© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
J Periodont Res 2015; 50: 189–196 All rights reserved
JOURNAL OF PERIODONTAL RESEARCH doi:10.1111/jre.12192
Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-jB pathway
M. Wan1, J. Liu1, X. Ouyang1,2 1
Department of Periodontology, Peking University School and Hospital of Stomatology, Beijing, China and 2National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing, China
Wan M, Liu J, Ouyang X. Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-jB pathway. J Periodont Res 2015; 50, 189–196. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Background and Objective: Porphyromonas gingivalis has been shown to actively invade endothelial cells and induce vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1) overexpression. Nucleotidebinding oligomerization domain 1 (NOD1) is an intracellular pattern recognition reporter, and its involvement in this process was unknown. This study focused on endothelial cells infected with P. gingivalis, the detection of NOD1 expression and the role that NOD1 plays in the upregulation of VCAM-1 and ICAM-1. Material and Methods: The human umbilical vein endothelial cell line (ECV-304) was intruded by P. gingivalis W83, and cells without any treatment were the control group. Expression levels of NOD1, VCAM-1, ICAM-1, phosphorylated P65 between cells with and without treatment on both mRNA and protein levels were compared. Then we examined whether mesodiaminopimelic acid (NOD1 agonist) could increase VCAM-1 and ICAM-1 expression, meanwhile, NOD1 gene silence by RNA interference could reduce VCAM-1, ICAM-1 and phosphorylated P65 release. At last, we examined whether inhibition of NF-jB by Bay117082 could reduce VCAM-1 and ICAM- 1 expression. The mRNA levels were measured by real-time polymerase chain reaction, and protein levels by western blot or electrophoretic mobility shift assays (for phosphorylated P65). Results: P. gingivalis invasion showed significant upregulation of NOD1, VCAM-1 and ICAM-1. NOD1 activation by meso-diaminopimelic acid
Xiangying Ouyang, DDS, PhD, Department of Periodontology, Peking University School and Hospital of Stomatology, 22 Zhongguancun Nandajie, Haidian District, Beijing 100081, China Tel: +86 10 82195495 Fax: +86 010 62173402 e-mail: [email protected] Key words: endothelial cell; intercellular
adhesion molecule-1; nucleotide-binding oligomerization domain 1; vascular cell adhesion molecule 1 Accepted for publication March 26, 2014
190
Wan et al.
increased VCAM-1 and ICAM-1 expression, and NOD1 gene silence reduced VCAM-1 and ICAM-1 release markedly. The NF-jB signaling pathway was activated by P. gingivalis, while NOD1 gene silence decreased the activation of NF-jB. Moreover, inhibition of NF-jB reduced VCAM-1 and ICAM-1 expression induced by P. gingivalis in endothelial cells. Conclusion: The results revealed that P. gingivalis induced NOD1 overexpression in endothelial cells and that NOD1 played an important role in the process of VCAM-1 and ICAM-1 expression in endothelial cells infected with P. gingivalis through the NF-jB signaling pathway.
The detection of microbial infection by the human innate immune system is highly dependent on the recognition of pathogen-associated molecular patterns, structural components conserved among pathogens and pattern recognition receptors (PRRs). Nucleotide-binding oligomerization domain (NOD) proteins are one type of PRRs. Because NOD proteins localize in the cytoplasm, they are known as intracellular PRRs (1). NOD1, a type of NOD protein, specifically detects L-Ala-c-D-glutamyl-meso-diaminopimelic acid (Tri-DAP), a compound found in nearly all peptidoglycans (2). In the cardiovascular system, endothelial cells are usually the first structures to be exposed to microbial components, which are detected through PRRs (3). Chlamydophila pneumonia (4), Listeria monocytogenes (5) and Orientia tsutsugamushi (6) have all been reported to increase NOD1 expression in endothelial cells. NOD1 has also played an important role in the expression of interleukin in endothelial cells infected by these three pathogens. P. gingivalis, a gram-negative, anaerobic bacteria, is an important periodontal pathogen. P. gingivalis has also been detected in atherosclerotic plaques (7,8). This means that P. gingivalis has the potential to come into contact with endothelial cells. In vitro studies have shown that P. gingivalis actively invades endothelial cells (9). Associations between P. gingivalis infection and vascular endothelial activation have been reported, including lipopolysaccharide stimulation (10,11) and intracellular (12–15) upregulation of vascular cell adhesion
molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1). P. gingivalis-induced lipopolysaccharide stimulation occurs via Toll-like receptor 2 and Toll-like receptor 4 (10,16). How the endothelial cells recognize intracellular P. gingivalis and initiate this response is still unknown. The effect of NOD1 in endothelial cells infected with P. gingivalis remains to be identified. This study hypothesizes that NOD1 plays an important role in the increased expression of VCAM-1 and ICAM-1 in these endothelial cells.
