Nuclear Proteins induced Annexin Transcription
You-Hai
Xu and Nelson
And Prolactinlcpa5 Gene
D. Horseman
Department of Physiology University of Cincinnati Cincinnati, Ohio 45267
and Biophysics
Annexin lcpa5 is the major PRL-stimulated gene in the pigeon cropsac. The regulation of its promoter has been studied by in vitro assays for nuclear protein binding and transcription. Proteins present in nuclear extracts of PRL-stimulated, but not control, pigeon cropsac contained factors which specifically bound to sequences within 73 base pairs upstream of the cp35 transcription start point. The binding of some of the factors was localized to a region between -32 and -73 by gel-shift assays. Cell-free transcription was used to determine whether the cp35 promoter could be influenced by factors present in cropsac nuclear extract. HeLa cell nuclear extract transcribed the cp35 gene at a basal rate. Transcription of the cp35 gene, but not adml, was synergistically enhanced by nuclear extract from PRL-stimulated cropsac. Nuclear extract from unstimulated pigeon cropsacs did not stimulate either cp35 or a&n/ transcription. A template from which sequences upstream of the cp35 gene TATA box were deleted was transcribed by HeLa cell extract but unaffected by any cropsac factors. These results demonstrate that PRL can cause the expression of one or more nuclear factors that bind to 5’-flanking DNA of cp35 and activate the gene’s transcription. (Molecular Endocrinology 6: 375-363, 1992)
there is a single anxl gene, and it is not regulated by PRL (4-6). The divergent adaptation and regulation of a unique anxl gene in pigeons (~~35) provides an opportunity to examine the mechanisms by which polypeptide hormones such as PRL can alter nuclear gene expression. PRL affects cells by binding to a membrane receptor (7). However, there is little concrete known about the postreceptor signaling events for either PRL or an entire class of cytokines which bind to similar receptors (8). Although numerous signaling pathways for PRL have been investigated, none are proven, and it is likely that the hormone uses more than one pathway. One theme common to PRL’s target tissue effects is the specific regulation of nuclear gene expression. Several genes are known to be regulated by PRL. The best characterized have been the mammary gland milk protein genes for which PRL is one of several necessary hormone factors (9! 10). One approach to understanding how a hormone can regulate a specific gene is to identify regions of the gene that can bind hormone-dependent factors. In addition, if those factors alter the transcriptional activity of the gene, they are likely to form at least one component of the hormone’s mechanism. Based upon the assumption that there might be sites for PRL-dependent regulatory activities in the proximal 5’-region of the cp35 gene, we have studied both DNA-binding and transcriptional activities in vitro. Our experiments suggest that by interacting with a region of about 40 base pairs (bp) 5’ of the cp35 TATA box, PRL-dependent factors can stimulate cp35 transcription.
INTRODUCTION To learn about the mechanisms by which PRL can affect gene expression in target tissues we have been studying the regulation of the annexin lcp35 gene (~~35) in pigeon cropsac cells (CSC) (l-3). The Annexin I (Anxl) of the pigeon is unlike mammalian Anxl in three ways: annexin I (anxl) is a multigene family in pigeon but a single gene in mammals; PRL is an absolute requirement for expression of the pigeon cp35 gene, but not mammalian Anxl; and the cp35 protein lacks phosphorylation sites for tyrosine kinases and protein kinase C in its regulatory amino terminus (1, 2). In mammals 0888.8809/92/0375-0383$03.00/O Molecular Endocmology Copynght 0 1992 by The Endocrine
RESULTS DNA Binding
Factors
in PRL-Stimulated
CSC Nuclei
Because sequence-specific DNA-protein interaction is a prerequisite for selective transcription regulation, we used gel mobility-shift assays to determine whether the proximal 5’-flanking region of cp35 contained binding sites for factors in cropsac nuclear extract (CSNE) from PRL-stimulated pigeons (PRL+). A 463-bp Hincll/Accl fragment of cp35 was cut with AM to yield a 264-bp
Society
375
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL END0.1992 376
Vol6 No. 3
Y-flanking fragment (-271 to -8). This promoter fragment was end-labeledto produce a substrate for protein binding.In preliminaryexperimentswe determined that the binding of factors present in the CSNE was eliminatedwhen the CSNE was denatured by heat or trichloroacetic acid treatment. In addition, the concentration of poly(dl-dC) was optimized by titration (not shown). As shown in the map in Fig. 1, the 264-bp Hincll/Alul fragment was digestedto yield three segments:51-bp /-/incll/Taql, 147-bp Taql/Rsal, and 66-bp Rsal/A/ul. Each of these was used in competitionexperimentsto determinethe specificityof factor binding.The complete /-/incll/A/ul fragment bound with proteins to yield a complex set of gel retardation products (Fig. 2A). This pattern of multiple gel mobility shift products could conceivably indicate either multiple cp35binding proteins in CSNE, or multimericforms of a singlepolypeptide. Neither the Hincll/Taql nor Taql/Rsalfragment competed for bindingthe probefragment(Fig. 2A). Together these fragments accounted for the majority of the Hincll/A/ulfragment(197 of 263 bp), andit is remarkable that none of the binding activity of Hincll/A/ul was displaced,even by large excessesof either fragment. In contrast to the lack of competitionby the two distal 5’-fragments (Hincll/Taql and Taql/Rsal),the proximal fragment (Rsal/A/ul, 66 bp) completelydisplacedfactor binding to the Hincll/A/ul probe in a dose-dependent manner(Fig. 28). The competition for binding by this fragment was essentiallyequivalentfor allof the bands. A promoter fragment probe consistingof the 66-bp Rsal/A/ul fragment (plus 16 basesof vector sequence) was used as a substrate for CSNE factor binding (Fig. 3). This probe yielded a set of multiple mobilityshift products that were qualitatively similarto those
A Competitor DNA Molar Excess IJ PRL+ Extract -
DrDbe
•,
-73 RIO I
-220 Tag I
-8 flIUI miiill
-
264
192 AC-C I
192bp I
bD 4
I -31
-8 RIU I
192 bp
,g2 SC: :
I
1. The cp35 Gene Promoter Region The cp35 5’ region (-273 to +192) was subcloned from a pigeon cropsac genomic clone. The upper line represents a /-/incll/Accl subclone and restriction enzyme sites (Taql, Rsal, and Alul) which were used to generate fragments for gel-shift assays and competition experiments. The lower line represents a minimal promoter deletion mutant (Acp35) that was synthesized by PCR so as to include the region from -31 to +192.
I
Hincll/Taql
I
Taql/Rsal
50
100
500
1000
50
100
500
IO00
+
+
+
+
+
+
+
+
I
I
B Competitor DNA Molar Excess 0 PRL+ Extract -
DrObe -271 llinc II
I o +
I 0
+
Rsal/Alul 50 100
+
+
I
500 1000
+
+
+
2. Gel-Shift Assay of cp35 Promoter-Binding Proteins Nuclear extracts from PRL-stimulated cropsac (PRL+ CSNE) were incubated with a 264-bp (Hincll/A/ul) fragment (10“ cpm) of the cp35 5’-flanking region in 20-hl reactions containing 5 pg PRL+ CSNE proteins. The reaction mixture was incubated for 30 min (30 C) and separated through 4% nondenaturing PAGE. Competitor DNA fragments (Hincll/Taql and Taql/Rsal, A; Rsal/A/ul, B) were added at up to lOOO-fold molar excess as labeled. The complexes were not competed by either the Hincll/Taql or the Taql/Rsal competitor (A). The 264-bp HincIlAlul probe DNA was completely displaced by the 66-bp F&al/ Alul fragment(B). Fig.
Fig.
derivedwith the 263-bpHincll/Alul probe.The mobilities of the bands cannot be directly compared between probes because of differences in probe size and the lengths of the gels. However, the complexities of the patterns were similar. Binding to the Rsal/A/ul probe was potently displacedin a dose-dependentmannerby
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced Transcription Factor
Extract
(Dg)
377
12
18
8
6
4
2
12
18
8
6 4
2
8
probe 1 -(
probe 2+ Probe I
Rsal/Alul
I
-32
to -73
I
3. Binding of CSNE Factors to cp35 Promoter Region Fragments Two probes corresponding to the Rsal/Alul promoter fragment (probe 1) and bases -32 through -73 (probe 2) were end-labeled. Each probe was reacted with various amounts of nuclear extract from PRL-stimulated cropsac, and complexes were separated through 4% PAGE and visualized by autoradiography. The amount of extract protein in each lane is marked above it, and the two probes are labeled below. Arrows mark the migration of the unbound probes. Fig.
