3-3=UTR⌬ reporter transcripts were used for in vitro translation assays. Firefly luciferase activity was measured to reflect the translation efficiency. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test.
Methylation-specific RT-PCR. A 2-g volume of cellular RNA or 1 g of in vitro-methylated RNA fragment was subjected to bisulfate conversion as described under “Bisulfate RNA sequencing” above. Methylation-specific reverse transcription-PCR (RT-PCR) (fragments at positions 1711 to 1900) was performed by using methylation-specific primers (GTAGGTTTTGAAAGTTTTTTC and AATTTAATTCCCAAAACTAAT AATTTTAAT), and nonmethylation RT-PCR (positions 1711 to 1900) was performed by using primers GTAGGTTTTGAAAGTTTTTTCTT and AATTTAATTCCCAAAACTAATAATTTTAT. The control RT-PCR (positions 1691 to 1900) was performed by using primers ATGAATTAT TTTATTTTTAGGTAGGTTTTGAAAG and AATTTAATTCCCAAAAC TAATAATAATTTTAAT. Reporter gene assays. Transient transfection of U2OS cultures with the reporters was carried out by the use of Lipofectamine 2000 (Invitrogen). Cotransfection of pRL-CMV (cytomegalovirus) served as an internal control. Firefly and Renilla luciferase activities were measured with a double-luciferase assay system (Promega, Madison, WI) by following the instructions of the manufacturers. All firefly luciferase measurements were normalized to Renilla luciferase measurements from the same sample. Preparation of the polysomal fractions. Cells were incubated with cycloheximide (Sigma; 100 g/ml for 15 min), and cytoplasmic lysates (500 l) were prepared by centrifugation through 10% to 50% linear sucrose gradients and divided into 11 fractions for RT-qPCR analysis, as described previously (33).
December 2015 Volume 35 Number 23
In vitro translation assays. For in vitro translation assays, a cell-free translation system (Promega) in rabbit reticulocyte lysate (RL) was used. In vitro-transcribed pGL3, pGL3-CR, pGL3-3=UTR, or pGL3-3=UTR⌬ (0.01 nM) transcripts (described under “Preparation of transcripts” above) were either methylated by NSun2 or left untreated. The methylated and nonmethylated transcripts were used for in vitro translation assays. The translation efficiency was determined by measuring the activity of firefly luciferase.
RESULTS
NSun2 acts as a positive regulator of CDK1 expression. To test whether NSun2 regulates the expression of the factors controlling cell division cycle, we assessed the levels of cyclin A, cyclin B1, CDC25A, CDC25C, PCNA, CDK1, and GAPDH in U2OS cells in which NSun2 was overexpressed or silenced. As shown in Fig. 1A and B, transfection with the NSun2-expressing vector increased the levels of CDK1 by ⬃5.15-fold (P ⫽ 0.0329), while transfection with the NSun2 siRNA reduced the protein levels of CDK1 by ⬃77% (P ⫽ 0.0017). In agreement with previous findings, CDC25C protein levels increased moderately (by ⬃1.22-fold, P ⫽ 0.0168) in cells overexpressing NSun2 and decreased moderately (by ⬃27%, P ⫽ 0.0555) in cells with silenced NSun2. The levels of proteins cyclin A, cyclin B1, CDC25A, PCNA, and GAPDH re-
Molecular and Cellular Biology
mcb.asm.org
4047
Xing et al.
FIG 5 Cell cycle-dependent expression of NSun2 and CDK1. (A) U2OS cells were synchronized by serum starvation for 3 days or were left unsynchronized (Asyn.). Cells released from arrest by addition of 10% fetal bovine serum (FBS) at the times indicated were subjected to FACS analysis to monitor the cell cycle distribution. (B) Cell lysates prepared from the cells described for panel A were subjected to Western blot analysis to assess NSun2, CDK1, and GAPDH proteins. (C) RNA isolated from the cells described for panel A at times 0 and 18 h was subjected to bisulfate RNA sequencing to assess the methylation levels of endogenous CDK1 mRNA. Open boxes indicate cytosine-to-uracil conversion, read as thymidine levels in the cDNA (nonmethylated [Unmet.]), and filled boxes indicate a retained cytosine (methylated [Met.]). The numbers below the columns refer to cytosine positions in the CDK1 3=UTR.
mained unchanged in cells with silenced or overexpressed NSun2, supporting the notion that the regulation of CDK1 and CDC25C by NSun2 was specific. On the other hand, neither overexpression nor knockdown of NSun2 influenced the levels of CDK1 mRNA (Fig. 1C), suggesting that NSun2-regulated expression of CDK1 may not involve a change in CDK1 mRNA transcription or turnover. NSun2 regulates CDK1 expression by methylating the CDK1 3=UTR. NSun2-mediated mRNA methylation has been linked to the regulation of p16, p53, ErbB2, Bak1, and E2F3 (32, 34). To test whether NSun2 was capable of methylating CDK1 mRNA, in vitro-transcribed fragments of CDK1 mRNA (described in the Fig. 2A legend) and purified His-NSun2 were used for in vitro methylation assays. 3H incorporation into the CDK1 cDNA and 3H incorporation into the bacterial tRNA were included as a negative control and a positive control, respectively. As shown in Fig. 2B, 3 H incorporation into CDK1 mRNA fragments CR, CR-A, CR-B, CR-C, 3=UTR, and 3=UTR-C was significantly higher than that observed for 5=UTR, 3=UTR-A, 3=UTR-B, and cDNA (Fig. 2B). Therefore, NSun2 could methylate the CDK1 CR and 3=UTR. To test whether the methylation of CDK1 mRNA by NSun2 was functional, pGL3-derived reporters bearing the 5=UTR, CR, and 3=UTR of CDK1 mRNA were constructed. The activity of the reporters was tested in cells with silenced or overexpressed NSun2. As shown in Fig. 2C, after overexpression of NSun2, luciferase activity was higher from pGL3-3=UTR (by ⬃2.9-fold, P ⫽ 0.0014) but not from pGL3-5=UTR or pGL3-CR, while silencing NSun2 selectively decreased luciferase activity from pGL3-3=UTR (by
4048
mcb.asm.org
⬃52%, P ⫽ 0.0000) but not from other reporters. These results suggest that the CDK1 3=UTR, but not the CDK1 CR, is the target of regulation by NSun2. We next tested the presence of m6A or m5C in the in vitromethylated CR and 3=UTR fragments. As shown in Fig. 3A, m5C was detected from the in vitro-methylated CR and 3=UTR fragments, while m6A was not (data not shown), indicating that NSun2 methylated CDK1 mRNA at a cytosine (m5C). The CR fragment may contain multiple methylation sites, since CR-A, CR-B, and CR-C were methylated by NSun2 (Fig. 2B). Because methylation of 3=UTR but not CR was functional for the regulation of CDK1 by NSun2 (Fig. 2C), we further identified the methylation sites within the 3=UTR of CDK1 by using bisulfate RNA sequencing. As this method is more effective in identifying m5C in fragments shorter than 100 nt, we performed in vitro RNA methylation assays to assess the methylation of 3=UTR-Ca, 3=UTR-Cb, and 3=UTR-Cc (Fig. 3B, left panel, schematic). As shown, fragment 3=UTR-Cb, but not 3=UTR-Ca and 3=UTR-Cc, was methylated by NSun2 (Fig. 3B, right panel), indicating that the methylation site is located at positions 1721 to 1751. Therefore, we performed bisulfate RNA sequencing to identify the methylation sites within fragment 3=UTR-Cb. As shown in Fig. 3C, methylation at C1733 was detected in all of the positive clones (14/14, 100%), while methylation at C1757 or C1780 was detected in only 1 (7.1%) or 2 (14.3%) of 14 clones. To further confirm whether C1733 was the major methylation site, variants of 3=UTR or 3=UTR-C with a mutated C1733 (C-G) (3=UTR⌬ or 3=UTR-C⌬) were used in in vitro methylation assays. As shown in Fig. 3D,
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 6 The NSun2-CDK1 regulatory process impacts the cell division cycle. (A and B) U2OS cells were transfected with a siRNA targeting NSun2 (A) or with a vector expressing NSun2 (B). At 48 h later, cells were collected and subjected to FACS analysis to assess the cell cycle distribution. Data represent the means ⫾ SD of the results of 3 independent experiments. (C) U2OS cells transfected with a siRNA targeting NSun2 (left) or with a vector expressing NSun2 (right). After transfection, the cell numbers were determined by MTT assays at the times indicated. OD, optical density.
mutation of C1733 abolished the effect of NSun2 in methylating the CDK1 3=UTR and 3=UTR-C. Therefore, C1733 is the major methylation site in the CDK1 3=UTR. To further test if NSun2 could methylate CDK1 mRNA in cells, RNA isolated from U2OS cells in which NSun2 was either overexpressed or silenced was subjected to methylation-specific PCR to determine the methylation levels of C1733 in cells, as described in Materials and Methods. As shown in Fig. 3E, this method found C1733 in CDK1 3=UTR methylated in vitro (Fig. 3E, left panel); C1733 methylation levels increased in cells that overexpressed NSun2 (Fig. 3E, middle panel) and decreased in cells with silenced NSun2 (Fig. 3E, right panel). To test if methylation at C1733 influenced the expression of CDK1, a pGL3-derived reporter bearing the 3=UTR⌬ fragment (pGL3-3=UTR⌬) was constructed. The activity of pGL3-3=UTR⌬ in cells with silenced NSun2 or with overexpressed NSun2 was determined. As shown in Fig. 3F, mutation of C1733 attenuated the effect of NSun2 overexpression (left panel) or knockdown (right panel) in altering the activity of pGL3-3=UTR. In sum, NSun2 methylates CDK1 3=UTR at C1733 in vitro and in cells, and methylation by NSun2 enhances CDK1 production. Methylation by NSun2 enhances the expression of CDK1 at the translational level. Based on the findings indicating that altering NSun2 levels affected CDK1 protein levels without altering
December 2015 Volume 35 Number 23
CDK1 mRNA levels, we asked if NSun2-mediated mRNA methylation influenced the translation of CDK1. To this end, U2OS cells were transfected with a siRNA targeting NSun2 and a polysomal or nonpolysomal fraction was prepared. RNA isolated from the polysomal or nonpolysomal fraction was subjected to realtime qPCR to assess the levels of CDK1 mRNA. As shown, knockdown of NSun2 reduced the levels of CDK1 mRNA in the polysome, as evidenced by a leftward shift indicative of the presence of smaller polysomes (Fig. 4A, left panel). As a negative control, knockdown of NSun2 did not affect the relative levels of -actin mRNA in each fraction (Fig. 4A, right panel). To test if methylation by NSun2 influenced the translation of CDK1, in vitro-transcribed pGL3, pGL3-CR, pGL3-3=UTR, and pGL3-3=UTR⌬ were methylated by NSun2 (“Met”) or left untreated (“Non-met”). The methylated or unmethylated reporter transcripts were then used for in vitro translation assays using rabbit reticulocyte lysates, whereupon the luciferase activity was measured. As shown in Fig. 4B, methylation by NSun2 increased the activity of pGL3-3=UTR (by ⬃1.75-fold, P ⫽ 0.0000) but not that of pGL3, pGL3-CR or pGL3-3=UTR⌬. Therefore, methylation by NSun2 increased the presence of CDK1 mRNA in polysomes and thus enhanced CDK1 translation. Methylation of CDK1 mRNA increased in the S and G2/M phases. To explore the role of NSun2 in cell proliferation, we
Molecular and Cellular Biology
mcb.asm.org
4049
Xing et al.