Material and methods Bacterial strains culture
P. gingivalis W83 (supplied by Prof. Chern-Hsiung Lai of Kaohsiung Medical University, Taiwan, China) was cultured in brain–heart infusion (BHI; Bacto, Sparks, MD, USA) broth agar plates supplemented with 5% defibrinated sheep blood, 5 lg/mL hemin and 0.4 lg/mL menadione while under anaerobic conditions (5% CO2, 10% H2 and 85% N2) at 37°C. Cultures were grown for 5–7 d. They were then inoculated into fresh BHI broth (supplemented with 5 lg/mL hemin and 0.4 lg/mL menadione), grown for an additional 24 h and subsequently used for experimentation. Cell culture
Human umbilical vein endothelial cell line ECV-304 (obtained from the ATCC, Manassas, VA, USA) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco,
Paisley, Scotland, UK) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA) in 5% CO2 at 37°C. Cells were inoculated into cell culture dishes at a concentration of 106 cells/mL, grown overnight and subsequently used for experimentation. Infection protocol
P. gingivalis W83 was inoculated into fresh BHI broth (supplemented with 5 lg/mL hemin and 0.4 lg/mL menadione) and grown for 24 h. Cells were then washed three times with phosphate-buffered saline (PBS, pH 7.2), and resuspended in DMEM supplemented with 10% fetal bovine serum. Optical density of the bacterial resuspension was measured at 600 nm and further diluted to an optical density of 0.5, corresponding to a concentration of 108 CFU/mL. The bacterial resuspension were then inoculated on to the ECV-304 monolayer at a multiplicity of infection of 1 : 100. After incubating for 2 h, the supernatant was replaced with fresh DMEM containing 0.5 g/L gentamicin and 0.1 g/L metronidazole to kill extracellular bacteria (15). After an additional 2 h, cells were harvested and used for experimentation. The viabilities of ECV-304 infected with P. gingivalis, as assessed by 0.2% Trypan Blue exclusion tests, were shown to exceed 90%. Antibiotic protection and invasion assays
Invasion of P. gingivalis was quantified by detecting the number of CFU
NOD1 mediates ECV-304 cell activation recovered following antibiotic treatment (9,15). ECV-304 monolayers were infected by P. gingivalis at an MOI of 1 : 100 (108 CFU/mL bacteria to 106/mL cells). After incubating for 2 h, half of the cell monolayers were washed by PBS to remove the unattached bacteria and lysed with sterile H2O for 20 min. Then the lysates were diluted, plated on BHI broth agar and incubated under anaerobic conditions for 7 d. The CFUs of P. gingivalis that had adhered to and invaded cells were enumerated. For the other half of the cell monolayers, after P. gingivalis infection, PBS douche and antibiotic protection were down, the cells were lysed with sterile H2O for 20 min. Then the lysates were diluted, plated on BHI broth agar plate and incubated under anaerobic conditions for 7 d. The CFUs of invasive bacteria were counted, and the invasion efficiency was expressed as the percentage of the initial inoculum recovered after invasion assay. The invasion assays were performed in triplicate. RNA interference in EVC-304
RNA interference experiments were done as described previously (17): the siRNAs targeting NOD1 (sense: UUCUGUUUGGCUUUGGACAACAGCC; antisense: GGCUGUUG UCCAAAGCCAAACAGAA) were purchased from Invitrogen (San Diego, CA, USA). ECV-304 cells were transfected for 48 h using Lipofectamine 2000 (Invitrogen) and 100 pM siRNA. Cells transfected with Lipofectamine 2000 plus scrambled siRNA were used as a control group (Roche, Indianapolis, IN, USA). Transfection efficiency was assessed by BLOCK-iT Fluorescent Oligo (Invitrogen). Both control and test groups were infected with P. gingivalis. The expression levels of NOD1, VCAM-1 and ICAM-1 were determined using real-time polymerase chain reaction (PCR) and western blotting. The viabilities of ECV-304 cells after transfection, as assessed by 0.2% Trypan Blue exclusion test, were shown to exceed 90%.
Nucleotide-binding oligomerization domain 1 activation by mesodiaminopimelic acid
Tri-DAP, an agonist of NOD1, was purchased from InvivoGen (San Diego, CA, USA). EVC-304 cells were stimulated for 24 h at a 10 lg/mL concentration of Tri-DAP. The expression levels of NOD1, VCAM-1 and ICAM-1 were then determined through real-time PCR and western blotting. Inhibition of NF-jB signaling pathway
Bay117082 (inhibitor of NF-jB) was purchased from Sigma (St. Louis, MO, USA). The endothelial cells were treated with 5 lM Bay117082 for 1 h before P. gingivalis infection. The expression levels of VCAM-1 and ICAM-1 were then determined through real-time PCR and western blotting. Real-time quantitative reverse transcription polymerase chain reaction analysis
Real-time quantitative reverse transcription (qRT)-PCR was performed in an ABI Prism 7000 Sequence Detection System (Applied Biosystems, LifeTechnologies, Warrington, UK) using SYBR green reagent (Roche). Standard real-time qRTPCR conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and finally 60°C for 1 min. All samples were performed in duplicate. In addition, all experiments were carried out in triplicate. Expression levels of the target transcripts in
191
each sample were calculated by the 2ΔΔCt method after normalization to b-actin, wherein b-actin was used as the endogenous gene control. The primers specific to NOD1, ICAM-1, VCAM-1 and b-actin are shown in Table 1. Western blot analysis
Cells were harvested and lysed in RIPA lysis buffer containing proteinase inhibitors. Western blot was then performed on cell extracts to detect protein expression levels of NOD1, VCAM-1 and ICAM-1. After measuring concentrations, protein samples were separated by electrophoresis in 10% sodium dodecyl sulfate polyacrylamide gels and transferred to polyvinylidene difluoride membranes by wet blotting. Following wet blotting, the membranes were blocked in 5% nonfat dry milk for 1 h, then exposed to antibodies specific to NOD1 (1 : 1000; Cell Signaling Technology, Danvers, MA, USA), VCAM-1 (1 : 1000; Santa Cruz, CA, USA), ICAM-1 (1 : 1000; Santa Cruz, CA, USA), phosphorylated (p)-P65 and total P65 (1 : 1000; Cell Signaling Technology), and b-actin (1 : 1000, ZSGB-BIO, Beijing, China). Membranes were maintained at 4°C and antibody exposure continued overnight. The following day they were incubated with secondary antibodies (ZSGB-BIO) for 1 h, and then observed for immunoreactive proteins using an ECL reagent (Thermo, Rockford, IL, USA). Data showed in figures represent one of three independent experiments.