competitor R.sal/Alul fragment but was not competed by a consensusTATA-box oligo (not shown). A probe prepared by labelinga double-stranded(ds) DNA oligodeoxynucleotidecorrespondingto bases-32 to -73 (inclusive) bound CSNE factors (Fig.. 3) to produce multiplegel-shift complexessimilarto the pattern with the Rsal/A/ul promoterfragment. Becauseof the difference in the sizes of the probes, it is not possibleto determinehow the variousbandswith each proberelate to one another. However, it is clear that the small-32, -73 fragment contains elements that bind multiple CSNE factors. The binding of multiple proteins to the co35 promoter-proximal region suggests that some pertinent regulatory elements are located within this region. PRL Dependence of cp35 Promoter-Binding Factors To study the relationshipbetween CSNE DNA-binding factors and PRL stimulation,the Rsal/A/ul probe was reacted with proteins from both hormonally unstimulated (PRL-) and PRL-stimulated(PRL+)CSNE (Fig. 4). Bindingactivity for the Rsal/A/ul probe was completely absentfrom the PRL- CSNE. In other experiments(not shown), PRL- CSNE likewise had no binding factors for any sequenceswithin the entire Hincll/A/ul 264-bp promoter fragment. Transcription of adml and cp35 Genes in HeLa Cell Nuclear Extract HeLa cell nuclearextract was usedto provide a system in which to study the transcription of co35 template
DNAs. As positive controls, a clone of the adenovirus major late (adml) gene (pML4) was digestedwith Pvull to yielded a 207-nucleotide(nt) run-off RNA and with Hindlll to yield a 118 nt RNA. When these substrates were used in transcription reactions (Fig. 5A, lanes 2 and 3) the adml promoter yielded run-off products of the expected sizes. The background reactants in the absenceof templateDNA (Fig. 5A, lane 1) includea set of low mol wt products (i.e. uridylated tRNAs, etc.) that we show on the gelsfor reference.With co35 promotertemplates, HeLa cell nuclear extract accurately transcribed the predicted run-offs (192 and 168 bp) (Fig. 5A, lanes4 and 5). To determinethe RNA polymeraseII (pol Il)-dependenceof the run-off transcripts, a-amanitin(1 pg/ml) was added (Fig. 58). The ol-amanitintotally suppressed the synthesisof runoff RNAs from either the adml or cp35 promoter. However, a-amanitindid not inhibit the labelingof smallbackground RNA products. Templatedependentsynthesisof both adml andcp35 RNAswas, therefore, a function of pol II. Pl?L+CSNE Synergistically Stimulated cp35 Transcription We designeda set of complementationexperimentsto study the effects of CSNE on cp35 gene transcription. We reasonedthat factors present in PRL’ CSNE that specificallybind the cp35 regulatory region might also affect the run-off transcription of the gene. Because
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL 378
ENDO.
1992
PRL Extract
Vol6
(fig)
0 5
No. 3
+
18 5 Template
DNR
no
I---AdML---I
I---cp35---I
207+ 192+
118+
DNA
probe +
n-amanitin
l--none--l -
+
I--AdML--I -
I--cp35--I +
-
+ I
Fig. 4. Gel-Shift
Assays for PRL Stimulation of co35 PromoterBinding Proteins The binding conditions were identical to Fig. 2. PRL- CSNE proteins (-) were from unstimulated cropsac, whereas PRL+ CSNE proteins (+) were from cropsac stimulated by PRL injection. The R.sal/A/ulfragment was used as the probe. In
contrast with the PRL+ extract, no binding activities were detected in PRL- CSNE. HeLa extract was competent to transcribe cp35 (Fig. 5A), but would not be expected to contain any tissueor hormone-specific factors, it was used to supply core requirements for transcription. In preliminary experiments we determined that CSNE, prepared according to the methods described, did not have an independent transcriptional activity (not shown, see also Fig. 6, lane 4). CSNE was mixed in specified ratios with HeLa extract (on ice), template was added to the mixed extracts, and run-off transcripts were synthesized (see Materials and Methods for additional details). To titrate the level of basal transcription, increasing HeLa extract was added, At the lowest levels of HeLa extract there was no basal transcription and no effect of CSNE (Fig. 6, lanes 3 and 4). CSNE factors stimulated co35 run-off transcription at levels of HeLa extract which yielded detectable basal transcription. The synergism between HeLa factors and CSNE was observed even
Fig. 5. Cell-Free
Transcription Assay of adml and cp35 DNA in HeLa Cell Nuclear Extract A, adml DNA (pML4) was linearized with Pvull to yield a 207-bp transcription template (lane 2) and with /findIll to yield a 118-bp template (lane 3). The control experiment contained no template DNA (lane 1). Two cp35 templates were prepared by digestion with Accl (lane 4, 192 bp) and Fokl (lane 5, 168 bp). Transcripts were assayed by electrophoresis on a 7 M
urea-20%gel and autoradiography.The expected positionsof the run-off transcripts relativeto coelectrophoresedmarkers are shown by the arrows at left. B, The sensitivity of run-off transcription to inhibition by a-amanitin was tested. a-Amanitin was added to a final concentration of 1 Kg/ml where indicated. Templates were Pvull digested adml (AdML) and Accl digested co35 (~~35). A 15% polyactylamide gel was used, and the predicted run-off transcripts are marked by the arrow at left
(ROT).
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
379
PRL-Induced Transcription Factor
PIa+
eHtract
9.4
9.8
HeL.3 extract
2.0
2.0
0.2
0.2
0.4
0.4
9.2 0.8
0.8
9.0 1.0
8.0
1.0
2.0
2.0
10
11
12
ROT -a
12
3456789
6. Enhancement of in Vitro Transcription from the cp35 Gene with PRL+ CSNE DNA for the adml template or cp35 template was added to mixtures of HeLa cell nuclear extract (HeLa extract) and PRL+ CSNE (PRL+ extract) at varying ratios as shown at the fop. Lane numbers are labeled below. The products were separated on 15% PAGE, and the runoff transcripts are marked by the arrow at left (ROT). Fig.
at levels of HeLa extract wherein basal transcription was high (Fig. 6, lanes 11 and 12). It is important to note that the effect of CSNE factors was not simply additive with HeLa core factors. The stimulation by CSNE (measured by densitometry of the autoradiograms) ranged from 1.3- to 8.7-fold and averaged 3.4 f 1.8-fold (mean f SEM). To test promoter specificity we performed a parallel experiment in which PRL+ CSNE was added to transcription reactions using adml as the template (Fig. 7). The figure shows a portion of the titration of HeLa extract with CSNE. In contrast to co35 the adml promoter was not activated by factors from the CSNE. Compared with transcription in the absence of CSNE, the level of run-off synthesis of adml was consistently
Template PM+ extract Hela extract
I________
fl,,,,.,L
________
9.0 1.0
1.0
1
8.0
2.0
lower in the presence of CSNE. While the nonspecific suppression of adml by CSNE was modest, it is noteworthy that the synergistic activation of cp35 transcription took place in the presence of proteins that were inhibitory to the adml strong constitutive promoter. Gel retardations indicated that protein binding to the cp35 promoter was PRL-dependent (Fig. 4). Therefore, we tested the effect of CSNE from PRL- animals on run-off transcription of the cp35 and adml genes. In contrast to PRL+ CSNE (Fig. 6), PRL- CSNE consistently inhibited transcription of the cp35 template (Fig. 8). The adml promoter was also partially inhibited in the presence of PRL- CSNE. The result with adml was identical in the presence of either PRL+ CSNE (which is shown in Fig. 7) or PRL- CSNE (not shown). We considered the possibility that the apparent suppression of transcripts by PRL- CSNE was caused by
2.0
Template PRL- extract HeLa extract
I-------
1.0
-cp35-
9.0 1.0
_______
[ fldML
8.0
2.0
2.0
2.0
ROT + ROT -)
Fig. 7. PRL+ CSNE Did Not Stimulate the in Vitro Transcription of the adml Promoter The adml template was transcribed in the presence of either HeLa cell nuclear extract alone or HeLa extract mixed with PRL+ CSNE, and RNA run-off transcription was assayed as before. Legend is as in Fig. 6.
Fig. 6. Inhibition of cp35 Transcription by Unstimulated Cropsac Extract (PRL- CSNE) co35 template was added to mixtures of HeLa cell nuclear extract and PRL- CSNE at the ratios indicated at the too. Legend and assay are as in Fig. 6.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO. 1992
Vol6 No. 3
380
ribonucieases.However, RNA degradation would be expected to be similaron both co35 and adml transcripts. In addition, experimentswith a deletion mutant (Acp35, see below)were not consistent with any RNA degradationeffects. CSNE Did Not Affect Transcription of a Deletion Mutant, Acp35 To test whether the effects of CSNE proteins were determinedby sequences5’ of the TATA-box we deleted the upstreamregionand transcribedthe resulting template in vitro. By PCR synthesis we prepared a transcription template (Acp35, Fig, 1) that contained bases -31 to +192 of cp35. Transcription of Acp35 was unaffectedby either CSNE protein fraction (Fig. 9). It is important to note that the Acp35 promoter, containing only a BarnHI-linkeredcp35 TATA-box, and sequencesdownstreamof it, was sufficient to synthesize the predicted run-off transcript in a HeLa extract assay. The run-off product appeared as a relatively diffuse band in all reactions with Acp35, whereas the wild-type cp35 promoter always yielded a sharp RNA band. This observation suggeststhat the precisionof initiationat the transcriptionstart point can be affected by the presenceof sequencesupstreamof TATA. Not only was there no activation by PRL’ nuclearfactors, but also the inhibitory effect of PRL- CSNE was completely absenton Acp35. DISCUSSION By virtue of its protein binding and factor-sensitive transcription,we have shown that the promoter-proxi-
Template PRL+extract PRL-extract Hela extract
A Ct’ 35
4.0 1.0
1.0
4.0 1.0
ROT +
Fig. 9. Cell-Free Transcription IC If S-Deleted cp35 Template (Acp35) in Nuclear Extracts The Acp35 template (-31 to +192) was made by PCR, propagated in pGEM3 vector, excised by restriction enzyme digestion with SamHI, and gel purified. Acp35 DNA was added to HeLa nuclear extract mixed with PRL+ or PRL- CSNE and assayed as in Fig. 6.