FIG 7 Methylation of CDK1 3=UTR is required for the function of NSun2 in regulating CDK1 in the cell division cycle. (A) U2OS cells were transfected with a pGL3 or pGL3-3=UTR reporter vector. At 24 h later, cells were further transfected with a vector expressing NSun2 (pNSun2) or an empty vector (V) and cultured for an additional 48 h. The levels of NSun2, CDK1, luciferase, and GAPDH proteins were assessed by Western blotting (left). The fold increases in the level of the CDK1 3=UTR were determined by real-time qPCR (right). (B and C) The cells described for panel A were subjected to FACS analysis (B) and MTT assays (C) to assess cell cycle distribution and cell growth, respectively. Data represent the means ⫾ SD of the results of 3 independent experiments.
examined the levels of NSun2 protein throughout the cell division cycle. U2OS cells were subjected to a synchronization regimen consisting of culture growth for 3 days in serum-free medium that was remarkably enriched in the G1 compartment, from ⬃45% in asynchronous cells to ⬃70% after serum starvation. The synchronized cells were released from arrest by the addition of serum (10%), and the cell cycle progression was monitored by FACS analysis at the times indicated. As shown in Fig. 5A, after addition of the serum into the medium, U2OS cells were gradually released from arrest, with the highest G2/M levels seen in 18 to 24 h. We then analyzed the levels of NSun2, CDK1, and GAPDH in the cells described in the Fig. 5A legend. As shown in Fig. 5B, CDK1 protein levels were very low at 0 to 6 h and then increased gradually; both NSun2 protein levels and CDK1 protein levels peaked at 15 h after addition of the serum. As a negative control, the levels of GAPDH remained unchanged throughout the time analyzed. To test whether CDK1 mRNA methylation levels increased in the G2/M phase, RNA was prepared at 0 and 18 h after addition of the serum. The methylation levels of C1733 were determined by bisulfate RNA sequencing. Since the CDK1 mRNA levels of CDK1 fluctuated during the cell cycle, the methylation-specific RT-PCR method described in the Fig. 3E legend was not appropriate in this case. As shown, the methylation of C1733 was low in synchronous cells (⬃23%) but dramatically increased at 18 h after addition of the serum (⬃50%) (Fig. 5C). These results suggested that NSun2mediated CDK1 mRNA methylation is capable of contributing to the elevation of CDK1 in G2/M phase.
4050
mcb.asm.org
Impact of Nsun2-CDK1 regulation on the cell division cycle. Next, we addressed if regulation of CDK1 by NSun2 affected the cell division cycle. To this end, the cell cycle distribution of NSun2-overexpressing and NSun2-silenced U2OS cells was analyzed by FACS analysis. As shown in Fig. 6A and B, cells overexpressing NSun2 exhibited smaller S and G2/M compartments and a larger G1 compartment (Fig. 6A), whereas cells with silenced NSun2 displayed the opposite distribution of compartments (Fig. 6B). In addition, overexpression of NSun2 globally accelerated cell growth whereas NSun2 silencing slowed it down (Fig. 6C). To further confirm the impact of NSun2-CDK1 on the cell division cycle, U2OS cells were cotransfected with the pGL33=UTR or the pGL3 reporter vector together with a vector expressing NSun2 (pNSun2) or the empty vector (V). The expression of endogenous CDK1 and cell growth were evaluated. As shown in Fig. 7A, transfection of pGL3-3=UTR reporter vector increased the abundance of CDK1 3=UTR by ⬃700-fold (left panel). As a result, overexpression of the ectopic CDK1 3=UTR abolished the induction in CDK1 resulting from NSun2 overexpression (Fig. 7A, right panel). As anticipated, overexpression of ectopic CDK1 3=UTR abolished the effect of NSun2 overexpression as an inducer of cell cycle progression (Fig. 7B) and cell growth (Fig. 7C). In sum, the induction of CDK1 expression via methylation of CDK1 mRNA by NSun2 promotes cell cycle progression. DISCUSSION
In the present report, we describe evidence indicating that NSun2 regulates the translation of CDK1 by methylating the CDK1
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
3=UTR (Fig. 1 to 4). Through this mechanism, NSun2 promotes the entry of G2/M phase from S phase (Fig. 6). Given that ectopic expression of the CDK1 3=UTR fragment was able to antagonize the upregulation of CDK1 and enhanced cell division by NSun2 (Fig. 7), the NSun2-CDK1 regulatory axis contributes, at least in part, to the increased regulation of CDK1 in the cell division cycle. Although the underlying mechanisms are not fully clear, that fact that methylation by NSun2 influences the presence of CDK1 mRNA in the polysome suggests that methylation by NSun2 may regulate the initiation of translation (Fig. 4A). In addition to the CDK1 3=UTR, the CDK1 CR could also be methylated by NSun2 (Fig. 2B). However, methylation of CDK1 CR did not alter CDK1 expression levels (Fig. 2C). Therefore, whether or not mRNA methylation influences mRNA fate may depend on the location of the methylated site or on additional factors interacting with the mRNA. As mentioned, microRNAs miR-410, miR-650, miR-4903p, and miR-582-5p are also repressors of the translation of CDK1 (25–27). The relative impacts of NSun2 and CDK1 mRNA-targeting microRNAs upon CDK1 translation remain to be studied. NSun2 has been shown to upregulate the expression of p16, p53, E2F3, and ErbB2 by methylating the mRNAs that encode these cell cycle regulators (32, 34). NSun2-mediated methylation was also shown to repress the processing and function of miR125b, thereby relieving the miR-125b-mediated repression of p53, E2F3, CDC25C, and ErbB2 (34). While the regulation of p53 mRNA and p16 mRNA by NSun2 may not be responsible for the growth-promoting function of NSun2 (since p53 and p16 repress cell proliferation), it is plausible that NSun2 promotes cell proliferation through its regulation of ErbB2, E2F3, and CDC25C (28, 35, 36) in addition to CDK1. Methylation of the 3=UTR of mRNAs has been described since the late 1980s (36–38). Recently, studies have revealed that methylation of mRNA other than the 5=-cap structure is a common posttranscriptional modification (39). Methylation of tRNA by NSun2 stabilizes tRNA and enhances translation (30); methylation of mRNAs by NSun2 is also usually a positive regulator of gene expression (32, 34). The present report suggests that NSun2mediated CDK1 3=UTR methylation enhances the translation of CDK1 (Fig. 4). Although both the CR and the 3=UTR of CDK1 mRNA are methylated (Fig. 3A), methylation of CDK1 CR does not seem to influence the expression of CDK1 (Fig. 3F). Therefore, whether methylation is functional with respect to expression of a target gene may depend on the location of methylation. Apart from regulating the cell division cycle and cellular senescence, NSun2 may also be involved in other physiological and pathological processes. For examples, elevation of NSun2 levels has been observed in various human cancers (28, 40), and NSun2 is also required for differentiation of testes and skin stem cells (41, 42). Whether NSun2-regulated CDK1 production impacts directly upon cell division during these processes remains to be studied. ACKNOWLEDGMENTS This work was supported by grants 81230008, 81420108016, and 91339114 from the National Science Foundation of China and by grant B07001 (111 project) from the Ministry of Education of People’s Republic of China. We declare that we have no conflicts of interest.