Table 1. PCR primer used in this study Targer gene
Sequence 50 ? 30
Product size (bp)
NOD1
ACAGCCAGGGCGAGATAC AAAGGTGCTAAGCGAAGAG GCCTGGGAACAACCGGAAGGTG GGGTGCCAGTTCCACCCGTTC GGACCACATCTACGCTGACAATGAA TCCAGAGGGCCACTCAAATGAATCT CCTGGCACCCAGCACAAT CCGATCCACACGGAGTACTTG
189
ICAM-1 VCAM-1 b-actin
148 160 68
ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; VCAM-1, vascular cell adhesion molecule 1.
192
Wan et al. Kit (Pierce, Rockford, IL, USA). The DNA–protein complex samples were analyzed on a 6% polyacrylamide gel.
Electrophoretic mobility shift assays
Nuclear extraction and EMSA were performed as described previously (18). After infected by P. gingivalis, ECV304 monolayer was washed three times with ice-cold PBS then nuclear extracts from cells were detected using the nuclear-cytosol extraction kit (Applygen Technology, Shanghai, China) according to the manufacturer’s instruction. Then 5 lg of each nuclear extracts were subjected to EMSA using a P32-radiolabeled NF-jB oligonucleotide probe (50 -AGTTGAGGGGACTTTCCCAGGC-30 ). Binding reaction was performed using the LightShift Chemiluminescent EMSA
3.5
mRNA expression
3
C P
Data were evaluated using the Student t-test. Throughout the figures, p < 0.05 was labeled by one asterisk, p < 0.01 by two asterisks.
Results Invasion efficiency of P. gingivalis
The ability of P. gingivalis to invade endothelial cells was validated when the invasive P. gingivalis was
C
** **
Densitometric measurement
A
Statistics analysis
**
2.5 2 1.5 1 0.5 0
NOD1
VCAM-1
recovered after 7 d incubation on BHI broth agar plate. The CFUs of P. gingivalis that had adhered to and invaded cells were enumerated, and about 0.083 0.005% (8.27 9 104 CFU/mL) bacteria had a close contact with ECV-304 cells. The CFUs of invasive bacteria were also counted, and the invasion efficiency was about 0.026 0.008% (2.63 9 104 CFU/mL).
3 2.5
**
C P *
2 1.5 1 0.5 0
ICAM-1
*
NOD1
VCAM -1 ICAM -1
P. gingivalis induced nucleotidebinding oligomerization domain 1 expression in endothelial cells
Western blotting detected NOD1 protein expression in ECV-304 cells (Fig. 1B,C). NOD1 expression in cells infected with P. gingivalis was at a higher level than those observed in cells that were not infected. The mRNA expression of NOD1 in ECV-304 cells with and without P. gingivalis infection was also examined by real-time qRT-PCR (Fig. 1A). NOD1 mRNA levels in infected cells were seen to increase by 2.63 0.12-fold (p < 0.01) of that seen in healthy cells. These results show that expression of NOD1 increased significantly, both in terms of mRNA and protein levels, when ECV-304 cells were infected with P. gingivalis.
B
NOD1
P. gingivalis induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells
VCAM-1 ICAM-1 β-actin C
P
Fig. 1. P. gingivalis upregulated NOD1, VCAM-1 and ICAM-1 expression in ECV-304. ECV-304 was incubated with P. gingivalis at MOI 100 : 1 for 2 h. Significant upregulation of the NOD1 mRNA level (2.63 0.12-fold), VCAM-1 (3.07 0.22-fold) and ICAM-1 (2.67 0.08-fold) were shown in (A). The NOD1, VCAM-1 and ICAM-1 protein levels (B) in cells infected with P. gingivalis were at a higher level than those observed in cells that were not infected. The quantification of the bands in western blot (C) showed that NOD1, VCAM-1 and ICAM-1 expression increased to 2.14 0.34-fold, 2.22 0.12-fold and 1.82 0.20-fold. C, cells without treatment; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; P, cells infected by P. gingivalis; VCAM-1, vascular cell adhesion molecule 1.