mal area of the cp35 5’-flanking regioncontains one or moreelementsby which PRLcan regulatecp35 expression. There are likely to be other regions of cp35 that contain additional regulatory elements. However, the correspondenceof factor bindingand synergistic transcriptionalactivation in the proximal regulatory region suggeststhat these sequencesare a substrate for at least someof the important mechanismsof regulation by PRL. PRL and its close relatives(GH, placentallactogens, etc.) are distinguishedfrom other classicalprotein hormones by the generalization that they cause slow changes in cell differentiation state and proliferation, ratherthan rapid metabolicalterations(11). In this sense they are more akin to the growth factors than to classical tropic hormones.This fundamentaldistinction is correlated with several other biochemicaland physiologicalobservations. Receptorsfor PRL belong to a superfamilyof cytokine receptors (10). The first discovered membersof this family were the GH (12) and PRL (7) receptors. Subsequently,receptors for interleukins2, 4, 6, and 7, granulocyte-macrophagecolony-stimulatingfactor, erythropoetin, etc., were shown to share a common domainstructure (8). None of the receptor sequences predict known signaltransduction pathways. In order to understandPRL’s signalingmechanisms, it is important to preciselydefine the postreceptor cellular responsesof target tissues.Our efforts have been directed toward examiningthe regulationof cp35 as a specificresponseto PRL receptor activation (1, 3, 6). The close relationshipof cp35 to other anxl genes that are not PRL-responsiveprovided us a justification for assuming that PRL-dependent regulatory sequenceswere probably located in the nonconserved5’ regionof the gene (1). With this backgroundwe examined potentialcp35 regulatory factors. DNA-Binding Proteins An a priori requirementfor selective regulationof gene transcriptionis sequence-specificnucleotidebindingof factors which are responsive, either directly or indirectly, to a regulatinghormone. Becausethe 5’ end of cp35 is most different from other anxl, we have suspected that the novel PRL regulationof cp35 is encoded in this region. Nuclear proteins that bind to the cp35 promoter region are dependent on PRL (Fig. 4). By comparison of competition and bindingpatterns, it seemsthat the bindingactivities observed in PRL’ CSNE interact with basesfrom -32 to -73. There were multiple complexes formed by PRL+ CSNE with either the 264-, 73-, or 42-bp promoter fragments. It is not possibleto know whether these were multimericcomplexesof a singleprotein, or multiple proteins interacting to yield different complexes. We favor the latter interpretation (multiplecomponent proteins) on the basis that competition with excess DNA resulted in paralleldisplacementof all complexes
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced
Transcription
Factor
381
(Fig. 2B). If a single protein formed multimers, one would expect that monomers would be favored as the quantity of competitor DNA increased. Direct knowledge of the stoichiometries of DNA-binding complexes will require purification and/or cloning of the relevant factor(s). The exact sequences to which PRL-induced DNA binding factor(s) bind within the 42-bp 5’ region (-32 to -73) have not yet been determined. One candidate is a region of multiple dyad symmetry located from bases -45 through -33. This region contains an 8member element (CACtgGTG) nested in a 13-member element (CACTcgtgcAGTG) (1). Neither of these signatures is closely related to any known transcription factor binding site. Their appearance within a relatively small fragment that binds specific proteins, and their proximity to the TATA-box, are compelling reasons to hypothesize that they may be of consequence for the regulation of co35 The Rsal/A/ul co35 promoter fragment has no sites which conform to well characterized transcription factor binding sites (1). In spite of the lack of known binding sequences, this promoter-containing region was clearly a substrate for DNA binding proteins that caused multiple gel mobility-shift products. In addition, our transcription experiments demonstrated that the region contains sequences that are capable of mediating hormone-dependent transcriptional activation. In order to determine whether other PRL-regulated genes contain sequences that are analogous to the co35 promoter region, a more specific definition of the functional sequence(s) will be needed. Transcriptional
Enhancement
in Vitro
By complementing a standard extract of HeLa cell nuclear proteins with CSNE we have shown that cropsac from PRL-treated, but not unstimulated, birds contains stimulatory activity for the co35 gene promoter. The CSNE prepared in these experiments was not capable of independently supporting transcription, and no attempt was made to optimize the preparation of the CSNE to produce an independently active transcription system. The degree of transcription synergism by CSNE was a function of the concentration of core factors in the HeLa extract. When we titrated increasing amounts of HeLa extract against the cropsac proteins there was no detectable co35 transcription at the lowest amounts of HeLa proteins. At the highest level of HeLa factors, basal transcription was relatively high, but CSNE remained stimulator-y. The synergistic nature of transcription activation argues that the mechanism of co35 stimulation involves interactions between proteins present in the two extracts. Such interactions might include stabilization of initiation complexes by factor(s) present in CSNE. The stimulatory activity of PRL’ CSNE was not observed when the adml promoter was used as the transcription template. In fact, transcription from the
adml promoter was consistently inhibited by CSNE. The inhibition of adml transcription might be a trivial consequence of adding a crude nuclear protein extract, since CSNE also appeared to suppress other nontranscriptional reactions (low mol wt bands on gels). Even so, the degree to which CSNE stimulated co35 transcription seems even more dramatic when one takes into consideration the nonspecific inhibitory activity of the extract. A deletion experiment (Fig. 9) showed that the PRL responsive sequences are in the region which is upstream of the TATA box. Therefore, in light of our gel retardation data, we infer that PRL-responsive sequences are located between -32 and -73 of cp35. Whenever we have purified and/or cloned binding factors in hand we will test other mutant forms of this region in chimeric promoters to examine this inference. In vitro transcription of cp35 in the presence of PRLCSNE was suppressed (Fig. 8). This was an unexpected finding. On gel retardations PRL- CSNE did not contain any activities which bound the cp35 promoter region. Taken alone these results suggest that cp35 inhibition by PRL- CSNE might result from an indirect action on the gene. Such an interaction could involve destabilizing the core transcription complex or depleting the system of necessary factor(s) by binding or degradation. It appears that the inhibition was not sequencespecific, since aciml was also inhibited, although not as effectively as cp35. The greater sensitivity of the cp35 promoter to inhibition might simply be a consequence of differences in their relative promoter strength. The data are clear that there was a dramatic suppression of cp35 by PRL- CSNE; however, we remain open about any mechanism that might be ascribed to this observation. Other PRL-Regulated
Genes
Our finding that the cp35 promoter is stimulated by PRL’ CSNE correlates with observations that PRL transcriptionally regulates several specific genes in other systems (12-14). Most work has been done on mammary gland milk protein genes. Although it is well documented that milk protein genes are transcriptionally responsive to PRL, the &-acting elements that mediate their regulation, and the associated proteins, have remained elusive. Using promoter/reporter expression in a mammary gland-derived cell line, some of the regulatory activities of a casein promoter were localized in the areas of -170 to -285, and beyond -330 bp in the 5’-flanking region of the /3-casein gene (15, 16). In a recent paper, additional sites of potential importance for p-casein gene regulation were localized to five sequences between -36 and -180 of the casein promoter. It is not clear which, if any, of these sites play a role in mediating a PRL effect on the casein gene. Additional promoter/ reporter expression studies have demonstrated control by PRL of the B-lactoalobulin (14) oromoter in CHO
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL 382
ENDO.
1992
Vol6
cells cotransfected with promoter/chloramphenicol aminotransferase constructs and a cloned PRL receptor. Much interest has focused on the fact that PRL is a
more broadly cytotropic factor than indicated by its association with mammalian pregnancy and lactation (17, 18). For example, PRL is necessary for activation of lymphocytes stimulated by either mitogens or lymphokines (19). Yu-Lee and coworkers (13) cloned cDNAs of several genes which were induced by PRL in a T-cell lymphoma line, one of which encodes interferonregulatory factor 1. The mechanisms by which PRL stimulates gene expression and mitogenesis in lymphocytes, or other cell types, are unknown. We have shown that PRL can act on a specific promoter fragment to cause transcriptional stimulation of co35 in a cell-free system. The events by which PRL causes expression of factors responsible for cp35 gene transcription will continue to be examined by genetic and biochemical reconstitution. These events are likely to involve novel transcription regulatory factors and novel mechanisms for their activation.