December 2015 Volume 35 Number 23
REFERENCES 1. Malumbres M, Barbacid M. 2005. Mammalian cyclin-dependent kinases. Trends Biochem Sci 30:630 – 641. http://dx.doi.org/10.1016/j.tibs.2005.09 .005. 2. Malumbres M, Barbacid M. 2009. Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer 9:153–166. http://dx.doi.org/10.1038 /nrc2602. 3. Fisher D, Krasinska L, Coudreuse D, Novák B. 2012. Phosphorylation network dynamics in the control of cell cycle transitions. J Cell Sci 125(Pt 20):4703– 4711. http://dx.doi.org/10.1242/jcs.106351. 4. Shimada M, Niida H, Zineldeen DH, Tagami H, Tanaka M, Saito H, Nakanishi M. 2008. Chk1 is a histone H3 threonine 11 kinase that regulates DNA damage-induced transcriptional repression. Cell 132:221–232. http://dx.doi.org/10.1016/j.cell.2007.12.013. 5. Marais A, Ji Z, Child ES, Krause E, Mann DJ, Sharrocks AD. 2010. Cell cycle-dependent regulation of the forkhead transcription factor FOXK2 by CDK·cyclin complexes. J Biol Chem 285:35728 –35739. http://dx.doi .org/10.1074/jbc.M110.154005. 6. Yuan Z, Becker EB, Merlo P, Yamada T, DiBacco S, Konishi Y, Schaefer EM, Bonni A. 2008. Activation of FOXO1 by Cdk1 in cycling cells and postmitotic neurons. Science 319:1665–1668. http://dx.doi.org/10.1126 /science.1152337. 7. Reis T, Edgar BA. 2004. Negative regulation of dE2F1 by cyclindependent kinases controls cell cycle timing. Cell 117:253–264. http://dx .doi.org/10.1016/S0092-8674(04)00247-8. 8. Le Breton M, Cormier P, Bellé R, Mulner-Lorillon O, Morales J. 2005. Translational control during mitosis. Biochimie 87:805– 811. http://dx .doi.org/10.1016/j.biochi.2005.04.014. 9. Chen S, Bohrer LR, Rai AN, Pan Y, Gan L, Zhou X, Bagchi A, Simon JA, Huang H. 2010. Cyclin-dependent kinases regulate epigenetic gene silencing through phosphorylation of EZH2. Nat Cell Biol 12:1108 –1114. http://dx.doi.org/10.1038/ncb2116. 10. Li S, Makovets S, Matsuguchi T, Blethrow JD, Shokat KM, Blackburn EH. 2009. Cdk1-dependent phosphorylation of Cdc13 coordinates telomere elongation during cell-cycle progression. Cell 136:50 – 61. http://dx .doi.org/10.1016/j.cell.2008.11.027. 11. Takizawa CG, Morgan DO. 2000. Control of mitosis by changes in the subcellular location of cyclin-B1-Cdk1 and Cdc25C. Curr Opin Cell Biol 12:658 – 665. http://dx.doi.org/10.1016/S0955-0674(00)00149-6. 12. Larochelle S, Merrick KA, Terret ME, Wohlbold L, Barboza NM, Zhang C, Shokat KM, Jallepalli PV, Fisher RP. 2007. Requirements for Cdk7 in the assembly of Cdk1/cyclin B and activation of Cdk2 revealed by chemical genetics in human cells. Mol Cell 25:839 – 850. http://dx.doi.org/10.1016 /j.molcel.2007.02.003. 13. Lolli G, Johnson LN. 2005. CAK— cyclin-dependent activating kinase: a key kinase in cell cycle control and a target for drugs? Cell Cycle 4:572–577. 14. Ferrari, S. 2006. Protein kinases controlling the onset of mitosis. Cell Mol Life Sci 63:781–795. http://dx.doi.org/10.1007/s00018-005-5515-3. 15. Timofeev O, Cizmecioglu O, Settele F, Kempf T, Hoffmann I. 2010. Cdc25 phosphatases are required for timely assembly of CDK1-cyclin B at the G2/M transition. J Biol Chem 285:16978 –16990. http://dx.doi.org/10 .1074/jbc.M109.096552. 16. Coulonval K, Kooken H, Roger PP. 2011. Coupling of T161 and T14 phosphorylations protects cyclin B-CDK1 from premature activation. Mol Biol Cell 22:3971–3985. http://dx.doi.org/10.1091/mbc.E11-02-0136. 17. Harvey SL, Charlet A, Haas W, Gygi SP, Kellogg DR. 2005. Cdk1dependent regulation of the mitotic inhibitor Wee1. Cell 122:407– 420. http://dx.doi.org/10.1016/j.cell.2005.05.029. 18. Jin Z, Homola EM, Goldbach P, Choi Y, Brill JA, Campbell SD. 2005. Drosophila Myt1 is a Cdk1 inhibitory kinase that regulates multiple aspects of cell cycle behavior during gametogenesis. Development 132: 4075– 4085. http://dx.doi.org/10.1242/dev.01965. 19. Krasinska L, Domingo-Sananes MR, Kapuy O, Parisis N, Harker B, Moorhead G, Rossignol M, Novák B, Fisher D. 2011. Protein phosphatase 2A controls the order and dynamics of cell-cycle transitions. Mol Cell 44:437– 450. http://dx.doi.org/10.1016/j.molcel.2011.10.007. 20. Nebreda AR. 2006. CDK activation by non-cyclin proteins. Curr Opin Cell Biol 18:192–198. http://dx.doi.org/10.1016/j.ceb.2006.01.001. 21. Kao CY, Tanimoto A, Arima N, Sasaguri Y, Padmanabhan R. 1999. Transactivation of the human cdc2 promoter by adenovirus E1A. E1A induces the expression and assembly of a heteromeric complex consisting
Molecular and Cellular Biology
mcb.asm.org
4051
Xing et al.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
of the CCAAT box binding factor, CBF/NF-Y, and a 110-kDa DNAbinding protein. J Biol Chem 274:23043–23051. Badie C, Itzhaki JE, Sullivan MJ, Carpenter AJ, Porter AC. 2000. Repression of CDK1 and other genes with CDE and CHR promoter elements during DNA damage-induced G(2)/M arrest in human cells. Mol Cell Biol 20:2358 –2366. http://dx.doi.org/10.1128/MCB.20.7.2358-2366 .2000. Marash L, Liberman N, Henis-Korenblit S, Sivan G, Reem E, ElroyStein O, Kimchi A. 2008. DAP5 promotes cap-independent translation of Bcl-2 and CDK1 to facilitate cell survival during mitosis. Mol Cell 30:447– 459. http://dx.doi.org/10.1016/j.molcel.2008.03.018. Liberman N, Marash L, Kimchi A. 2009. The translation initiation factor DAP5 is a regulator of cell survival during mitosis. Cell Cycle 8:204 –209. http://dx.doi.org/10.4161/cc.8.2.7384. Chien WW, Domenech C, Catallo R, Kaddar T, Magaud JP, Salles G, Ffrench M. 2011. Cyclin-dependent kinase 1 expression is inhibited by p16(INK4a) at the post-transcriptional level through the microRNA pathway. Oncogene 30:1880 –1891. http://dx.doi.org/10.1038/onc.2010.570. Chen S, Chen X, Xiu YL, Sun KX, Zhao Y. 2015. MicroRNA-490-3P targets CDK1 and inhibits ovarian epithelial carcinoma tumorigenesis and progression. Cancer Lett 362:122–130. http://dx.doi.org/10.1016/j.canlet .2015.03.029. Zhang Y, Huang W, Ran Y, Xiong Y, Zhong Z, Fan X, Wang Z, Ye Q. 23 May 2015, posting date. miR-582-5p inhibits proliferation of hepatocellular carcinoma by targeting CDK1 and AKT3. Tumour Biol http://dx .doi.org/10.1007/s13277-015-3582-0. Frye M, Watt FM. 2006. The RNA methyltransferase Misu (NSun2) mediates Myc-induced proliferation and is upregulated in tumors. Curr Biol 16:971–981. http://dx.doi.org/10.1016/j.cub.2006.04.027. Sakita-Suto S, Kanda A, Suzuki F, Sato S, Takata T, Tatsuka M. 2007. Aurora-B regulates RNA methyltransferase NSUN2. Mol Biol Cell 18: 1107–1117. http://dx.doi.org/10.1091/mbc.E06-11-1021. Tuorto F, Liebers R, Musch T, Schaefer M, Hofmann S, Kellner S, Frye M, Helm M, Stoecklin G, Lyko F. 2012. RNA cytosine methylation by Dnmt2 and NSun2 promotes tRNA stability and protein synthesis. Nat Struct Mol Biol 19:900 –905. http://dx.doi.org/10.1038/nsmb.2357. Ma L, Chang N, Guo S, Zhang Z, Wang W, Tong T. 2008. CSIG regulates PTEN translation in replicative senescence. Mol Cell Biol 28: 6290 – 6301. http://dx.doi.org/10.1128/MCB.00142-08. Zhang X, Liu Z, Yi J, Tang H, Xing J, Yu M, Tong T, Shang Y, Gorospe M, Wang W. 2012. NSun2 stabilizes p16INK4 mRNA by methylating the
4052
mcb.asm.org
33.
34.
35.
36. 37. 38. 39.
40.
41.
42.
3=-untranslated region of p16. Nat Commun 3:712. http://dx.doi.org/10 .1038/ncomms1692. Abdelmohsen K, Srikantan S, Kuwano Y, Gorospe M. 2008. miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Proc Natl Acad Sci U S A 105:20297–20302. http://dx.doi.org/10.1073 /pnas.0809376106. Yuan S, Tang H, Xing J, Fan X, Cai X, Li Q, Han P, Luo Y, Zhang Z, Jiang B, Dou Y, Gorospe M, Wang W. 2014. Methylation by NSun2 represses the levels and function of miR-125b. Mol Cell Biol 34:3630 – 3641. http://dx.doi.org/10.1128/MCB.00243-14. Di Fiore PP, Segatto O, Taylor WG, Aaronson SA, Pierce JH. 1990. EGF receptor and erbB-2 tyrosine kinase domains confer cell specificity for mitogenic signaling. Science 248:79 – 83. http://dx.doi.org/10.1126/science .2181668. DeGregori J, Leone G, Miron A, Jakoi L, Nevins JR. 1997. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A 94:7245–7250. http://dx.doi.org/10.1073/pnas.94.14.7245. Narayan P, Rottman FM. 1988. An in vitro system for accurate methylation of internal adenosine residues in messenger RNA. Science 242: 1159 –1162. http://dx.doi.org/10.1126/science.3187541. Carroll SM, Narayan P, Rottman FM. 1990. N6-methyladenosine residues in an intron-specific region of prolactin pre-mRNA. Mol Cell Biol 10:4456 – 4465. Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G. 2012. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485:201–206. http://dx .doi.org/10.1038/nature11112. Okamoto M, Hirata S, Sato S, Koga S, Fujii M, Qi G, Ogawa I, Takata T, Shimamoto F, Tatsuka M. 2012. Frequent increased gene copy number and high protein expression of tRNA (cytosine-5-)-methyltransferase (NSUN2) in human cancers. DNA Cell Biol 31:660 – 671. http://dx.doi .org/10.1089/dna.2011.1446. Blanco S, Kurowski A, Nichols J, Watt FM, Benitah SA, Frye M. 2011. The RNA-methyltransferase Misu NSun2 poises epidermal stem cells to differentiate. PLoS Genet 7:e1002403. http://dx.doi.org/10.1371/journal .pgen.1002403. Hussain S, Tuorto F, Menon S, Blanco S, Cox C, Flores JV, Watt S, Kudo NR, Lyko F, Frye M. 2013. The mouse cytosine-5 RNA methyltransferase NSun2 is a component of the chromatoid body and required for testis differentiation. Mol Cell Biol 33:1561–1570. http://dx.doi.org/10 .1128/MCB.01523-12.