Cellular expression levels of VCAM-1 and ICAM-1 were also examined. Compared with the control group, VCAM-1 and ICAM-1 mRNA levels increased by 3.07 0.22-fold and 2.67 0.08-fold (p < 0.01), respectively, in cells infected with P. gingivalis (Fig. 1A). The protein expression of VCAM-1 and ICAM-1 also increased (Fig. 1B,C). These results show that the expression of VCAM-1 and ICAM-1 both increased significantly in terms of mRNA and protein levels in ECV-304 cells infected with P. gingivalis.
NOD1 mediates ECV-304 cell activation Activation of nucleotide-binding oligomerization domain 1 by mesodiaminopimelic acid, an agonist of nucleotide-binding oligomerization domain 1, upregulated the expression of vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 in endothelial cells
This test was used to see if upregulation of NOD1 played a role in VCAM-1 and ICAM-1 expression in ECV-304 cells. After being activated with 10 lg/mL Tri-DAP for 24 h, real-time qRT-PCR and western blot results showed that Tri-DAP successfully upregulated NOD1 in ECV-304 cells by 2.34 0.15-fold. In addition, mRNA levels showed that VCAM-1 and ICAM-1 were upregulated by 2.91 0.26-fold and 2.00 0.21fold, respectively (Fig. 2A). As shown in Fig. 2B,C, protein levels were also elevated.
3.5
mRNA expression
3 2.5
Control Tri-DAP
This test was used to see if downregulation of NOD1 played a role in VCAM-1 and ICAM-1 expression in ECV-304 cells infected with P. gingivalis. Both scrambled siRNA and the NOD1 siRNA did not affect the basal expression of VCAM-1 and ICAM-1 in endothelial cells. After siRNA transfection, cells were infected by P. gingivalis. The cells exposed to siRNA targeting NOD1 that specifically aimed to lower NOD1 expression (Fig. 3). This decreased NOD1 expression also significantly blocked the expression of VCAM-1 and ICAM-1 by nearly two times, both in mRNA (Fig. 3A) and protein levels
C
** **
2 1.5 1 0.5 0 NOD1
3
**
Densitometric measurement
A
Silence of nucleotide-binding oligomerization domain 1 downregulated the expression of vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 in endothelial cells infected by P. gingivalis
VCAM-1
B NOD1
2.5
**
* *
2 1.5
1 0.5 0
ICAM-1
Control Tri-DAP
NOD1
VCAM-1 ICAM-1
193
(Fig. 3B,C). In addition, NOD1, VCAM-1 and ICAM-1 expression levels were not affected by scrambled siRNA. P. gingivalis induced NF-jB activity in ECV-304, and NF-jB mediated vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression by P. gingivalis in endothelial cells
The NF-jB signaling pathway involved in P. gingivalis infection was measured. As shown in EMSA assay, compared with cells untreated, the NF-jB DNA-binding activity remarkably increased in endothelial cells infected by P. gingivalis (Fig. 4A). However, when NOD1 was downregulated by RNA interference, the NF-jB DNA-binding activity decreased (Fig. 4C). Then the cells were treated with Bay117082 (inhibitor of NF-jB) before P. gingivalis infection. The results showed that after adding 5 lM Bay117082 to the cells, the NF-jB DNA-binding activity decreased (Fig. 4A). Western blot result of p-P65 reconfirmed this result, while the total P65 were used to check equal loading (Fig. 4B,D,G). When NF-jB signaling pathway was inhibited by Bay117082, P. gingivalisinduced VCAM-1 and ICAM-1 was reduced to 0.47 0.048-fold and 0.55 0.02-fold in endothelial cells (Fig. 4E,F,H). The results suggested that NOD1-mediating VCAM-1 and ICAM-1 expression was NF-jB dependent in endothelial cells.
VCAM-1
Discussion
ICAM-1
β-actin Control
Tri-DAP
β-actin Control
Tri-DAP
Fig. 2. Tri-DAP (agonist for NOD1) increased the expression of VCAM-1 and ICAM-1 in ECV-304. After being stimulated by 10 lg/mL Tri-DAP for 24 h, the expression of VCAM-1 and ICAM-1 both at mRNA and protein level were examined. (A) The expression of NOD1 was successfully increased by almost 2.34 0.15-fold. In addition, mRNA levels showed that VCAM-1 and ICAM-1 were upregulated by 2.91 0.26-fold and 2.00 0.21-fold, respectively. The protein levels were also elevated (B). Quantification of the bands in western blot showed that expression of NOD1, VCAM-1 and ICAM-1 increased to 2.13 0.15-fold, 2.08 0.41-fold and 1.77 0.35-fold (C). Control, cells without treatment; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; Tri-DAP, meso-diaminopimelic acid, cells stimulated by TriDAP; VCAM-1, vascular cell adhesion molecule 1.