MATERIALS Isolation
AND METHODS
of Promoter
Fragments
of the cp35
Gene
A 5’-Hincll subclone of the cp35 gene (1) (pGcpl.9H2) was used as the starting material to produce substrates for these experiments. This clone was deleted by Accl digestion to yield a 463-bp subclone (pGcp5H2Al) that included 264 bases of 5’-flanking sequence and approximately 200 bases encoding exon 1 and part of intron I of the cp35 gene (Fig. 1). Promoter region fragments for the binding studies were prepared by restriction enzyme digestion of pGcp.5H2A1, followed by gel purification. Templates for in vitro transcriptions were prepared by excising the insert of pGcp5H2Al and gel purifying the insert DNA. A deleted co35 promoter containing only the TATA-box and downstream sequences was made by polymerase chain reaction (PCR) synthesis. Amplification was done with Pvulllinearized oGcp.5H2Al DNA as the template. An SP6 promoter primer served as right PCR primer,.and a BarnHI-tailed TATA box sequence (GGGGGATCCTATAAAAGCATGACAAGCCC) as the left primer so as to delete the 5’upstream sequence above the TATA box. PCR (30 cycles) was processed in 50 UI 50 mM KCI. 10 mM Tris-HCI pH 8.4, 1.5 mM MgC12, 100 pg/ml gelatin, 6.25 mM of each ‘primer, 200 pM each dNTP, 100 ng DNA, and 1.25 U Taq DNA polymerase. PCR products were analyzed on a 1.5% agarose gel, and a 284-bp fragment was purified from the gel. This fragment was digested by HindIll and BarnHI, inserted in pGEM3, and propagated. The resulting Acp35 clone was confirmed by sequencing. For transcription, this fragment was excised by BarnHI digestion and gel purified. Adenovirus
Major
Late
Promoter/Template
A plasmid clone of the adenovirus major promoter and transcript (pML4) was purified Pvull and Hindlll to yield run-off transcripts bases, respectively. Nuclear
late gene (adml) and digested with of 207 and 118
Extracts
A transcription-qualified extract of HeLa cell nuclei, prepared as described by Cai and Luse (20) was a gift of Donal Lute
No. 3
(University of Cincinnati). For analysis of PRL-regulated activities we prepared nuclear extract from cropsac epithelial cells fCSCI of oiaeons (Columba livia). PRL INIH-ovine PRL (oPRL)i9, gift of &e National Hormone and Pituitary Program, BaItimore, MD] was injected at a dose of 0.2 mg/day im for 5 days before killing the animals by COn inhalation and decapitation. CSC of PRL-stimulated and unstimulated tissues were dispersed by digestion with collagenase and dispase (Boehinger Mannheim Biochemicals, Indianapolis, IN) (in RPMI-1640 medium, -5 ml/g tissue for 30 min at 37 C). After filtering through cheese cloth the CSC isolates were washed by three rounds of centrifuging (300 x g, 10 min, 4 C) and resuspending in buffer containing no enzymes. The resulting CSC were counted and isosmotically lysed in 0.32 M sucrose buffer [20 mM Na-HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 10 mM KCI, 1 mM dithiothreitol (DTT), 0.1 mM EDTA, and 0.1 mM EGTA]. Nuclei were purified through a 2 M sucrose cushion in the same buffer. The purified CSC nuclei were extracted by a modification of the Shapiro et al. (21) method. Briefly, CSC nuclei were gently lysed in 9 vol nuclear resuspension buffer (20 mM Na-HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, 25% glycerol, and 0.1% Nonidet P40) and 1 vol 4 Csaturated (NH&SO4 solution. The extracted proteins were precipitated in 33% (NH&SO4 and dialyzed exhaustively against 20 mM Na-HEPES, pH 7.9,20% glycerol, 100 mM KCI, 0.2 mrv EDTA. 0.2 mM EGTA. and 2 mM DTT at 4 C. The integrity of extracts from PRL+ and PRL- CSNE were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and appeared equivalent. Gel Mobility-Shift
Assays
The DNA binding reactions were performed at 30 C for 20 min in a vol of 20 ~1, following standard methods (22). The reaction mixture contained 10 mM Na-HEPES pH 7.9, 50 mrv NaCI, 0.5 mM EDTA, 10% glycerol, 1 mM DTT, 5 mrv MgCI*, 2 pg BSA, 2 pg poly (dl-dC):poly (dl-dC), 10 wg nuclear extract protein, and 10,000 cpm [32P]DNA probe (-0.5 ng). DNA probes were 5’ end-labeled with Tq polynucleotide kinase. After incubation, samples were electrophoresed through 4% nondenaturing polyacrylamide gels. Electrophoresis was done at 10 V/cm, and the products were exposed to x-ray film at -80 C. In the competition experiments, unlabeled competitor DNAs were mixed with the reaction buffer, and nuclear extract before 32Pprobe was added. Each experiment was replicated at least twice. Cell-Free
Transcription
Cell-free transcription was modified from the method described by Cai and Luse (20). For 20-~1 reactions (final vol) the mixture contained 10 mM Na-HEPES, pH 7.9, 7.5 mM MgCI,, 75 mM KCI, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 10% glycerol along with nuclear extracts (per experimental design). After mixing the extracts with reaction buffer on ice, 12 pg/ml template DNA were added. The reactions were preincubated for 20 min at 30 C to allow formation of protein complexes with the templates. After preincubation, 1 gl 250 PM ATP, CTP, GTP, and 1 ~1 (10 &I) c@*P]UTP (800 Ci/mmol) were added, and the samples were incubated for 5 min (30 C). ATP, CTP, GTP, and UTP were then added to 500 KM, and the reactions were incubated for an additional 10 min (30 C). The transcripts were immediately treated with 20 pg/ml protease K in 25 mM EDTA and 0.5% sodium dodecyl sulfate for 60 min (37 C), and extracted with phenol and chloroform. The run-off RNAs were precipitated with ethanol, denatured in electrophoresis loading buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanole FF), and analyzed on 7 M urea-PAGE.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced
Transcription
Factor
383
Acknowledgments
10.
We thank Donal Lute for providing reagents and helpful advice. Received August 29, 1991. Revision received December 13,199l. Accepted January 6, 1992. Address requests for reprints to: Dr. Nelson D. Horseman, Department of Physiology and Biophysics, University of Cincinnati, Cincinnati, Ohio 45267. This work was supported by NSF Grant DCB-6996208 and NIH Grant DK-42461.
11.
12.
13.
REFERENCES 1. Hitti YS, Horseman ND 1991 Structure of the gene encoding columbid annexin Icp35. Gene 103:185-l 92 2. Horseman ND 1989 A prolactin-inducible gene product which is a member of the calpactin/lipocortin family. Mol Endocrinol3:773-779 3. Pukac LA, Horseman ND 1987 Regulation of cloned prolactin-inducible genes in pigeon crop. Mol Endocrinol 1:188-194 4. Huebner K, Cannizzaro LA, Frey AZ, Hecht BK, Hecht F, Croce CM, Wallner BP 1988 Chromosomal localization of the human genes for lipocortin I and lipocortin II. Oncogene Res 2:299-310 KR, Ganjianpour M, Frost SC, Nick HS 1991 5. Horlick Annexin-l regulation in response to suckling and rat mammary cell differentiation. Endocrinology 128:1574-l 579 6. Horseman ND 1990 Hormonal regulation of an avian annexin I gene. Biochem Sot Trans 18:1113-l 115 7. Boutin J-M, Jolicoeur C, Okamura H, Gagnon J, Edery M, Shirota M, Banville D, Dusanter-Fourt I, Djiane J, Kelly PA 1988 Cloning and expression of the rat prolactin receptor, a member of the growth hormone/prolactin receptor gene family. Cell 53:69-77 8. Patthy L 1990 Homology of a domain of the growth hormone/prolactin receptor family with type 3 modules of fibronectin. Cell 61 :13-l 4 9. Eisenstein RS, Rosen JM 1988 Both cell substratum regulation and hormonal regulation of milk protein gene expression are exerted primarily at the posttranscriptional level. Mol Cell Biol 8:3183-3190
14.
15.
16.
17. 18.
19.
20. 21.
22.