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while overexpression of NSun2 elevated it without altering CDK1 mRNA levels. Further studies revealed that NSun2 methylated CDK1 mRNA in vitro and in cells and that methylation by NSun2 enhanced CDK1 translation. Importantly, NSun2-mediated regulation of CDK1 expression had an impact on the cell division cycle. These results provide new insight into the regulation of CDK1 during the cell division cycle.
T
he mammalian cell division cycle is orchestrated by the timely activation and inactivation of cyclin-dependent kinases (CDKs). Among the major CDKs, CDK1 (also known as CDC2) plays a central role in the entry into and progression through mitosis (1, 2). Once activated, CDK1 phosphorylates various substrates controlling G2 and early mitosis and thereby promotes progression through the cell division cycle (1–3). Besides regulating the cell cycle, CDK1-mediated protein phosphorylation is also implicated in controlling transcription (4–7), translation (8), epigenetic events (9), and telomere maintenance (10). The activity of CDK1 is regulated by multiple cell cycle regulatory factors. It is well known that CDK1 activity is controlled by protein-protein interactions. For example, interaction of CDK1 with positive regulators, including cyclin A or cyclin B1, activates CDK1, while interaction of CDK1 with negative regulators, including CDK inhibitors (CKIs) p27KIP1 and p21CIP1, inhibits CDK1 activity (2, 11, 12). Both cyclins and CKIs are periodically synthesized and degraded during the cell cycle, regulating the activity of CDK1. However, the interaction with cyclins is not sufficient for the full activation of CDK1; instead, CDK1 activity is also regulated by phosphorylation. The CDK-activating kinase (CAK) phosphorylates CDK1 at T161 and activates it (13–15), while Wee1 and Myt1 inhibit CDK1 activity by phosphorylating CDK1 at T14 and T15 (16–18). Protein phosphatases are also important for CDK1 activity: CDC25C dephosphorylates the T14 and T15 phosphorylation, thereby activating CDK1, while PP2A counteracts CDK1 by dephosphorylating Wee1 and CDC25 (19). Interestingly, the RINGO/Speedy family of proteins, which were originally identified as regulators of meiotic cell cycle in Xenopus oocytes and lack sequence similarity to cyclins, can activate CDK1 by directly binding to CDK1 (20). In keeping with the fact that CDK1 levels fluctuate during the cell cycle, the expression of CDK1 is also tightly regulated during the cell division cycle. The adenovirus EIA protein mediates the transcriptional activation of CDK1 by inducing the expression and assembly of the complex formed by CBF/NY-F and a 110-kDa protein, which in turn interacts with the CCAAT motifs of the CDK1 promoter and activates CDK1 transcription (21). The p53 transcription factor may repress the transcription of CDK1
December 2015 Volume 35 Number 23
through binding to the cis-acting elements (CDE and CHR) located in the CDK1 promoter (22). In addition, the expression of CDK1 is also regulated at posttranscriptional levels. For example, DAP5 protein, which is an eIF4G family member, has been found to target the internal ribosome entry site (IRES) located in the 5= untranslated region (5=UTR) of CDK1 mRNA and regulates the translation of CDK1 (23, 24). Recently, microRNA 410 (miR410), miR-650, miR-490-3p, and miR-582-5p were found to interact with the 3=UTR of CDK1 mRNA, repressing the translation of CDK1 (25–27). The p16INK4 CDK4/6 inhibitor could repress the translation of CDK1 by inducing expression of miR-410 and miR-650 (25). The tRNA methyltransferase NSun2 (Misu) mediates Myc-induced cell proliferation. The levels of expression of NSun2 differ throughout the cell cycle, displaying the lowest expression in G1 phase and the highest in S phase (27). Phosphorylation of NSun2 at Ser-139 by Aurora-B inhibits the association of NSun2 with nucleolar protein NPM1 and activates NSun2 in mitotic cells (28). tRNA has been described as a key substrate of NSun2 (29, 30), and methylation of tRNA by NSun2 stabilizes tRNA and promotes protein synthesis (30). However, whether NSun2 regulates cell cycle progression by regulating specific cell cycle regulators remains to be studied. In the present study, we demonstrated a role for NSun2 in regulating CDK1 expression and cell cycle progression. By methylating the CDK1 mRNA at the 3=UTR, NSun2 enhances the
Received 29 July 2015 Returned for modification 5 September 2015 Accepted 14 September 2015 Accepted manuscript posted online 21 September 2015 Citation Xing J, Yi J, Cai X, Tang H, Liu Z, Zhang X, Martindale JL, Yang X, Jiang B, Gorospe M, Wang W. 2015. NSun2 promotes cell growth via elevating cyclindependent kinase 1 translation. Mol Cell Biol 35:4043–4052. doi:10.1128/MCB.00742-15. Address correspondence to Wengong Wang, [email protected]. J.X. and J.Y. contributed equally to this article. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Molecular and Cellular Biology
mcb.asm.org
4043
Xing et al.
FIG 1 NSun2 regulates CDK1 expression without influencing CDK1 mRNA levels. (A) At 48 h after transfection of HeLa cells with a vector expressing NSun2 (pNSun2) or with a siRNA targeting NSun2 (shSun2), lysates were prepared to assess the levels of NSun2, cyclin A, cyclin B1, PCNA, CDK1, CDC25A, CDC25C, and GAPDH by Western blotting. Ctrl., control. (B) The protein levels of CDK1 and CDC25C were quantified by densitometry and are represented as means ⫾ standard deviations (SD) of the results of 3 independent experiments; statistical significance is indicated. V, vector. (C) RNA isolated from the cells described for panel A was subjected to real-time qPCR analysis (normalized to GAPDH mRNA) to assess the levels of CDK1 mRNA. The real-time qPCR data are represented as the means ⫾ SEM of the results of 3 independent experiments.
translation of CDK1, thereby influencing entry into and the progression of the cell division cycle. Our results reveal a novel regulatory mechanism by which the cell cycle is regulated. MATERIALS AND METHODS Cell culture, synchronization, MTT assays, and FACS analysis. U2OS cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum and antibiotics at 37°C in 5% CO2. For synchronization studies, U2OS cultures were maintained in serum-free medium for 2 days and then released by serum addition; using this synchronization protocol, the G1-phase compartment, which generally constitutes 40% to 45% of the total population, was considerably enriched, reaching ⬎70%. MTT (methyl thiazolyldiphenyl-tetrazolium bromide) assays and fluorescence-activated cell sorter (FACS) analysis were performed as described previously (31). Antibodies and Western blot analysis. Western blot analysis was performed using standard procedures. Polyclonal anti-cyclin A, polyclonal anti-cyclin B1, polyclonal anti-PCNA, polyclonal anti-NSun2, and monoclonal anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase) were from Abcam. Monoclonal anti-CDK1, monoclonal antiCDC25A, and monoclonal anti-CDC25C were from Santa Cruz Biotechnology. RNA isolation and real-time qPCR. Total cellular RNA was prepared using an RNeasy minikit (Qiagen). For real-time quantitative PCR (qPCR) analysis of CDK1 mRNA, we used the following primer pair: AA ATGTGTGTAGGTCTCAC and ATGATTTAAGCCAACTCAAA. Transfections and RNA interference. All plasmid transfections were performed using Lipofectamine 2000 (Invitrogen). Unless otherwise indicated, cells were analyzed 48 h after transfection. To silence NSun2
4044
mcb.asm.org
transiently, cells were transfected with a small interfering RNA (siRNA) targeting NSun2 (GAGATCCTCTTCTATGATC) using Oligofectamine (Invitrogen). Constructs. pGL3-5=UTR, pGL3-CR (pGL3-coding region), pGL33=UTR, and pGL3-3=UTR⌬ was constructed by inserting the 5=UTR, CR, 3=UTR, and 3=UTR⌬ fragments of CDK1 into the pGL3-promoter vector (V) (Promega). The 5=UTR was amplified by PCR using primers CCCAA GCTTAGCGCGGTGAGTTTGAAACT and CCCAAGCTTATTTTCTC TATTTTGGTATAA and inserted into the HindIII site, the CR was amplified using primers GGACTAGTCCTACCTATGGAGTTGTGTATA and GGACTAGTCCTGATTGTCCAAATCATTAAA and inserted into the XbaI site, and the 3=UTR or 3=UTR⌬ was amplified by using primers GCTCTAGAGCGATTAAGAAGATGTAGCTTTCTGAC and GCTCTA GAGCAGTTTAATTCCCAAAGCTAG and inserted into the SpeI site. The pcDNA 3.1 vector and pET-28a(⫹) vector expressing NSun2 in cells (pcDNA 3.1) and bacteria [pET-28a(⫹)] were described previously (32). Preparation of transcripts. cDNA was used as a template for PCR amplification of RNA fragments of CDK1. All 5= primers contained the T7 promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA). To prepare templates for the 5=UTR (positions 1 to 143), CR (coding region; positions 143 to 1036), UR (5=UTR plus the CR; positions 1 to 1036), CR-A (positions 143 to 520), CR-B (positions 503 to 769), CR-C (positions 752 to 1036), 3=UTR (positions 1037 to 1900), 3=UTR-A (positions 1021 to 1320), 3=UTR-B (positions 1291 to 1660), 3=UTR-C (positions 1621 to 1900), 3=UTR-Ca (positions 1621 to 1720), 3=UTR-Cb (positions 1721 to 1830), and 3=UTR-Cc (positions 1751 to 1900), we used the following primer pairs: (T7)AGCGCGGTGAGTTTGAAACT and AT TTTCTCTATTTTGGTATAA for 5=UTR, (T7)TACCTATGGAGTTGTG TATA and TGATTGTCCAAATCATTAAA for CR, (T7)ATGGAAGATT