P. gingivalis is considered to be an important periodontal pathogen. It is reported as being found in atherosclerotic plaques (7,8). In vitro, P. gingivalis has the capability of invading endothelial cells (9) and inducing increased expression of VCAM-1 and ICAM-1 (13–15). How the cells recognize intracellular P. gingivalis and initiate this response is still unknown. This study proposed that NOD1, an intracellular PRR, might play an important role in how the endothelial cell responds to P. gingivalis infection.
194
Wan et al.
1.2
**
**
Control siRNA(–)
C B NOD1
Si-NOD1 VCAM-1
0.9 ICAM-1
0.6
NOD1
VCAM-1
ICAM-1
Si -N O D 1
0
Si R N A (– )
β-actin
0.3
C on tr ol
mRNA expression
**
Densitometric measurement
A 1.5
1.2
**
*
NOD1
VCAM-1
*
1
Control siRNA(–) Si-NOD1
0.8 0.6 0.4 0.2
0
ICAM-1
Fig. 3. Knockdown of NOD1 gene attenuated P. gingivalis-induced VCAM-1 and ICAM-1 expression in ECV-304. All cells left unaffected [siRNA()] or transfected by NOD1 siRNA (Si-NOD1) or scrambled siRNA (control) were infected by P. gingivalis. Gene-silencing ability of the RNA interference was assessed by real-time quantitative reverse transcription polymerase chain reaction analysis and western blot. Cells transfected by siRNA targeting NOD1 showed the mRNA expression of NOD1 was decreased to 31 3%-fold compared with cells transfected by scrambled siRNA, and scrambled siRNA did not affect NOD1 expression level (A). The upregulation of VCAM-1 and ICAM-1 triggered by P. gingivalis were decreased to 57 3% and 61 3% (A). The scrambled siRNA did not affect the expression of VCAM-1 and ICAM-1. The protein levels also showed the same tendency (B). Quantification of the bands in western blot showed that the expression of NOD1, VCAM-1 and ICAM-1 decreased to 38 6%-fold, 57 7%-fold and 67 3%-fold (C) in the group transfected by siRNA targeting NOD1 compared with control group. ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; VCAM-1, vascular cell adhesion molecule 1.
P. gingivalis was demonstrated to induce NOD1 expression in endothelial cells. Then two experiments were used to examine the effect of NOD1 in mediating VCAM-1 and ICAM-1 expression in endothelial cells. Exposure of endothelial cells to Tri-DAP led to an increase in NOD1 activity, which in turn caused an increase in the expression of VCAM-1 and ICAM-1. Silencing of NOD1 with siRNA decreased the VCAM-1 and ICAM-1 expression that would normally be induced by P. gingivalis. These results demonstrated that NOD1 plays an important role in regulating VCAM-1 and ICAM-1 expression in endothelial cells, improving the understanding of how P. gingivalis infection may contribute to endothelial cell activation. P. gingivalis induces NOD1 expression in endothelial cells. Studies have shown that human endothelial cells can express functional NOD1 when cells have been infected by three particular pathogens: Chlamydophila pneumonia (4), Listeria monocytogenes (5) and Orientia tsutsugamushi (6). All of these pathogens have been shown to invade endothelial cells and induce increased NOD1 expression. NOD1 is believed to play an important role in detecting infections of these microorganisms (4–6).
P. gingivalis has been shown actively to invade endothelial cells (9). This study demonstrated that in addition to the aforementioned microorganisms, P. gingivalis is also capable of inducing NOD1 expression in endothelial cells, which implies that NOD1 may play a role in sensing P. gingivalis endothelial cell infection. NOD1 expression can also be induced in other cell types by various pathogens, such as in epithelial cells by Shigella (19), Campylobacter (20) and enteroinvasive Escherichia coli (21), and in periodontal fibroblasts by P. gingivalis (17). This study, however, is the first documented instance of P. gingivalisinduced NOD1 upregulation in endothelial cells. Because P. gingivalis is a relatively common organism of the oral cavity, dental activity has the potential to introduce the bacteria into systemic circulation (22,23). P. gingivalis has been shown to actively invade endothelial cells and induce changes that allow it to participate in the inflammatory response (24). Upregulation of adhesion molecules, such as VCAM-1 and ICAM-1, is one of the core changes of endothelial cell activation that can be linked to P. gingivalis infection (24,25). NF-jB is an important effector in transduction pathways of the inflam-