Rosen JM, Jones WK, Rodgers JR, Compton JG, Bisbee CA, David-lnouye Y, Yu-Lee L-Y 1986 Regulatory sequences involved in the hormonal control of casein gene expression. Ann NY Acad Sci 464:87-99 Horseman ND 1987 Models of prolactin action in nonmammalian vertebrates. In: Rillema JA (ed) Actions of Prolactin on Molecular Processes. CRC Press. Boca Raton. DD 41Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI 1987 Growth hormone receptor and serum binding protein: purification, cloning and expression. Nature 330:537-543 Yu-Lee L-Y, Hrachovy JA, Stevens AM, Schwarz LA 1990 Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol Cell Biol 10:3087-3094 Lesueur L, Edery M, Paly J, Clark J, Kelly PA, Djiane J 1990 Prolactin stimulates milk protein promoter in CHO cells cotransfected with prolactin receptor cDNA. Mol Cell Endocrinol71 :R7-R12 Doppler W, Hock W, Hofer P, Groner B, Ball RK 1990 Prolactin and glucocorticoid hormones control transcription of the P-casein gene by kinetically distinct mechanisms. Mol Endocrinol 4:912-919 Doppler W, Groner B, Ball RK 1989 Prolactin and glucocorticoid hormones synergistically induce expression of transfected rat P-casein gene promoter constructs in a mammary epithelial cell line. Proc Natl Acad Sci USA 86:104-l 08 Nicoll CS 1980 Ontogeny and evolution of prolactin’s functions. Fed Proc 39:2563-2566 Nagy E, Berczi I 1991 Hypophysectomized rats depend on residual prolactin for survival. Endocrinology 128:2776-2784 Hartman DP, Holoday JW, Bernton EW 1989 Inhibition of lymphocyte proliferation by antibodies to prolactin. FASEB J 3:2194-2202 Cai H, Luse DS 1987 Transcription initiation by RNA polymerase II in vitro. J Biol Chem 262:298-304 Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A highefficiency HeLa cell nuclear transcription extract. DNA 7:47-55 Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning: A Laboratory Manual, ed 2, ~012. Cold Spring Harbor Laboratory Press, Cold Spring Harbor
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
You-Hai
Xu and Nelson
And Prolactinlcpa5 Gene
D. Horseman
Department of Physiology University of Cincinnati Cincinnati, Ohio 45267
and Biophysics
Annexin lcpa5 is the major PRL-stimulated gene in the pigeon cropsac. The regulation of its promoter has been studied by in vitro assays for nuclear protein binding and transcription. Proteins present in nuclear extracts of PRL-stimulated, but not control, pigeon cropsac contained factors which specifically bound to sequences within 73 base pairs upstream of the cp35 transcription start point. The binding of some of the factors was localized to a region between -32 and -73 by gel-shift assays. Cell-free transcription was used to determine whether the cp35 promoter could be influenced by factors present in cropsac nuclear extract. HeLa cell nuclear extract transcribed the cp35 gene at a basal rate. Transcription of the cp35 gene, but not adml, was synergistically enhanced by nuclear extract from PRL-stimulated cropsac. Nuclear extract from unstimulated pigeon cropsacs did not stimulate either cp35 or a&n/ transcription. A template from which sequences upstream of the cp35 gene TATA box were deleted was transcribed by HeLa cell extract but unaffected by any cropsac factors. These results demonstrate that PRL can cause the expression of one or more nuclear factors that bind to 5’-flanking DNA of cp35 and activate the gene’s transcription. (Molecular Endocrinology 6: 375-363, 1992)
there is a single anxl gene, and it is not regulated by PRL (4-6). The divergent adaptation and regulation of a unique anxl gene in pigeons (~~35) provides an opportunity to examine the mechanisms by which polypeptide hormones such as PRL can alter nuclear gene expression. PRL affects cells by binding to a membrane receptor (7). However, there is little concrete known about the postreceptor signaling events for either PRL or an entire class of cytokines which bind to similar receptors (8). Although numerous signaling pathways for PRL have been investigated, none are proven, and it is likely that the hormone uses more than one pathway. One theme common to PRL’s target tissue effects is the specific regulation of nuclear gene expression. Several genes are known to be regulated by PRL. The best characterized have been the mammary gland milk protein genes for which PRL is one of several necessary hormone factors (9! 10). One approach to understanding how a hormone can regulate a specific gene is to identify regions of the gene that can bind hormone-dependent factors. In addition, if those factors alter the transcriptional activity of the gene, they are likely to form at least one component of the hormone’s mechanism. Based upon the assumption that there might be sites for PRL-dependent regulatory activities in the proximal 5’-region of the cp35 gene, we have studied both DNA-binding and transcriptional activities in vitro. Our experiments suggest that by interacting with a region of about 40 base pairs (bp) 5’ of the cp35 TATA box, PRL-dependent factors can stimulate cp35 transcription.
INTRODUCTION To learn about the mechanisms by which PRL can affect gene expression in target tissues we have been studying the regulation of the annexin lcp35 gene (~~35) in pigeon cropsac cells (CSC) (l-3). The Annexin I (Anxl) of the pigeon is unlike mammalian Anxl in three ways: annexin I (anxl) is a multigene family in pigeon but a single gene in mammals; PRL is an absolute requirement for expression of the pigeon cp35 gene, but not mammalian Anxl; and the cp35 protein lacks phosphorylation sites for tyrosine kinases and protein kinase C in its regulatory amino terminus (1, 2). In mammals 0888.8809/92/0375-0383$03.00/O Molecular Endocmology Copynght 0 1992 by The Endocrine
RESULTS DNA Binding
Factors
in PRL-Stimulated
CSC Nuclei
Because sequence-specific DNA-protein interaction is a prerequisite for selective transcription regulation, we used gel mobility-shift assays to determine whether the proximal 5’-flanking region of cp35 contained binding sites for factors in cropsac nuclear extract (CSNE) from PRL-stimulated pigeons (PRL+). A 463-bp Hincll/Accl fragment of cp35 was cut with AM to yield a 264-bp
Society
375
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL END0.1992 376
Vol6 No. 3
Y-flanking fragment (-271 to -8). This promoter fragment was end-labeledto produce a substrate for protein binding.In preliminaryexperimentswe determined that the binding of factors present in the CSNE was eliminatedwhen the CSNE was denatured by heat or trichloroacetic acid treatment. In addition, the concentration of poly(dl-dC) was optimized by titration (not shown). As shown in the map in Fig. 1, the 264-bp Hincll/Alul fragment was digestedto yield three segments:51-bp /-/incll/Taql, 147-bp Taql/Rsal, and 66-bp Rsal/A/ul. Each of these was used in competitionexperimentsto determinethe specificityof factor binding.The complete /-/incll/A/ul fragment bound with proteins to yield a complex set of gel retardation products (Fig. 2A). This pattern of multiple gel mobility shift products could conceivably indicate either multiple cp35binding proteins in CSNE, or multimericforms of a singlepolypeptide. Neither the Hincll/Taql nor Taql/Rsalfragment competed for bindingthe probefragment(Fig. 2A). Together these fragments accounted for the majority of the Hincll/A/ulfragment(197 of 263 bp), andit is remarkable that none of the binding activity of Hincll/A/ul was displaced,even by large excessesof either fragment. In contrast to the lack of competitionby the two distal 5’-fragments (Hincll/Taql and Taql/Rsal),the proximal fragment (Rsal/A/ul, 66 bp) completelydisplacedfactor binding to the Hincll/A/ul probe in a dose-dependent manner(Fig. 28). The competition for binding by this fragment was essentiallyequivalentfor allof the bands. A promoter fragment probe consistingof the 66-bp Rsal/A/ul fragment (plus 16 basesof vector sequence) was used as a substrate for CSNE factor binding (Fig. 3). This probe yielded a set of multiple mobilityshift products that were qualitatively similarto those
A Competitor DNA Molar Excess IJ PRL+ Extract -
DrDbe
•,
-73 RIO I
-220 Tag I
-8 flIUI miiill
-
264
192 AC-C I
192bp I
bD 4
I -31
-8 RIU I
192 bp
,g2 SC: :
I
1. The cp35 Gene Promoter Region The cp35 5’ region (-273 to +192) was subcloned from a pigeon cropsac genomic clone. The upper line represents a /-/incll/Accl subclone and restriction enzyme sites (Taql, Rsal, and Alul) which were used to generate fragments for gel-shift assays and competition experiments. The lower line represents a minimal promoter deletion mutant (Acp35) that was synthesized by PCR so as to include the region from -31 to +192.
I
Hincll/Taql
I
Taql/Rsal
50
100
500
1000
50
100
500
IO00
+
+
+
+
+
+
+
+
I
I
B Competitor DNA Molar Excess 0 PRL+ Extract -
DrObe -271 llinc II
I o +
I 0
+
Rsal/Alul 50 100
+
+
I
500 1000
+
+
+
2. Gel-Shift Assay of cp35 Promoter-Binding Proteins Nuclear extracts from PRL-stimulated cropsac (PRL+ CSNE) were incubated with a 264-bp (Hincll/A/ul) fragment (10“ cpm) of the cp35 5’-flanking region in 20-hl reactions containing 5 pg PRL+ CSNE proteins. The reaction mixture was incubated for 30 min (30 C) and separated through 4% nondenaturing PAGE. Competitor DNA fragments (Hincll/Taql and Taql/Rsal, A; Rsal/A/ul, B) were added at up to lOOO-fold molar excess as labeled. The complexes were not competed by either the Hincll/Taql or the Taql/Rsal competitor (A). The 264-bp HincIlAlul probe DNA was completely displaced by the 66-bp F&al/ Alul fragment(B). Fig.
Fig.
derivedwith the 263-bpHincll/Alul probe.The mobilities of the bands cannot be directly compared between probes because of differences in probe size and the lengths of the gels. However, the complexities of the patterns were similar. Binding to the Rsal/A/ul probe was potently displacedin a dose-dependentmannerby
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced Transcription Factor
Extract
(Dg)
377
12
18
8
6
4
2
12
18
8
6 4
2
8
probe 1 -(
probe 2+ Probe I
Rsal/Alul
I
-32
to -73
I
3. Binding of CSNE Factors to cp35 Promoter Region Fragments Two probes corresponding to the Rsal/Alul promoter fragment (probe 1) and bases -32 through -73 (probe 2) were end-labeled. Each probe was reacted with various amounts of nuclear extract from PRL-stimulated cropsac, and complexes were separated through 4% PAGE and visualized by autoradiography. The amount of extract protein in each lane is marked above it, and the two probes are labeled below. Arrows mark the migration of the unbound probes. Fig.