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 2 NSun2 methylates the CDK1 CR and 3=UTR. (A) Schematic presentation of the fragments of CDK1 mRNA used for in vitro methylation assays. (B) Incorporation of 3H-labeled SAM into CDK1 fragments 5=UTR, CR, CR-A, CR-B, CR-C, 3=UTR, 3=UTR-A, 3=UTR-B, and 3=UTR-C. The incorporation of 3 H-labeled SAM into CDK1 cDNA and the p16 3=UTR served as a negative control and a positive control, respectively. CPM, counts per minute. (C) U2OS cells were transfected with the pGL3 reporter vector or with the pGL3 reporter bearing the CDK1 5=UTR (pGL3-5=UTR), the CDK1 CR (pGL3-CR), or the CDK1 3=UTR (pGL3-3=UTR) plus the pRL-CMV control reporter. At 24 h later, cells were further transfected with a vector expressing NSun2 or with an NSun2 siRNA and cultured for an additional 48 h. Firefly luciferase activity relative to Renilla luciferase activity was analyzed. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test. ATACCAAAAT and GTGAAGAACTCTTCTAGAGTGACAAAACACA ATCCCCTGTAGGATTTGGTATAAATAAC for CR-A, (T7)CTAGAAG AGTTCTTCAC and TTCTGAATCCCCATGGAAAAGTGGTTTCTTAG TTGCTAGTTCAGCAAAT for CR-B, (T7)TTCCATGGGGATTCAG AAAT and CTACATCTTCTTAATCTGATTGTCCAAATCATTAAAAT ATGGATGATTCAGTGCCAT for CR-C, (T7)AGCGCGGTGAGTTTGA AACT and TGATTGTCCAAATCATTAAA for UR, (T7)GATTAAGAAG ATGTAGCTTTCTGAC and AGTTTAATTCCCAAAGCTAG for 3=UTR, (T7)GATTAAGAAGATGTAGCTTTCTGAC and ATGATTTAAGCCAA CTCAAA for 3=UTR-A, (T7)CAGGAAAAAATTTGAGTTGG and GAC AGCCCTTGATCTTTGTA for 3=UTR-B, (T7)TGCCAAAATTTGCTAA GTCT and AGTTTAATTCCCAAAGCTAG for 3=UTR-C, (T7)TGCCAA AATTTGCTAAGTCT and CAAAACCTACCTAAAAATAAGATATTCA TAAATTTTCAAAACTGTTCTT for 3=UTR-Ca, (T7)AAAGCTTTTTGT CTAAGTGAATTC and CACTATGTCAAAATGTGTAGTTTTAAACTC AGACTCGAAAGCCAAGATAAG for 3=UTR-Cb, and (T7)CTTGTCAG AGGTAATAACTG and TATTTGTTAAACAGTTTAATTCCCAAAGCT AGTAATTTTAGTTAAATATACA for 3=UTR-Cc. The mutants of 3=UTR (3=UTR⌬; C1733 to G1733) and 3=UTR-C (3=UTR-C⌬; C1733 to G1733) were generated by overlapping PCR. The p16 3=UTR fragment was described previously (32).
December 2015 Volume 35 Number 23
For preparing the luciferase, luciferase-CR, and luciferase-3=UTR transcripts used for in vitro translation assays, we used following primers: CCAAGCTTCTAATACGACTCACTATAGGGAGAATGGAAGACGCC AAAAACAT and TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACACGG CGATCTTTCCGCCCT for luciferase, CCAAGCTTCTAATACGACTCA CTATAGGGAGAATGGAAGACGCCAAAAACAT and TTTTTTTTTTT TTTTTTTTTTTTTTTTTTTCTACATCTTCTTAATCTGATTGTCCA for luciferase-CR, and CCAAGCTTCTAATACGACTCACTATAGGGAGAAT GGAAGACGCCAAAAACAT and TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTATTTGTTCCCAAAGC for luciferase-3=UTR. In vitro methylation assays. For in vitro methyltransferase assays, His-tagged NSun2 was expressed in Escherichia coli and purified using nickel-nitrilotriacetic acid (Ni-NTA)–agarose (Qiagen) following the manufacturer’s instructions. Reaction mixtures (50 l) containing 0.2 nM His-NSun2, 0.01 nM in vitro-transcribed fragments of mRNA, and 1 Ci of 3H-labeled S-adenosyl-L-methionine (SAM; Amersham Bioscience) in reaction buffer (5 mM Tris HCl [pH 7.5], 5 mM EDTA, 10% glycerol, 1.5 mM dithiothreitol, 5 mM MgCl2) supplemented with inhibitors (leupeptin [1 g/ml], aprotinin [1 g/ml], 0.5 mM phenylmethylsulfonyl fluoride, and RNasin [5 U/l]) were incubated for 60 min at
Molecular and Cellular Biology
mcb.asm.org
4045
Xing et al.
FIG 3 NSun2 regulates CDK1 expression by methylating the CDK1 3=UTR. (A) The CDK1 CR and 3=UTR fragments were methylated in vitro by NSun2 using nonisotopic SAM. The fragments were then subjected to MS-HPLC analysis to assess the presence of m5C, as described in Materials and Methods. (B) Fragments 3=UTR-C, 3=UTR-Ca, 3=UTR-Cb, and 3=UTR-Cc (left, schematic) were used for in vitro methylation assays (right). (C) Fragment 3=UTR-Cb was methylated in vitro using NSun2 and nonisotopic SAM and subjected to bisulfate RNA sequencing analysis to identify the methylation site (m5C). The proportions of methylation at C1733, C1757, and C1780 are indicated. (D) Fragment 3=UTR or 3=UTR-C mutating C1733 (C-G) (3=UTR⌬ or 3=UTR-C⌬) was used for in vitro methylation assays as described in the Fig. 2B legend. (E) In vitro-methylated CDK1 3=UTR was subjected to methylation-specific RT-PCR to assess the levels of methylated and unmethylated 3=UTR fragments (left), as described in Materials and Methods. The levels of total 3=UTR served as a loading control. RNA isolated from U2OS cells in which NSun2 was overexpressed or silenced was subjected to methylation-specific RT-PCR to assess the levels of methylated or unmethylated CKD1 mRNA (right). The levels of total CDK1 mRNA served as loading controls. (F) U2OS cells were transfected with pGL3-derived reporters bearing the 3=UTR (pGL3-3=UTR) or the 3=UTR mutating C1733 (pGL3-3=UTR⌬) together with a pRL-CMV control reporter. At 24 h later, cells were further transfected with a vector expressing NSun2 or with an NSun2 siRNA and cultured for an additional 48 h. Firefly luciferase activity was assayed relative to Renilla luciferase activity. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test.
37°C. E. coli tRNA (Sigma) (0.01 nM) and unmethylated DNA (CDK1 cDNA; 0.01 nM) were used as positive and negative controls, respectively. Unincorporated [3H]SAM was removed by using Microspin G25 columns, and the radioactivity associated with incorporation was measured by liquid scintillation counting. Nonisotopic methylated fragment B was prepared using cold SAM (Sigma) under the same conditions. LC-MS analysis. In vitro-methylated RNA fragments (1 g) were digested by the use of nuclease P1 (sigma) and alkaline phosphatase (Promega). The formation of m5C or m6A was analyzed by mass spectrometry– high-performance liquid chromatography (MS-HPLC) analysis at Tsinghua University Mass Spectrum Center (Beijing, China). Bisulfate RNA sequencing. This method can identify the methylation site (m5C) within a RNA fragment shorter than 100 nucleotides (⬍100 nt). Briefly, a 3=UTR fragment (positions 1701 to 1800) which was methylated by NSun2 was amplified by using primers (T7)TTATTTTTAGGT AGGTTTTG and CCTCCATTCCCAACAAACAGACTCGAAAGCCAA GATAAGCAAC. This fragment (1 g) was in vitro transcribed and
4046
mcb.asm.org
methylated by using nonisotopic SAM. Samples were then dissolved in 10 l of RNase-free water, mixed with 42.5 l of 5 M sodium bisulfate (Epitect) and 17.5 l of DNA protection buffer (Epitect), and incubated in 70°C for 5 min and 60°C for 60 min, repeating for 3 to 5 cycles. After desalting was performed by the use of Micro Bio-spin6 columns, samples were desulfonated by 1 M Tris (pH 9.0; 1/1 [vol/vol]) at 37°C for 1 h, followed by ethanol precipitation. The bisulfate-converted fragments (0.2 g) were reverse transcribed by the use of a RevertAid First Strand cDNA synthesis kit (Thermo) and primer GTCGTATCCAGTGCAG GGTCCGAGGTATTCGCACTGGATACGACCCTCCATTCCCAACA AAC. The reverse-transcribed products (cDNAs) were amplified by PCR by using primers GGGAGATTATTTTTAGGTAGGTTTT and GCAGGGTCCGAGGTATTC. The PCR products were inserted into a pGEM-T Easy Vector system (Promega). The plasmids purified from single clones were sequenced. The sequences were aligned with the corresponding CDK1 mRNA sequence, and the maintained cytosines were considered the sites to be methylated.
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 4 Methylation by NSun2 enhances the translation of CDK1. (A) U2OS cells were transfected with a siRNA targeting NSun2. At 48 h later, polysomes were fractionated by centrifugation through sucrose gradients and RNA was prepared from each of 11 fractions for analysis of the distribution of CDK1 and -actin mRNAs. (B) In vitro-methylated (Met.) or unmethylated (Non-met.) linear pGL3, pGL3-CR, pGL3-3=UTR, and pGL3-3=UTR⌬ reporter transcripts were used for in vitro translation assays. Firefly luciferase activity was measured to reflect the translation efficiency. Data represent the means ⫾ SEM of the results of 3 independent experiments; significance was analyzed by Student’s t test.