matory response. NOD1 have been known as a sensor to trigger activation of NF-jB (26). It is reported that C. pneumoniae were able to induce NF-jB -activation in NOD1-overexpressing HEK293 cells, while extracellular challenge failed to activate NF-jB in these HEK293 cells (4). In our present study, P. gingivalis induced NF-jB activation in endothelial cells; meanwhile, the P. gingivalisinduced activation of NF-jB was reduced by siRNA targeting NOD1. Therefore, these results confirmed the role of NOD1 in P. gingivalis-induced NF-jB activation in endothelial cells. The fact that downregulation of VCAM-1 and ICAM-1 by Bay117082 in P. gingivalis-infected endothelial cells confirmed the involvement NFjB in this process. Thus, NOD1 appears to contribute to P. gingivalismediated endothelial cell activation through the NF-jB signaling pathway. Adhesion molecules initiate leukocyte–endothelial cell contact, leading to leukocyte rolling and transendothelial migration into the vascular wall (27,28). VCAM-1 and ICAM-1 are members of this adhesion molecule family actively expressed on the cell surface (29). Both play a pivotal role in the initiation of atherosclerosis; thus, serum concentrations of VCAM-1 and ICAM-1 are signifi-
NOD1 mediates ECV-304 cell activation A
C
E
NF-κB
NF-κB
1.2 P(+) Bay(–)
mRNA expression
1
Free probe
Free probe
195
P(+) Bay(+) 0.8 0.6
**
*
0.4 0.2
y( +)
y( –)
P( +) Ba
C
P( +) Ba
–)
( NA
siR
B
D p-P65
l
D1
ro
t on
0
NO
-
C
Si
VCAM-1
ICAM-1
F
p-P65
VCAM-1
Total-P65
Total-P65 y( +)
P( +) Ba
y( –)
C
P( +) Ba
)
(–
NA
siR
l
ro
nt
Co
D1
ICAM-1
O
-N
Si
β-actin P(+) Bay(–)
2 1.5
*
1 0.5
l
D1
O
P(+) Bay(–) P(+) Bay(+)
1 0.8 0.6
*
*
0.4 0.2 0
VCAM-1
ICAM-1
-N
) (–
ro nt
1.2
P(+) Bay(+)
Si
NA
Co
y( Ba
+)
siR
C
y( +)
Ba
P(
P(
+)
0
Densitometric measurement
H
*
**
2.5
–)
Densitometric measurement
G
Fig. 4. NOD1 regulated P. gingivalis-induced VCAM-1 and ICAM-1 expression through the NF-jB signaling pathway. Electrophoretic mobility shift assays assay demonstrated the NF-jB DNA-binding activity remarkably increased in endothelial cells infected by P. gingivalis. While the cells were incubated with 5 lM Bay117082 for 1 h before infection by P. gingivalis, the NF-jB DNA-binding activity decreased (A). Western blot results showed p-P65 was increased in the groups infected by P. gingivalis, which was reduced when applying Bay117082. The total P65 was used to check equal loading (B). In addition, the quantification of the bands in western blot showed that the expression of p-P65 increased to 2.11 0.13-fold in the P. gingivalis-infected group, which decreased to 54 10% when applying Bay117082 (G). The P. gingivalis-induced NF-jB activation was reduced by siRNA targeting NOD1 compared with the control group, while the scrambled siRNA did not affect NF-jB activation (C). Western blot results showed P. gingivalis-induced p-P65 upregulation was reduced in the groups transfected by the siRNA targeting NOD1. The total P65 was used to check equal loading (D). Quantification of the bands in western blot showed that expression of p-P65 decreased to 71 2% in the NOD1-siRNA group, compared with the control group (G). When NF-jB signaling pathway was blocked, P. gingivalis-induced VCAM-1 and ICAM-1 high expression were statistically reduced to 47 4.8% and 55 2% in endothelial cells (E, F). Quantification of the bands in western blot showed that after transfection by siRNA targeting NOD1, P. gingivalis-induced VCAM-1 and ICAM-1 high expression were reduced to 49 7%-fold, 61 9%-fold (H). C, cells without any treatment; control, cells transfected by scrambled siRNA; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; P(+) Bay(), cells infected by P. gingivalis and untreated with Bay117082; P(+) Bay(+), cells infected by P. gingivalis and treated with Bay117082; p-P65; phosphorylated-P65; siRNA(), cells unaffected by RNA interfering before P. gingivalis infection; Si-NOD1, cells transfected by siRNA targeting NOD1; VCAM-1, vascular cell adhesion molecule 1.
cantly higher in patients with coronary artery disease when compared with control groups (30). Increased soluble-ICAM levels also correlate with an increase in the amount of vascular inflammation seen in patients with atherosclerosis (31,32). Because P. gingivalis has been associated with increased expression
of VCAM-1 and ICAM-1, infection may also have close ties to endothelial cell inflammation. For this reason, analyzing the mechanism of P. gingivalis infection that leads to the upregulation of VCAM-1 and ICAM-1 is important. Results of this study showed that NOD1 is closely involved in this process, highlighting
the importance of NOD1 in endothelial cells. In conclusion, a signaling pathway involving NOD1 has been suggested in endothelial cells infected with P. gingivalis. When triggered, this pathway can lead to upregulation and high expression of VCAM-1 and ICAM-1. In addition, the participa-
196
Wan et al.
tion of the NF-jB signaling pathway in this process was also confirmed. The data presented may improve our understanding of inflammatory mechanisms in endothelial cells.
Acknowledgements Gratitude is extended to Prof. ChernHsiung Lai of the Kaohsiung Medical University and to the Central Laboratory PKU School of Stomatology. This work was funded by the National Natural Science Foundation of China (81070840).