competitor R.sal/Alul fragment but was not competed by a consensusTATA-box oligo (not shown). A probe prepared by labelinga double-stranded(ds) DNA oligodeoxynucleotidecorrespondingto bases-32 to -73 (inclusive) bound CSNE factors (Fig.. 3) to produce multiplegel-shift complexessimilarto the pattern with the Rsal/A/ul promoterfragment. Becauseof the difference in the sizes of the probes, it is not possibleto determinehow the variousbandswith each proberelate to one another. However, it is clear that the small-32, -73 fragment contains elements that bind multiple CSNE factors. The binding of multiple proteins to the co35 promoter-proximal region suggests that some pertinent regulatory elements are located within this region. PRL Dependence of cp35 Promoter-Binding Factors To study the relationshipbetween CSNE DNA-binding factors and PRL stimulation,the Rsal/A/ul probe was reacted with proteins from both hormonally unstimulated (PRL-) and PRL-stimulated(PRL+)CSNE (Fig. 4). Bindingactivity for the Rsal/A/ul probe was completely absentfrom the PRL- CSNE. In other experiments(not shown), PRL- CSNE likewise had no binding factors for any sequenceswithin the entire Hincll/A/ul 264-bp promoter fragment. Transcription of adml and cp35 Genes in HeLa Cell Nuclear Extract HeLa cell nuclearextract was usedto provide a system in which to study the transcription of co35 template
DNAs. As positive controls, a clone of the adenovirus major late (adml) gene (pML4) was digestedwith Pvull to yielded a 207-nucleotide(nt) run-off RNA and with Hindlll to yield a 118 nt RNA. When these substrates were used in transcription reactions (Fig. 5A, lanes 2 and 3) the adml promoter yielded run-off products of the expected sizes. The background reactants in the absenceof templateDNA (Fig. 5A, lane 1) includea set of low mol wt products (i.e. uridylated tRNAs, etc.) that we show on the gelsfor reference.With co35 promotertemplates, HeLa cell nuclear extract accurately transcribed the predicted run-offs (192 and 168 bp) (Fig. 5A, lanes4 and 5). To determinethe RNA polymeraseII (pol Il)-dependenceof the run-off transcripts, a-amanitin(1 pg/ml) was added (Fig. 58). The ol-amanitintotally suppressed the synthesisof runoff RNAs from either the adml or cp35 promoter. However, a-amanitindid not inhibit the labelingof smallbackground RNA products. Templatedependentsynthesisof both adml andcp35 RNAswas, therefore, a function of pol II. Pl?L+CSNE Synergistically Stimulated cp35 Transcription We designeda set of complementationexperimentsto study the effects of CSNE on cp35 gene transcription. We reasonedthat factors present in PRL’ CSNE that specificallybind the cp35 regulatory region might also affect the run-off transcription of the gene. Because
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL 378
ENDO.
1992
PRL Extract
Vol6
(fig)
0 5
No. 3
+
18 5 Template
DNR
no
I---AdML---I
I---cp35---I
207+ 192+
118+
DNA
probe +
n-amanitin
l--none--l -
+
I--AdML--I -
I--cp35--I +
-
+ I
Fig. 4. Gel-Shift
Assays for PRL Stimulation of co35 PromoterBinding Proteins The binding conditions were identical to Fig. 2. PRL- CSNE proteins (-) were from unstimulated cropsac, whereas PRL+ CSNE proteins (+) were from cropsac stimulated by PRL injection. The R.sal/A/ulfragment was used as the probe. In
contrast with the PRL+ extract, no binding activities were detected in PRL- CSNE. HeLa extract was competent to transcribe cp35 (Fig. 5A), but would not be expected to contain any tissueor hormone-specific factors, it was used to supply core requirements for transcription. In preliminary experiments we determined that CSNE, prepared according to the methods described, did not have an independent transcriptional activity (not shown, see also Fig. 6, lane 4). CSNE was mixed in specified ratios with HeLa extract (on ice), template was added to the mixed extracts, and run-off transcripts were synthesized (see Materials and Methods for additional details). To titrate the level of basal transcription, increasing HeLa extract was added, At the lowest levels of HeLa extract there was no basal transcription and no effect of CSNE (Fig. 6, lanes 3 and 4). CSNE factors stimulated co35 run-off transcription at levels of HeLa extract which yielded detectable basal transcription. The synergism between HeLa factors and CSNE was observed even
Fig. 5. Cell-Free
Transcription Assay of adml and cp35 DNA in HeLa Cell Nuclear Extract A, adml DNA (pML4) was linearized with Pvull to yield a 207-bp transcription template (lane 2) and with /findIll to yield a 118-bp template (lane 3). The control experiment contained no template DNA (lane 1). Two cp35 templates were prepared by digestion with Accl (lane 4, 192 bp) and Fokl (lane 5, 168 bp). Transcripts were assayed by electrophoresis on a 7 M
urea-20%gel and autoradiography.The expected positionsof the run-off transcripts relativeto coelectrophoresedmarkers are shown by the arrows at left. B, The sensitivity of run-off transcription to inhibition by a-amanitin was tested. a-Amanitin was added to a final concentration of 1 Kg/ml where indicated. Templates were Pvull digested adml (AdML) and Accl digested co35 (~~35). A 15% polyactylamide gel was used, and the predicted run-off transcripts are marked by the arrow at left
(ROT).
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
379
PRL-Induced Transcription Factor
PIa+
eHtract
9.4
9.8
HeL.3 extract
2.0
2.0
0.2
0.2
0.4
0.4
9.2 0.8
0.8
9.0 1.0
8.0
1.0
2.0
2.0
10
11
12
ROT -a
12
3456789
6. Enhancement of in Vitro Transcription from the cp35 Gene with PRL+ CSNE DNA for the adml template or cp35 template was added to mixtures of HeLa cell nuclear extract (HeLa extract) and PRL+ CSNE (PRL+ extract) at varying ratios as shown at the fop. Lane numbers are labeled below. The products were separated on 15% PAGE, and the runoff transcripts are marked by the arrow at left (ROT). Fig.
at levels of HeLa extract wherein basal transcription was high (Fig. 6, lanes 11 and 12). It is important to note that the effect of CSNE factors was not simply additive with HeLa core factors. The stimulation by CSNE (measured by densitometry of the autoradiograms) ranged from 1.3- to 8.7-fold and averaged 3.4 f 1.8-fold (mean f SEM). To test promoter specificity we performed a parallel experiment in which PRL+ CSNE was added to transcription reactions using adml as the template (Fig. 7). The figure shows a portion of the titration of HeLa extract with CSNE. In contrast to co35 the adml promoter was not activated by factors from the CSNE. Compared with transcription in the absence of CSNE, the level of run-off synthesis of adml was consistently
Template PM+ extract Hela extract
I________
fl,,,,.,L
________
9.0 1.0
1.0
1
8.0
2.0
lower in the presence of CSNE. While the nonspecific suppression of adml by CSNE was modest, it is noteworthy that the synergistic activation of cp35 transcription took place in the presence of proteins that were inhibitory to the adml strong constitutive promoter. Gel retardations indicated that protein binding to the cp35 promoter was PRL-dependent (Fig. 4). Therefore, we tested the effect of CSNE from PRL- animals on run-off transcription of the cp35 and adml genes. In contrast to PRL+ CSNE (Fig. 6), PRL- CSNE consistently inhibited transcription of the cp35 template (Fig. 8). The adml promoter was also partially inhibited in the presence of PRL- CSNE. The result with adml was identical in the presence of either PRL+ CSNE (which is shown in Fig. 7) or PRL- CSNE (not shown). We considered the possibility that the apparent suppression of transcripts by PRL- CSNE was caused by
2.0
Template PRL- extract HeLa extract
I-------
1.0
-cp35-
9.0 1.0
_______
[ fldML
8.0
2.0
2.0
2.0
ROT + ROT -)
Fig. 7. PRL+ CSNE Did Not Stimulate the in Vitro Transcription of the adml Promoter The adml template was transcribed in the presence of either HeLa cell nuclear extract alone or HeLa extract mixed with PRL+ CSNE, and RNA run-off transcription was assayed as before. Legend is as in Fig. 6.
Fig. 6. Inhibition of cp35 Transcription by Unstimulated Cropsac Extract (PRL- CSNE) co35 template was added to mixtures of HeLa cell nuclear extract and PRL- CSNE at the ratios indicated at the too. Legend and assay are as in Fig. 6.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO. 1992
Vol6 No. 3
380
ribonucieases.However, RNA degradation would be expected to be similaron both co35 and adml transcripts. In addition, experimentswith a deletion mutant (Acp35, see below)were not consistent with any RNA degradationeffects. CSNE Did Not Affect Transcription of a Deletion Mutant, Acp35 To test whether the effects of CSNE proteins were determinedby sequences5’ of the TATA-box we deleted the upstreamregionand transcribedthe resulting template in vitro. By PCR synthesis we prepared a transcription template (Acp35, Fig, 1) that contained bases -31 to +192 of cp35. Transcription of Acp35 was unaffectedby either CSNE protein fraction (Fig. 9). It is important to note that the Acp35 promoter, containing only a BarnHI-linkeredcp35 TATA-box, and sequencesdownstreamof it, was sufficient to synthesize the predicted run-off transcript in a HeLa extract assay. The run-off product appeared as a relatively diffuse band in all reactions with Acp35, whereas the wild-type cp35 promoter always yielded a sharp RNA band. This observation suggeststhat the precisionof initiationat the transcriptionstart point can be affected by the presenceof sequencesupstreamof TATA. Not only was there no activation by PRL’ nuclearfactors, but also the inhibitory effect of PRL- CSNE was completely absenton Acp35. DISCUSSION By virtue of its protein binding and factor-sensitive transcription,we have shown that the promoter-proxi-
Template PRL+extract PRL-extract Hela extract
A Ct’ 35
4.0 1.0
1.0
4.0 1.0
ROT +
Fig. 9. Cell-Free Transcription IC If S-Deleted cp35 Template (Acp35) in Nuclear Extracts The Acp35 template (-31 to +192) was made by PCR, propagated in pGEM3 vector, excised by restriction enzyme digestion with SamHI, and gel purified. Acp35 DNA was added to HeLa nuclear extract mixed with PRL+ or PRL- CSNE and assayed as in Fig. 6.