Methylation-specific RT-PCR. A 2-g volume of cellular RNA or 1 g of in vitro-methylated RNA fragment was subjected to bisulfate conversion as described under “Bisulfate RNA sequencing” above. Methylation-specific reverse transcription-PCR (RT-PCR) (fragments at positions 1711 to 1900) was performed by using methylation-specific primers (GTAGGTTTTGAAAGTTTTTTC and AATTTAATTCCCAAAACTAAT AATTTTAAT), and nonmethylation RT-PCR (positions 1711 to 1900) was performed by using primers GTAGGTTTTGAAAGTTTTTTCTT and AATTTAATTCCCAAAACTAATAATTTTAT. The control RT-PCR (positions 1691 to 1900) was performed by using primers ATGAATTAT TTTATTTTTAGGTAGGTTTTGAAAG and AATTTAATTCCCAAAAC TAATAATAATTTTAAT. Reporter gene assays. Transient transfection of U2OS cultures with the reporters was carried out by the use of Lipofectamine 2000 (Invitrogen). Cotransfection of pRL-CMV (cytomegalovirus) served as an internal control. Firefly and Renilla luciferase activities were measured with a double-luciferase assay system (Promega, Madison, WI) by following the instructions of the manufacturers. All firefly luciferase measurements were normalized to Renilla luciferase measurements from the same sample. Preparation of the polysomal fractions. Cells were incubated with cycloheximide (Sigma; 100 g/ml for 15 min), and cytoplasmic lysates (500 l) were prepared by centrifugation through 10% to 50% linear sucrose gradients and divided into 11 fractions for RT-qPCR analysis, as described previously (33).
December 2015 Volume 35 Number 23
In vitro translation assays. For in vitro translation assays, a cell-free translation system (Promega) in rabbit reticulocyte lysate (RL) was used. In vitro-transcribed pGL3, pGL3-CR, pGL3-3=UTR, or pGL3-3=UTR⌬ (0.01 nM) transcripts (described under “Preparation of transcripts” above) were either methylated by NSun2 or left untreated. The methylated and nonmethylated transcripts were used for in vitro translation assays. The translation efficiency was determined by measuring the activity of firefly luciferase.
RESULTS
NSun2 acts as a positive regulator of CDK1 expression. To test whether NSun2 regulates the expression of the factors controlling cell division cycle, we assessed the levels of cyclin A, cyclin B1, CDC25A, CDC25C, PCNA, CDK1, and GAPDH in U2OS cells in which NSun2 was overexpressed or silenced. As shown in Fig. 1A and B, transfection with the NSun2-expressing vector increased the levels of CDK1 by ⬃5.15-fold (P ⫽ 0.0329), while transfection with the NSun2 siRNA reduced the protein levels of CDK1 by ⬃77% (P ⫽ 0.0017). In agreement with previous findings, CDC25C protein levels increased moderately (by ⬃1.22-fold, P ⫽ 0.0168) in cells overexpressing NSun2 and decreased moderately (by ⬃27%, P ⫽ 0.0555) in cells with silenced NSun2. The levels of proteins cyclin A, cyclin B1, CDC25A, PCNA, and GAPDH re-
Molecular and Cellular Biology
mcb.asm.org
4047
Xing et al.
FIG 5 Cell cycle-dependent expression of NSun2 and CDK1. (A) U2OS cells were synchronized by serum starvation for 3 days or were left unsynchronized (Asyn.). Cells released from arrest by addition of 10% fetal bovine serum (FBS) at the times indicated were subjected to FACS analysis to monitor the cell cycle distribution. (B) Cell lysates prepared from the cells described for panel A were subjected to Western blot analysis to assess NSun2, CDK1, and GAPDH proteins. (C) RNA isolated from the cells described for panel A at times 0 and 18 h was subjected to bisulfate RNA sequencing to assess the methylation levels of endogenous CDK1 mRNA. Open boxes indicate cytosine-to-uracil conversion, read as thymidine levels in the cDNA (nonmethylated [Unmet.]), and filled boxes indicate a retained cytosine (methylated [Met.]). The numbers below the columns refer to cytosine positions in the CDK1 3=UTR.
mained unchanged in cells with silenced or overexpressed NSun2, supporting the notion that the regulation of CDK1 and CDC25C by NSun2 was specific. On the other hand, neither overexpression nor knockdown of NSun2 influenced the levels of CDK1 mRNA (Fig. 1C), suggesting that NSun2-regulated expression of CDK1 may not involve a change in CDK1 mRNA transcription or turnover. NSun2 regulates CDK1 expression by methylating the CDK1 3=UTR. NSun2-mediated mRNA methylation has been linked to the regulation of p16, p53, ErbB2, Bak1, and E2F3 (32, 34). To test whether NSun2 was capable of methylating CDK1 mRNA, in vitro-transcribed fragments of CDK1 mRNA (described in the Fig. 2A legend) and purified His-NSun2 were used for in vitro methylation assays. 3H incorporation into the CDK1 cDNA and 3H incorporation into the bacterial tRNA were included as a negative control and a positive control, respectively. As shown in Fig. 2B, 3 H incorporation into CDK1 mRNA fragments CR, CR-A, CR-B, CR-C, 3=UTR, and 3=UTR-C was significantly higher than that observed for 5=UTR, 3=UTR-A, 3=UTR-B, and cDNA (Fig. 2B). Therefore, NSun2 could methylate the CDK1 CR and 3=UTR. To test whether the methylation of CDK1 mRNA by NSun2 was functional, pGL3-derived reporters bearing the 5=UTR, CR, and 3=UTR of CDK1 mRNA were constructed. The activity of the reporters was tested in cells with silenced or overexpressed NSun2. As shown in Fig. 2C, after overexpression of NSun2, luciferase activity was higher from pGL3-3=UTR (by ⬃2.9-fold, P ⫽ 0.0014) but not from pGL3-5=UTR or pGL3-CR, while silencing NSun2 selectively decreased luciferase activity from pGL3-3=UTR (by
4048
mcb.asm.org
⬃52%, P ⫽ 0.0000) but not from other reporters. These results suggest that the CDK1 3=UTR, but not the CDK1 CR, is the target of regulation by NSun2. We next tested the presence of m6A or m5C in the in vitromethylated CR and 3=UTR fragments. As shown in Fig. 3A, m5C was detected from the in vitro-methylated CR and 3=UTR fragments, while m6A was not (data not shown), indicating that NSun2 methylated CDK1 mRNA at a cytosine (m5C). The CR fragment may contain multiple methylation sites, since CR-A, CR-B, and CR-C were methylated by NSun2 (Fig. 2B). Because methylation of 3=UTR but not CR was functional for the regulation of CDK1 by NSun2 (Fig. 2C), we further identified the methylation sites within the 3=UTR of CDK1 by using bisulfate RNA sequencing. As this method is more effective in identifying m5C in fragments shorter than 100 nt, we performed in vitro RNA methylation assays to assess the methylation of 3=UTR-Ca, 3=UTR-Cb, and 3=UTR-Cc (Fig. 3B, left panel, schematic). As shown, fragment 3=UTR-Cb, but not 3=UTR-Ca and 3=UTR-Cc, was methylated by NSun2 (Fig. 3B, right panel), indicating that the methylation site is located at positions 1721 to 1751. Therefore, we performed bisulfate RNA sequencing to identify the methylation sites within fragment 3=UTR-Cb. As shown in Fig. 3C, methylation at C1733 was detected in all of the positive clones (14/14, 100%), while methylation at C1757 or C1780 was detected in only 1 (7.1%) or 2 (14.3%) of 14 clones. To further confirm whether C1733 was the major methylation site, variants of 3=UTR or 3=UTR-C with a mutated C1733 (C-G) (3=UTR⌬ or 3=UTR-C⌬) were used in in vitro methylation assays. As shown in Fig. 3D,
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
FIG 6 The NSun2-CDK1 regulatory process impacts the cell division cycle. (A and B) U2OS cells were transfected with a siRNA targeting NSun2 (A) or with a vector expressing NSun2 (B). At 48 h later, cells were collected and subjected to FACS analysis to assess the cell cycle distribution. Data represent the means ⫾ SD of the results of 3 independent experiments. (C) U2OS cells transfected with a siRNA targeting NSun2 (left) or with a vector expressing NSun2 (right). After transfection, the cell numbers were determined by MTT assays at the times indicated. OD, optical density.
mutation of C1733 abolished the effect of NSun2 in methylating the CDK1 3=UTR and 3=UTR-C. Therefore, C1733 is the major methylation site in the CDK1 3=UTR. To further test if NSun2 could methylate CDK1 mRNA in cells, RNA isolated from U2OS cells in which NSun2 was either overexpressed or silenced was subjected to methylation-specific PCR to determine the methylation levels of C1733 in cells, as described in Materials and Methods. As shown in Fig. 3E, this method found C1733 in CDK1 3=UTR methylated in vitro (Fig. 3E, left panel); C1733 methylation levels increased in cells that overexpressed NSun2 (Fig. 3E, middle panel) and decreased in cells with silenced NSun2 (Fig. 3E, right panel). To test if methylation at C1733 influenced the expression of CDK1, a pGL3-derived reporter bearing the 3=UTR⌬ fragment (pGL3-3=UTR⌬) was constructed. The activity of pGL3-3=UTR⌬ in cells with silenced NSun2 or with overexpressed NSun2 was determined. As shown in Fig. 3F, mutation of C1733 attenuated the effect of NSun2 overexpression (left panel) or knockdown (right panel) in altering the activity of pGL3-3=UTR. In sum, NSun2 methylates CDK1 3=UTR at C1733 in vitro and in cells, and methylation by NSun2 enhances CDK1 production. Methylation by NSun2 enhances the expression of CDK1 at the translational level. Based on the findings indicating that altering NSun2 levels affected CDK1 protein levels without altering
December 2015 Volume 35 Number 23
CDK1 mRNA levels, we asked if NSun2-mediated mRNA methylation influenced the translation of CDK1. To this end, U2OS cells were transfected with a siRNA targeting NSun2 and a polysomal or nonpolysomal fraction was prepared. RNA isolated from the polysomal or nonpolysomal fraction was subjected to realtime qPCR to assess the levels of CDK1 mRNA. As shown, knockdown of NSun2 reduced the levels of CDK1 mRNA in the polysome, as evidenced by a leftward shift indicative of the presence of smaller polysomes (Fig. 4A, left panel). As a negative control, knockdown of NSun2 did not affect the relative levels of -actin mRNA in each fraction (Fig. 4A, right panel). To test if methylation by NSun2 influenced the translation of CDK1, in vitro-transcribed pGL3, pGL3-CR, pGL3-3=UTR, and pGL3-3=UTR⌬ were methylated by NSun2 (“Met”) or left untreated (“Non-met”). The methylated or unmethylated reporter transcripts were then used for in vitro translation assays using rabbit reticulocyte lysates, whereupon the luciferase activity was measured. As shown in Fig. 4B, methylation by NSun2 increased the activity of pGL3-3=UTR (by ⬃1.75-fold, P ⫽ 0.0000) but not that of pGL3, pGL3-CR or pGL3-3=UTR⌬. Therefore, methylation by NSun2 increased the presence of CDK1 mRNA in polysomes and thus enhanced CDK1 translation. Methylation of CDK1 mRNA increased in the S and G2/M phases. To explore the role of NSun2 in cell proliferation, we
Molecular and Cellular Biology
mcb.asm.org
4049
Xing et al.