References 1. Inohara N, Nunez G. NODs: intracellular proteins involved in inflammation and apoptosis. Nat Rev Immunol 2003;3:371–382. 2. Girardin SE, Boneca IG, Carneiro LA et al. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science 2003;300:1584–1587. 3. Meylan E, Tschopp J, Karin M. Intracellular pattern recognition receptors in the host response. Nature 2006;442:39–44. 4. Opitz B, Forster S, Hocke AC et al. Nod1-mediated endothelial cell activation by Chlamydophila pneumoniae. Circ Res 2005;96:319–326. 5. Opitz B, Puschel A, Beermann W et al. Listeria monocytogenes activated p38 MAPK and induced IL-8 secretion in a nucleotide-binding oligomerization domain 1-dependent manner in endothelial cells. J Immunol 2006;176:484–490. 6. Cho KA, Jun YH, Suh JW, Kang JS, Choi HJ, Woo SY. Orientia tsutsugamushi induced endothelial cell activation via the NOD1-IL-32 pathway. Microb Pathog 2010;49:95–104. 7. Kozarov E, Sweier D, Shelburne C, Progulske-Fox A, Lopatin D. Detection of bacterial DNA in atheromatous plaques by quantitative PCR. Microbes Infect 2006;8:687–693. 8. An N, Ou-yang XY, Han W. [Detection of periodental pathogens in atherosclerotic lesions in patients]. Beijing Da Xue Xue Bao 2010;42:33–36. 9. Deshpande RG, Khan MB, Genco CA. Invasion of aortic and heart endothelial cells by Porphyromonas gingivalis. Infect Immun 1998;66:5337–5343.
10. Nakamura N, Yoshida M, Umeda M et al. Extended exposure of lipopolysaccharide fraction from Porphyromonas gingivalis facilitates mononuclear cell adhesion to vascular endothelium via Toll-like receptor-2 dependent mechanism. Atherosclerosis 2008;196:59–67. 11. Park HJ, Jeong SK, Kim SR et al. Resveratrol inhibits Porphyromonas gingivalis lipopolysaccharide-induced endothelial adhesion molecule expression by suppressing NF-kappaB activation. Arch Pharm Res 2009;32:583–591. 12. Roth GA, Moser B, Roth-Walter F et al. Infection with a periodontal pathogen increases mononuclear cell adhesion to human aortic endothelial cells. Atherosclerosis 2007;190:271–281. 13. Cai SY, Lin YX, Xiao L, He QM, Ge S, Qian MZ. [Effects of Porphyromonas gingivalis with different fimA genotypes on vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 production by human umbilical vein endothelial cells]. Zhonghua Kou Qiang Yi Xue Za Zhi 2011;46:332–337. 14. Hashizume T, Kurita-Ochiai T, Yamamoto M. Porphyromonas gingivalis stimulates monocyte adhesion to human umbilical vein endothelial cells. FEMS Immunol Med Microbiol 2011;62:57–65. 15. Zhang D, Zheng H, Zhao J et al. Porphyromonas gingivalis induces intracellular adhesion molecule-1 expression in endothelial cells through the nuclear factor-kappaB pathway, but not through the p38 MAPK pathway. J Periodontal Res 2011;46:31–38. 16. Kocgozlu L, Elkaim R, Tenenbaum H, Werner S. Variable cell responses to P. gingivalis lipopolysaccharide. J Dent Res 2009;88:741–745. 17. Liu J, Duan J, Wang Y, Ouyang X. ICAM-1 is regulated by Porphyromonas gingivalis through NOD1 and NOD2 molecules in periodontal fibroblasts. J Periodontol 2013;85:358–368. 18. Zhou S, Zhang J, Zheng H, Zhou Y, Chen F, Lin J. Inhibition of mechanical stress-induced NF-kappaB promotes bone formation. Oral Dis 2013;19:59–64. 19. Girardin SE, Tournebize R, Mavris M et al. CARD4/Nod1 mediates NFkappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2001;2:736– 742. 20. Zilbauer M, Dorrell N, Elmi A et al. A major role for intestinal epithelial nucleotide oligomerization domain 1 (NOD1) in eliciting host bactericidal immune
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
responses to Campylobacter jejuni. Cell Microbiol 2007;9:2404–2416. Kim JG, Lee SJ, Kagnoff MF. Nod1 is an essential signal transducer in intestinal epithelial cells infected with bacteria that avoid recognition by toll-like receptors. Infect Immun 2004;72:1487–1495. Silver JG, Martin AW, McBride BC. Experimental transient bacteraemias in human subjects with varying degrees of plaque accumulation and gingival inflammation. J Clin Periodontol 1977; 4:92–99. Amano A, Inaba H. [Cardiovascular diseases and periodontal diseases]. Clin Calcium 2012;22:43–48. Hunt BJ, Jurd KM. Endothelial cell activation. A central pathophysiological process. BMJ 1998;316:1328–1329. Pober JS. Warner-Lambert/Parke-Davis award lecture. Cytokine-mediated activation of vascular endothelium. Physiology and pathology. Am J Pathol 1988; 133:426–433. Rietdijk ST, Burwell T, Bertin J, Coyle AJ. Sensing intracellular pathogensNOD-like receptors. Curr Opin Pharmacol 2008;8:261–266. Kuldo JM, Ogawara KI, Werner N et al. Molecular pathways of endothelial cell activation for (targeted) pharmacological intervention of chronic inflammatory diseases. Curr Vasc Pharmacol 2005;3: 11–39. Libby P. Inflammatory mechanisms: the molecular basis of inflammation and disease. Nutr Rev 2007;65:S140–S146. Klein CL, Bittinger F, Kohler H et al. Comparative studies on vascular endothelium in vitro. 3. Effects of cytokines on the expression of E-selectin, ICAM-1 and VCAM-1 by cultured human endothelial cells obtained from different passages. Pathobiology 1995;63: 83–92. Damnjanovic G, Jelic M, Dindic B, Ilic S. [Serum concentration of soluble adhesive molecules in patients with different forms of coronary artery disease]. Vojnosanit Pregl 2009;66:265–270. Lu HH, Sheng ZQ, Wang Y, Zhang L. Levels of soluble adhesion molecules in patients with various clinical presentations of coronary atherosclerosis. Chin Med J (Engl) 2010;123:3123–3126. Roebuck KA, Finnegan A. Regulation of intercellular adhesion molecule-1 (CD54) gene expression. J Leukoc Biol 1999;66:876–888.