mal area of the cp35 5’-flanking regioncontains one or moreelementsby which PRLcan regulatecp35 expression. There are likely to be other regions of cp35 that contain additional regulatory elements. However, the correspondenceof factor bindingand synergistic transcriptionalactivation in the proximal regulatory region suggeststhat these sequencesare a substrate for at least someof the important mechanismsof regulation by PRL. PRL and its close relatives(GH, placentallactogens, etc.) are distinguishedfrom other classicalprotein hormones by the generalization that they cause slow changes in cell differentiation state and proliferation, ratherthan rapid metabolicalterations(11). In this sense they are more akin to the growth factors than to classical tropic hormones.This fundamentaldistinction is correlated with several other biochemicaland physiologicalobservations. Receptorsfor PRL belong to a superfamilyof cytokine receptors (10). The first discovered membersof this family were the GH (12) and PRL (7) receptors. Subsequently,receptors for interleukins2, 4, 6, and 7, granulocyte-macrophagecolony-stimulatingfactor, erythropoetin, etc., were shown to share a common domainstructure (8). None of the receptor sequences predict known signaltransduction pathways. In order to understandPRL’s signalingmechanisms, it is important to preciselydefine the postreceptor cellular responsesof target tissues.Our efforts have been directed toward examiningthe regulationof cp35 as a specificresponseto PRL receptor activation (1, 3, 6). The close relationshipof cp35 to other anxl genes that are not PRL-responsiveprovided us a justification for assuming that PRL-dependent regulatory sequenceswere probably located in the nonconserved5’ regionof the gene (1). With this backgroundwe examined potentialcp35 regulatory factors. DNA-Binding Proteins An a priori requirementfor selective regulationof gene transcriptionis sequence-specificnucleotidebindingof factors which are responsive, either directly or indirectly, to a regulatinghormone. Becausethe 5’ end of cp35 is most different from other anxl, we have suspected that the novel PRL regulationof cp35 is encoded in this region. Nuclear proteins that bind to the cp35 promoter region are dependent on PRL (Fig. 4). By comparison of competition and bindingpatterns, it seemsthat the bindingactivities observed in PRL’ CSNE interact with basesfrom -32 to -73. There were multiple complexes formed by PRL+ CSNE with either the 264-, 73-, or 42-bp promoter fragments. It is not possibleto know whether these were multimericcomplexesof a singleprotein, or multiple proteins interacting to yield different complexes. We favor the latter interpretation (multiplecomponent proteins) on the basis that competition with excess DNA resulted in paralleldisplacementof all complexes
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced
Transcription
Factor
381
(Fig. 2B). If a single protein formed multimers, one would expect that monomers would be favored as the quantity of competitor DNA increased. Direct knowledge of the stoichiometries of DNA-binding complexes will require purification and/or cloning of the relevant factor(s). The exact sequences to which PRL-induced DNA binding factor(s) bind within the 42-bp 5’ region (-32 to -73) have not yet been determined. One candidate is a region of multiple dyad symmetry located from bases -45 through -33. This region contains an 8member element (CACtgGTG) nested in a 13-member element (CACTcgtgcAGTG) (1). Neither of these signatures is closely related to any known transcription factor binding site. Their appearance within a relatively small fragment that binds specific proteins, and their proximity to the TATA-box, are compelling reasons to hypothesize that they may be of consequence for the regulation of co35 The Rsal/A/ul co35 promoter fragment has no sites which conform to well characterized transcription factor binding sites (1). In spite of the lack of known binding sequences, this promoter-containing region was clearly a substrate for DNA binding proteins that caused multiple gel mobility-shift products. In addition, our transcription experiments demonstrated that the region contains sequences that are capable of mediating hormone-dependent transcriptional activation. In order to determine whether other PRL-regulated genes contain sequences that are analogous to the co35 promoter region, a more specific definition of the functional sequence(s) will be needed. Transcriptional
Enhancement
in Vitro
By complementing a standard extract of HeLa cell nuclear proteins with CSNE we have shown that cropsac from PRL-treated, but not unstimulated, birds contains stimulatory activity for the co35 gene promoter. The CSNE prepared in these experiments was not capable of independently supporting transcription, and no attempt was made to optimize the preparation of the CSNE to produce an independently active transcription system. The degree of transcription synergism by CSNE was a function of the concentration of core factors in the HeLa extract. When we titrated increasing amounts of HeLa extract against the cropsac proteins there was no detectable co35 transcription at the lowest amounts of HeLa proteins. At the highest level of HeLa factors, basal transcription was relatively high, but CSNE remained stimulator-y. The synergistic nature of transcription activation argues that the mechanism of co35 stimulation involves interactions between proteins present in the two extracts. Such interactions might include stabilization of initiation complexes by factor(s) present in CSNE. The stimulatory activity of PRL’ CSNE was not observed when the adml promoter was used as the transcription template. In fact, transcription from the
adml promoter was consistently inhibited by CSNE. The inhibition of adml transcription might be a trivial consequence of adding a crude nuclear protein extract, since CSNE also appeared to suppress other nontranscriptional reactions (low mol wt bands on gels). Even so, the degree to which CSNE stimulated co35 transcription seems even more dramatic when one takes into consideration the nonspecific inhibitory activity of the extract. A deletion experiment (Fig. 9) showed that the PRL responsive sequences are in the region which is upstream of the TATA box. Therefore, in light of our gel retardation data, we infer that PRL-responsive sequences are located between -32 and -73 of cp35. Whenever we have purified and/or cloned binding factors in hand we will test other mutant forms of this region in chimeric promoters to examine this inference. In vitro transcription of cp35 in the presence of PRLCSNE was suppressed (Fig. 8). This was an unexpected finding. On gel retardations PRL- CSNE did not contain any activities which bound the cp35 promoter region. Taken alone these results suggest that cp35 inhibition by PRL- CSNE might result from an indirect action on the gene. Such an interaction could involve destabilizing the core transcription complex or depleting the system of necessary factor(s) by binding or degradation. It appears that the inhibition was not sequencespecific, since aciml was also inhibited, although not as effectively as cp35. The greater sensitivity of the cp35 promoter to inhibition might simply be a consequence of differences in their relative promoter strength. The data are clear that there was a dramatic suppression of cp35 by PRL- CSNE; however, we remain open about any mechanism that might be ascribed to this observation. Other PRL-Regulated
Genes
Our finding that the cp35 promoter is stimulated by PRL’ CSNE correlates with observations that PRL transcriptionally regulates several specific genes in other systems (12-14). Most work has been done on mammary gland milk protein genes. Although it is well documented that milk protein genes are transcriptionally responsive to PRL, the &-acting elements that mediate their regulation, and the associated proteins, have remained elusive. Using promoter/reporter expression in a mammary gland-derived cell line, some of the regulatory activities of a casein promoter were localized in the areas of -170 to -285, and beyond -330 bp in the 5’-flanking region of the /3-casein gene (15, 16). In a recent paper, additional sites of potential importance for p-casein gene regulation were localized to five sequences between -36 and -180 of the casein promoter. It is not clear which, if any, of these sites play a role in mediating a PRL effect on the casein gene. Additional promoter/ reporter expression studies have demonstrated control by PRL of the B-lactoalobulin (14) oromoter in CHO
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
MOL 382
ENDO.
1992
Vol6
cells cotransfected with promoter/chloramphenicol aminotransferase constructs and a cloned PRL receptor. Much interest has focused on the fact that PRL is a
more broadly cytotropic factor than indicated by its association with mammalian pregnancy and lactation (17, 18). For example, PRL is necessary for activation of lymphocytes stimulated by either mitogens or lymphokines (19). Yu-Lee and coworkers (13) cloned cDNAs of several genes which were induced by PRL in a T-cell lymphoma line, one of which encodes interferonregulatory factor 1. The mechanisms by which PRL stimulates gene expression and mitogenesis in lymphocytes, or other cell types, are unknown. We have shown that PRL can act on a specific promoter fragment to cause transcriptional stimulation of co35 in a cell-free system. The events by which PRL causes expression of factors responsible for cp35 gene transcription will continue to be examined by genetic and biochemical reconstitution. These events are likely to involve novel transcription regulatory factors and novel mechanisms for their activation.