FIG 7 Methylation of CDK1 3=UTR is required for the function of NSun2 in regulating CDK1 in the cell division cycle. (A) U2OS cells were transfected with a pGL3 or pGL3-3=UTR reporter vector. At 24 h later, cells were further transfected with a vector expressing NSun2 (pNSun2) or an empty vector (V) and cultured for an additional 48 h. The levels of NSun2, CDK1, luciferase, and GAPDH proteins were assessed by Western blotting (left). The fold increases in the level of the CDK1 3=UTR were determined by real-time qPCR (right). (B and C) The cells described for panel A were subjected to FACS analysis (B) and MTT assays (C) to assess cell cycle distribution and cell growth, respectively. Data represent the means ⫾ SD of the results of 3 independent experiments.
examined the levels of NSun2 protein throughout the cell division cycle. U2OS cells were subjected to a synchronization regimen consisting of culture growth for 3 days in serum-free medium that was remarkably enriched in the G1 compartment, from ⬃45% in asynchronous cells to ⬃70% after serum starvation. The synchronized cells were released from arrest by the addition of serum (10%), and the cell cycle progression was monitored by FACS analysis at the times indicated. As shown in Fig. 5A, after addition of the serum into the medium, U2OS cells were gradually released from arrest, with the highest G2/M levels seen in 18 to 24 h. We then analyzed the levels of NSun2, CDK1, and GAPDH in the cells described in the Fig. 5A legend. As shown in Fig. 5B, CDK1 protein levels were very low at 0 to 6 h and then increased gradually; both NSun2 protein levels and CDK1 protein levels peaked at 15 h after addition of the serum. As a negative control, the levels of GAPDH remained unchanged throughout the time analyzed. To test whether CDK1 mRNA methylation levels increased in the G2/M phase, RNA was prepared at 0 and 18 h after addition of the serum. The methylation levels of C1733 were determined by bisulfate RNA sequencing. Since the CDK1 mRNA levels of CDK1 fluctuated during the cell cycle, the methylation-specific RT-PCR method described in the Fig. 3E legend was not appropriate in this case. As shown, the methylation of C1733 was low in synchronous cells (⬃23%) but dramatically increased at 18 h after addition of the serum (⬃50%) (Fig. 5C). These results suggested that NSun2mediated CDK1 mRNA methylation is capable of contributing to the elevation of CDK1 in G2/M phase.
4050
mcb.asm.org
Impact of Nsun2-CDK1 regulation on the cell division cycle. Next, we addressed if regulation of CDK1 by NSun2 affected the cell division cycle. To this end, the cell cycle distribution of NSun2-overexpressing and NSun2-silenced U2OS cells was analyzed by FACS analysis. As shown in Fig. 6A and B, cells overexpressing NSun2 exhibited smaller S and G2/M compartments and a larger G1 compartment (Fig. 6A), whereas cells with silenced NSun2 displayed the opposite distribution of compartments (Fig. 6B). In addition, overexpression of NSun2 globally accelerated cell growth whereas NSun2 silencing slowed it down (Fig. 6C). To further confirm the impact of NSun2-CDK1 on the cell division cycle, U2OS cells were cotransfected with the pGL33=UTR or the pGL3 reporter vector together with a vector expressing NSun2 (pNSun2) or the empty vector (V). The expression of endogenous CDK1 and cell growth were evaluated. As shown in Fig. 7A, transfection of pGL3-3=UTR reporter vector increased the abundance of CDK1 3=UTR by ⬃700-fold (left panel). As a result, overexpression of the ectopic CDK1 3=UTR abolished the induction in CDK1 resulting from NSun2 overexpression (Fig. 7A, right panel). As anticipated, overexpression of ectopic CDK1 3=UTR abolished the effect of NSun2 overexpression as an inducer of cell cycle progression (Fig. 7B) and cell growth (Fig. 7C). In sum, the induction of CDK1 expression via methylation of CDK1 mRNA by NSun2 promotes cell cycle progression. DISCUSSION
In the present report, we describe evidence indicating that NSun2 regulates the translation of CDK1 by methylating the CDK1
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
NSun2 Regulates CDK1
3=UTR (Fig. 1 to 4). Through this mechanism, NSun2 promotes the entry of G2/M phase from S phase (Fig. 6). Given that ectopic expression of the CDK1 3=UTR fragment was able to antagonize the upregulation of CDK1 and enhanced cell division by NSun2 (Fig. 7), the NSun2-CDK1 regulatory axis contributes, at least in part, to the increased regulation of CDK1 in the cell division cycle. Although the underlying mechanisms are not fully clear, that fact that methylation by NSun2 influences the presence of CDK1 mRNA in the polysome suggests that methylation by NSun2 may regulate the initiation of translation (Fig. 4A). In addition to the CDK1 3=UTR, the CDK1 CR could also be methylated by NSun2 (Fig. 2B). However, methylation of CDK1 CR did not alter CDK1 expression levels (Fig. 2C). Therefore, whether or not mRNA methylation influences mRNA fate may depend on the location of the methylated site or on additional factors interacting with the mRNA. As mentioned, microRNAs miR-410, miR-650, miR-4903p, and miR-582-5p are also repressors of the translation of CDK1 (25–27). The relative impacts of NSun2 and CDK1 mRNA-targeting microRNAs upon CDK1 translation remain to be studied. NSun2 has been shown to upregulate the expression of p16, p53, E2F3, and ErbB2 by methylating the mRNAs that encode these cell cycle regulators (32, 34). NSun2-mediated methylation was also shown to repress the processing and function of miR125b, thereby relieving the miR-125b-mediated repression of p53, E2F3, CDC25C, and ErbB2 (34). While the regulation of p53 mRNA and p16 mRNA by NSun2 may not be responsible for the growth-promoting function of NSun2 (since p53 and p16 repress cell proliferation), it is plausible that NSun2 promotes cell proliferation through its regulation of ErbB2, E2F3, and CDC25C (28, 35, 36) in addition to CDK1. Methylation of the 3=UTR of mRNAs has been described since the late 1980s (36–38). Recently, studies have revealed that methylation of mRNA other than the 5=-cap structure is a common posttranscriptional modification (39). Methylation of tRNA by NSun2 stabilizes tRNA and enhances translation (30); methylation of mRNAs by NSun2 is also usually a positive regulator of gene expression (32, 34). The present report suggests that NSun2mediated CDK1 3=UTR methylation enhances the translation of CDK1 (Fig. 4). Although both the CR and the 3=UTR of CDK1 mRNA are methylated (Fig. 3A), methylation of CDK1 CR does not seem to influence the expression of CDK1 (Fig. 3F). Therefore, whether methylation is functional with respect to expression of a target gene may depend on the location of methylation. Apart from regulating the cell division cycle and cellular senescence, NSun2 may also be involved in other physiological and pathological processes. For examples, elevation of NSun2 levels has been observed in various human cancers (28, 40), and NSun2 is also required for differentiation of testes and skin stem cells (41, 42). Whether NSun2-regulated CDK1 production impacts directly upon cell division during these processes remains to be studied. ACKNOWLEDGMENTS This work was supported by grants 81230008, 81420108016, and 91339114 from the National Science Foundation of China and by grant B07001 (111 project) from the Ministry of Education of People’s Republic of China. We declare that we have no conflicts of interest.