MATERIALS Isolation
AND METHODS
of Promoter
Fragments
of the cp35
Gene
A 5’-Hincll subclone of the cp35 gene (1) (pGcpl.9H2) was used as the starting material to produce substrates for these experiments. This clone was deleted by Accl digestion to yield a 463-bp subclone (pGcp5H2Al) that included 264 bases of 5’-flanking sequence and approximately 200 bases encoding exon 1 and part of intron I of the cp35 gene (Fig. 1). Promoter region fragments for the binding studies were prepared by restriction enzyme digestion of pGcp.5H2A1, followed by gel purification. Templates for in vitro transcriptions were prepared by excising the insert of pGcp5H2Al and gel purifying the insert DNA. A deleted co35 promoter containing only the TATA-box and downstream sequences was made by polymerase chain reaction (PCR) synthesis. Amplification was done with Pvulllinearized oGcp.5H2Al DNA as the template. An SP6 promoter primer served as right PCR primer,.and a BarnHI-tailed TATA box sequence (GGGGGATCCTATAAAAGCATGACAAGCCC) as the left primer so as to delete the 5’upstream sequence above the TATA box. PCR (30 cycles) was processed in 50 UI 50 mM KCI. 10 mM Tris-HCI pH 8.4, 1.5 mM MgC12, 100 pg/ml gelatin, 6.25 mM of each ‘primer, 200 pM each dNTP, 100 ng DNA, and 1.25 U Taq DNA polymerase. PCR products were analyzed on a 1.5% agarose gel, and a 284-bp fragment was purified from the gel. This fragment was digested by HindIll and BarnHI, inserted in pGEM3, and propagated. The resulting Acp35 clone was confirmed by sequencing. For transcription, this fragment was excised by BarnHI digestion and gel purified. Adenovirus
Major
Late
Promoter/Template
A plasmid clone of the adenovirus major promoter and transcript (pML4) was purified Pvull and Hindlll to yield run-off transcripts bases, respectively. Nuclear
late gene (adml) and digested with of 207 and 118
Extracts
A transcription-qualified extract of HeLa cell nuclei, prepared as described by Cai and Luse (20) was a gift of Donal Lute
No. 3
(University of Cincinnati). For analysis of PRL-regulated activities we prepared nuclear extract from cropsac epithelial cells fCSCI of oiaeons (Columba livia). PRL INIH-ovine PRL (oPRL)i9, gift of &e National Hormone and Pituitary Program, BaItimore, MD] was injected at a dose of 0.2 mg/day im for 5 days before killing the animals by COn inhalation and decapitation. CSC of PRL-stimulated and unstimulated tissues were dispersed by digestion with collagenase and dispase (Boehinger Mannheim Biochemicals, Indianapolis, IN) (in RPMI-1640 medium, -5 ml/g tissue for 30 min at 37 C). After filtering through cheese cloth the CSC isolates were washed by three rounds of centrifuging (300 x g, 10 min, 4 C) and resuspending in buffer containing no enzymes. The resulting CSC were counted and isosmotically lysed in 0.32 M sucrose buffer [20 mM Na-HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 10 mM KCI, 1 mM dithiothreitol (DTT), 0.1 mM EDTA, and 0.1 mM EGTA]. Nuclei were purified through a 2 M sucrose cushion in the same buffer. The purified CSC nuclei were extracted by a modification of the Shapiro et al. (21) method. Briefly, CSC nuclei were gently lysed in 9 vol nuclear resuspension buffer (20 mM Na-HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, 25% glycerol, and 0.1% Nonidet P40) and 1 vol 4 Csaturated (NH&SO4 solution. The extracted proteins were precipitated in 33% (NH&SO4 and dialyzed exhaustively against 20 mM Na-HEPES, pH 7.9,20% glycerol, 100 mM KCI, 0.2 mrv EDTA. 0.2 mM EGTA. and 2 mM DTT at 4 C. The integrity of extracts from PRL+ and PRL- CSNE were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and appeared equivalent. Gel Mobility-Shift
Assays
The DNA binding reactions were performed at 30 C for 20 min in a vol of 20 ~1, following standard methods (22). The reaction mixture contained 10 mM Na-HEPES pH 7.9, 50 mrv NaCI, 0.5 mM EDTA, 10% glycerol, 1 mM DTT, 5 mrv MgCI*, 2 pg BSA, 2 pg poly (dl-dC):poly (dl-dC), 10 wg nuclear extract protein, and 10,000 cpm [32P]DNA probe (-0.5 ng). DNA probes were 5’ end-labeled with Tq polynucleotide kinase. After incubation, samples were electrophoresed through 4% nondenaturing polyacrylamide gels. Electrophoresis was done at 10 V/cm, and the products were exposed to x-ray film at -80 C. In the competition experiments, unlabeled competitor DNAs were mixed with the reaction buffer, and nuclear extract before 32Pprobe was added. Each experiment was replicated at least twice. Cell-Free
Transcription
Cell-free transcription was modified from the method described by Cai and Luse (20). For 20-~1 reactions (final vol) the mixture contained 10 mM Na-HEPES, pH 7.9, 7.5 mM MgCI,, 75 mM KCI, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 10% glycerol along with nuclear extracts (per experimental design). After mixing the extracts with reaction buffer on ice, 12 pg/ml template DNA were added. The reactions were preincubated for 20 min at 30 C to allow formation of protein complexes with the templates. After preincubation, 1 gl 250 PM ATP, CTP, GTP, and 1 ~1 (10 &I) c@*P]UTP (800 Ci/mmol) were added, and the samples were incubated for 5 min (30 C). ATP, CTP, GTP, and UTP were then added to 500 KM, and the reactions were incubated for an additional 10 min (30 C). The transcripts were immediately treated with 20 pg/ml protease K in 25 mM EDTA and 0.5% sodium dodecyl sulfate for 60 min (37 C), and extracted with phenol and chloroform. The run-off RNAs were precipitated with ethanol, denatured in electrophoresis loading buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanole FF), and analyzed on 7 M urea-PAGE.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
PRL-Induced
Transcription
Factor
383
Acknowledgments
10.
We thank Donal Lute for providing reagents and helpful advice. Received August 29, 1991. Revision received December 13,199l. Accepted January 6, 1992. Address requests for reprints to: Dr. Nelson D. Horseman, Department of Physiology and Biophysics, University of Cincinnati, Cincinnati, Ohio 45267. This work was supported by NSF Grant DCB-6996208 and NIH Grant DK-42461.
11.
12.
13.
REFERENCES 1. Hitti YS, Horseman ND 1991 Structure of the gene encoding columbid annexin Icp35. Gene 103:185-l 92 2. Horseman ND 1989 A prolactin-inducible gene product which is a member of the calpactin/lipocortin family. Mol Endocrinol3:773-779 3. Pukac LA, Horseman ND 1987 Regulation of cloned prolactin-inducible genes in pigeon crop. Mol Endocrinol 1:188-194 4. Huebner K, Cannizzaro LA, Frey AZ, Hecht BK, Hecht F, Croce CM, Wallner BP 1988 Chromosomal localization of the human genes for lipocortin I and lipocortin II. Oncogene Res 2:299-310 KR, Ganjianpour M, Frost SC, Nick HS 1991 5. Horlick Annexin-l regulation in response to suckling and rat mammary cell differentiation. Endocrinology 128:1574-l 579 6. Horseman ND 1990 Hormonal regulation of an avian annexin I gene. Biochem Sot Trans 18:1113-l 115 7. Boutin J-M, Jolicoeur C, Okamura H, Gagnon J, Edery M, Shirota M, Banville D, Dusanter-Fourt I, Djiane J, Kelly PA 1988 Cloning and expression of the rat prolactin receptor, a member of the growth hormone/prolactin receptor gene family. Cell 53:69-77 8. Patthy L 1990 Homology of a domain of the growth hormone/prolactin receptor family with type 3 modules of fibronectin. Cell 61 :13-l 4 9. Eisenstein RS, Rosen JM 1988 Both cell substratum regulation and hormonal regulation of milk protein gene expression are exerted primarily at the posttranscriptional level. Mol Cell Biol 8:3183-3190
14.
15.
16.
17. 18.
19.
20. 21.
22.
Rosen JM, Jones WK, Rodgers JR, Compton JG, Bisbee CA, David-lnouye Y, Yu-Lee L-Y 1986 Regulatory sequences involved in the hormonal control of casein gene expression. Ann NY Acad Sci 464:87-99 Horseman ND 1987 Models of prolactin action in nonmammalian vertebrates. In: Rillema JA (ed) Actions of Prolactin on Molecular Processes. CRC Press. Boca Raton. DD 41Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI 1987 Growth hormone receptor and serum binding protein: purification, cloning and expression. Nature 330:537-543 Yu-Lee L-Y, Hrachovy JA, Stevens AM, Schwarz LA 1990 Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol Cell Biol 10:3087-3094 Lesueur L, Edery M, Paly J, Clark J, Kelly PA, Djiane J 1990 Prolactin stimulates milk protein promoter in CHO cells cotransfected with prolactin receptor cDNA. Mol Cell Endocrinol71 :R7-R12 Doppler W, Hock W, Hofer P, Groner B, Ball RK 1990 Prolactin and glucocorticoid hormones control transcription of the P-casein gene by kinetically distinct mechanisms. Mol Endocrinol 4:912-919 Doppler W, Groner B, Ball RK 1989 Prolactin and glucocorticoid hormones synergistically induce expression of transfected rat P-casein gene promoter constructs in a mammary epithelial cell line. Proc Natl Acad Sci USA 86:104-l 08 Nicoll CS 1980 Ontogeny and evolution of prolactin’s functions. Fed Proc 39:2563-2566 Nagy E, Berczi I 1991 Hypophysectomized rats depend on residual prolactin for survival. Endocrinology 128:2776-2784 Hartman DP, Holoday JW, Bernton EW 1989 Inhibition of lymphocyte proliferation by antibodies to prolactin. FASEB J 3:2194-2202 Cai H, Luse DS 1987 Transcription initiation by RNA polymerase II in vitro. J Biol Chem 262:298-304 Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A highefficiency HeLa cell nuclear transcription extract. DNA 7:47-55 Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning: A Laboratory Manual, ed 2, ~012. Cold Spring Harbor Laboratory Press, Cold Spring Harbor
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 05:57 For personal use only. No other uses without permission. . All rights reserved.