December 2015 Volume 35 Number 23
REFERENCES 1. Malumbres M, Barbacid M. 2005. Mammalian cyclin-dependent kinases. Trends Biochem Sci 30:630 – 641. http://dx.doi.org/10.1016/j.tibs.2005.09 .005. 2. Malumbres M, Barbacid M. 2009. Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer 9:153–166. http://dx.doi.org/10.1038 /nrc2602. 3. Fisher D, Krasinska L, Coudreuse D, Novák B. 2012. Phosphorylation network dynamics in the control of cell cycle transitions. J Cell Sci 125(Pt 20):4703– 4711. http://dx.doi.org/10.1242/jcs.106351. 4. Shimada M, Niida H, Zineldeen DH, Tagami H, Tanaka M, Saito H, Nakanishi M. 2008. Chk1 is a histone H3 threonine 11 kinase that regulates DNA damage-induced transcriptional repression. Cell 132:221–232. http://dx.doi.org/10.1016/j.cell.2007.12.013. 5. Marais A, Ji Z, Child ES, Krause E, Mann DJ, Sharrocks AD. 2010. Cell cycle-dependent regulation of the forkhead transcription factor FOXK2 by CDK·cyclin complexes. J Biol Chem 285:35728 –35739. http://dx.doi .org/10.1074/jbc.M110.154005. 6. Yuan Z, Becker EB, Merlo P, Yamada T, DiBacco S, Konishi Y, Schaefer EM, Bonni A. 2008. Activation of FOXO1 by Cdk1 in cycling cells and postmitotic neurons. Science 319:1665–1668. http://dx.doi.org/10.1126 /science.1152337. 7. Reis T, Edgar BA. 2004. Negative regulation of dE2F1 by cyclindependent kinases controls cell cycle timing. Cell 117:253–264. http://dx .doi.org/10.1016/S0092-8674(04)00247-8. 8. Le Breton M, Cormier P, Bellé R, Mulner-Lorillon O, Morales J. 2005. Translational control during mitosis. Biochimie 87:805– 811. http://dx .doi.org/10.1016/j.biochi.2005.04.014. 9. Chen S, Bohrer LR, Rai AN, Pan Y, Gan L, Zhou X, Bagchi A, Simon JA, Huang H. 2010. Cyclin-dependent kinases regulate epigenetic gene silencing through phosphorylation of EZH2. Nat Cell Biol 12:1108 –1114. http://dx.doi.org/10.1038/ncb2116. 10. Li S, Makovets S, Matsuguchi T, Blethrow JD, Shokat KM, Blackburn EH. 2009. Cdk1-dependent phosphorylation of Cdc13 coordinates telomere elongation during cell-cycle progression. Cell 136:50 – 61. http://dx .doi.org/10.1016/j.cell.2008.11.027. 11. Takizawa CG, Morgan DO. 2000. Control of mitosis by changes in the subcellular location of cyclin-B1-Cdk1 and Cdc25C. Curr Opin Cell Biol 12:658 – 665. http://dx.doi.org/10.1016/S0955-0674(00)00149-6. 12. Larochelle S, Merrick KA, Terret ME, Wohlbold L, Barboza NM, Zhang C, Shokat KM, Jallepalli PV, Fisher RP. 2007. Requirements for Cdk7 in the assembly of Cdk1/cyclin B and activation of Cdk2 revealed by chemical genetics in human cells. Mol Cell 25:839 – 850. http://dx.doi.org/10.1016 /j.molcel.2007.02.003. 13. Lolli G, Johnson LN. 2005. CAK— cyclin-dependent activating kinase: a key kinase in cell cycle control and a target for drugs? Cell Cycle 4:572–577. 14. Ferrari, S. 2006. Protein kinases controlling the onset of mitosis. Cell Mol Life Sci 63:781–795. http://dx.doi.org/10.1007/s00018-005-5515-3. 15. Timofeev O, Cizmecioglu O, Settele F, Kempf T, Hoffmann I. 2010. Cdc25 phosphatases are required for timely assembly of CDK1-cyclin B at the G2/M transition. J Biol Chem 285:16978 –16990. http://dx.doi.org/10 .1074/jbc.M109.096552. 16. Coulonval K, Kooken H, Roger PP. 2011. Coupling of T161 and T14 phosphorylations protects cyclin B-CDK1 from premature activation. Mol Biol Cell 22:3971–3985. http://dx.doi.org/10.1091/mbc.E11-02-0136. 17. Harvey SL, Charlet A, Haas W, Gygi SP, Kellogg DR. 2005. Cdk1dependent regulation of the mitotic inhibitor Wee1. Cell 122:407– 420. http://dx.doi.org/10.1016/j.cell.2005.05.029. 18. Jin Z, Homola EM, Goldbach P, Choi Y, Brill JA, Campbell SD. 2005. Drosophila Myt1 is a Cdk1 inhibitory kinase that regulates multiple aspects of cell cycle behavior during gametogenesis. Development 132: 4075– 4085. http://dx.doi.org/10.1242/dev.01965. 19. Krasinska L, Domingo-Sananes MR, Kapuy O, Parisis N, Harker B, Moorhead G, Rossignol M, Novák B, Fisher D. 2011. Protein phosphatase 2A controls the order and dynamics of cell-cycle transitions. Mol Cell 44:437– 450. http://dx.doi.org/10.1016/j.molcel.2011.10.007. 20. Nebreda AR. 2006. CDK activation by non-cyclin proteins. Curr Opin Cell Biol 18:192–198. http://dx.doi.org/10.1016/j.ceb.2006.01.001. 21. Kao CY, Tanimoto A, Arima N, Sasaguri Y, Padmanabhan R. 1999. Transactivation of the human cdc2 promoter by adenovirus E1A. E1A induces the expression and assembly of a heteromeric complex consisting
Molecular and Cellular Biology
mcb.asm.org
4051
Xing et al.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
of the CCAAT box binding factor, CBF/NF-Y, and a 110-kDa DNAbinding protein. J Biol Chem 274:23043–23051. Badie C, Itzhaki JE, Sullivan MJ, Carpenter AJ, Porter AC. 2000. Repression of CDK1 and other genes with CDE and CHR promoter elements during DNA damage-induced G(2)/M arrest in human cells. Mol Cell Biol 20:2358 –2366. http://dx.doi.org/10.1128/MCB.20.7.2358-2366 .2000. Marash L, Liberman N, Henis-Korenblit S, Sivan G, Reem E, ElroyStein O, Kimchi A. 2008. DAP5 promotes cap-independent translation of Bcl-2 and CDK1 to facilitate cell survival during mitosis. Mol Cell 30:447– 459. http://dx.doi.org/10.1016/j.molcel.2008.03.018. Liberman N, Marash L, Kimchi A. 2009. The translation initiation factor DAP5 is a regulator of cell survival during mitosis. Cell Cycle 8:204 –209. http://dx.doi.org/10.4161/cc.8.2.7384. Chien WW, Domenech C, Catallo R, Kaddar T, Magaud JP, Salles G, Ffrench M. 2011. Cyclin-dependent kinase 1 expression is inhibited by p16(INK4a) at the post-transcriptional level through the microRNA pathway. Oncogene 30:1880 –1891. http://dx.doi.org/10.1038/onc.2010.570. Chen S, Chen X, Xiu YL, Sun KX, Zhao Y. 2015. MicroRNA-490-3P targets CDK1 and inhibits ovarian epithelial carcinoma tumorigenesis and progression. Cancer Lett 362:122–130. http://dx.doi.org/10.1016/j.canlet .2015.03.029. Zhang Y, Huang W, Ran Y, Xiong Y, Zhong Z, Fan X, Wang Z, Ye Q. 23 May 2015, posting date. miR-582-5p inhibits proliferation of hepatocellular carcinoma by targeting CDK1 and AKT3. Tumour Biol http://dx .doi.org/10.1007/s13277-015-3582-0. Frye M, Watt FM. 2006. The RNA methyltransferase Misu (NSun2) mediates Myc-induced proliferation and is upregulated in tumors. Curr Biol 16:971–981. http://dx.doi.org/10.1016/j.cub.2006.04.027. Sakita-Suto S, Kanda A, Suzuki F, Sato S, Takata T, Tatsuka M. 2007. Aurora-B regulates RNA methyltransferase NSUN2. Mol Biol Cell 18: 1107–1117. http://dx.doi.org/10.1091/mbc.E06-11-1021. Tuorto F, Liebers R, Musch T, Schaefer M, Hofmann S, Kellner S, Frye M, Helm M, Stoecklin G, Lyko F. 2012. RNA cytosine methylation by Dnmt2 and NSun2 promotes tRNA stability and protein synthesis. Nat Struct Mol Biol 19:900 –905. http://dx.doi.org/10.1038/nsmb.2357. Ma L, Chang N, Guo S, Zhang Z, Wang W, Tong T. 2008. CSIG regulates PTEN translation in replicative senescence. Mol Cell Biol 28: 6290 – 6301. http://dx.doi.org/10.1128/MCB.00142-08. Zhang X, Liu Z, Yi J, Tang H, Xing J, Yu M, Tong T, Shang Y, Gorospe M, Wang W. 2012. NSun2 stabilizes p16INK4 mRNA by methylating the
4052
mcb.asm.org
33.
34.
35.
36. 37. 38. 39.
40.
41.
42.
3=-untranslated region of p16. Nat Commun 3:712. http://dx.doi.org/10 .1038/ncomms1692. Abdelmohsen K, Srikantan S, Kuwano Y, Gorospe M. 2008. miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Proc Natl Acad Sci U S A 105:20297–20302. http://dx.doi.org/10.1073 /pnas.0809376106. Yuan S, Tang H, Xing J, Fan X, Cai X, Li Q, Han P, Luo Y, Zhang Z, Jiang B, Dou Y, Gorospe M, Wang W. 2014. Methylation by NSun2 represses the levels and function of miR-125b. Mol Cell Biol 34:3630 – 3641. http://dx.doi.org/10.1128/MCB.00243-14. Di Fiore PP, Segatto O, Taylor WG, Aaronson SA, Pierce JH. 1990. EGF receptor and erbB-2 tyrosine kinase domains confer cell specificity for mitogenic signaling. Science 248:79 – 83. http://dx.doi.org/10.1126/science .2181668. DeGregori J, Leone G, Miron A, Jakoi L, Nevins JR. 1997. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A 94:7245–7250. http://dx.doi.org/10.1073/pnas.94.14.7245. Narayan P, Rottman FM. 1988. An in vitro system for accurate methylation of internal adenosine residues in messenger RNA. Science 242: 1159 –1162. http://dx.doi.org/10.1126/science.3187541. Carroll SM, Narayan P, Rottman FM. 1990. N6-methyladenosine residues in an intron-specific region of prolactin pre-mRNA. Mol Cell Biol 10:4456 – 4465. Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G. 2012. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485:201–206. http://dx .doi.org/10.1038/nature11112. Okamoto M, Hirata S, Sato S, Koga S, Fujii M, Qi G, Ogawa I, Takata T, Shimamoto F, Tatsuka M. 2012. Frequent increased gene copy number and high protein expression of tRNA (cytosine-5-)-methyltransferase (NSUN2) in human cancers. DNA Cell Biol 31:660 – 671. http://dx.doi .org/10.1089/dna.2011.1446. Blanco S, Kurowski A, Nichols J, Watt FM, Benitah SA, Frye M. 2011. The RNA-methyltransferase Misu NSun2 poises epidermal stem cells to differentiate. PLoS Genet 7:e1002403. http://dx.doi.org/10.1371/journal .pgen.1002403. Hussain S, Tuorto F, Menon S, Blanco S, Cox C, Flores JV, Watt S, Kudo NR, Lyko F, Frye M. 2013. The mouse cytosine-5 RNA methyltransferase NSun2 is a component of the chromatoid body and required for testis differentiation. Mol Cell Biol 33:1561–1570. http://dx.doi.org/10 .1128/MCB.01523-12.
Molecular and Cellular Biology
December 2015 Volume 35 Number 23