J Periodont Res 2015; 50: 189–196 All rights reserved
JOURNAL OF PERIODONTAL RESEARCH doi:10.1111/jre.12192
Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-jB pathway
M. Wan1, J. Liu1, X. Ouyang1,2 1
Department of Periodontology, Peking University School and Hospital of Stomatology, Beijing, China and 2National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing, China
Wan M, Liu J, Ouyang X. Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-jB pathway. J Periodont Res 2015; 50, 189–196. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Background and Objective: Porphyromonas gingivalis has been shown to actively invade endothelial cells and induce vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1) overexpression. Nucleotidebinding oligomerization domain 1 (NOD1) is an intracellular pattern recognition reporter, and its involvement in this process was unknown. This study focused on endothelial cells infected with P. gingivalis, the detection of NOD1 expression and the role that NOD1 plays in the upregulation of VCAM-1 and ICAM-1. Material and Methods: The human umbilical vein endothelial cell line (ECV-304) was intruded by P. gingivalis W83, and cells without any treatment were the control group. Expression levels of NOD1, VCAM-1, ICAM-1, phosphorylated P65 between cells with and without treatment on both mRNA and protein levels were compared. Then we examined whether mesodiaminopimelic acid (NOD1 agonist) could increase VCAM-1 and ICAM-1 expression, meanwhile, NOD1 gene silence by RNA interference could reduce VCAM-1, ICAM-1 and phosphorylated P65 release. At last, we examined whether inhibition of NF-jB by Bay117082 could reduce VCAM-1 and ICAM- 1 expression. The mRNA levels were measured by real-time polymerase chain reaction, and protein levels by western blot or electrophoretic mobility shift assays (for phosphorylated P65). Results: P. gingivalis invasion showed significant upregulation of NOD1, VCAM-1 and ICAM-1. NOD1 activation by meso-diaminopimelic acid
Xiangying Ouyang, DDS, PhD, Department of Periodontology, Peking University School and Hospital of Stomatology, 22 Zhongguancun Nandajie, Haidian District, Beijing 100081, China Tel: +86 10 82195495 Fax: +86 010 62173402 e-mail: [email protected] Key words: endothelial cell; intercellular
adhesion molecule-1; nucleotide-binding oligomerization domain 1; vascular cell adhesion molecule 1 Accepted for publication March 26, 2014
190
Wan et al.
increased VCAM-1 and ICAM-1 expression, and NOD1 gene silence reduced VCAM-1 and ICAM-1 release markedly. The NF-jB signaling pathway was activated by P. gingivalis, while NOD1 gene silence decreased the activation of NF-jB. Moreover, inhibition of NF-jB reduced VCAM-1 and ICAM-1 expression induced by P. gingivalis in endothelial cells. Conclusion: The results revealed that P. gingivalis induced NOD1 overexpression in endothelial cells and that NOD1 played an important role in the process of VCAM-1 and ICAM-1 expression in endothelial cells infected with P. gingivalis through the NF-jB signaling pathway.
The detection of microbial infection by the human innate immune system is highly dependent on the recognition of pathogen-associated molecular patterns, structural components conserved among pathogens and pattern recognition receptors (PRRs). Nucleotide-binding oligomerization domain (NOD) proteins are one type of PRRs. Because NOD proteins localize in the cytoplasm, they are known as intracellular PRRs (1). NOD1, a type of NOD protein, specifically detects L-Ala-c-D-glutamyl-meso-diaminopimelic acid (Tri-DAP), a compound found in nearly all peptidoglycans (2). In the cardiovascular system, endothelial cells are usually the first structures to be exposed to microbial components, which are detected through PRRs (3). Chlamydophila pneumonia (4), Listeria monocytogenes (5) and Orientia tsutsugamushi (6) have all been reported to increase NOD1 expression in endothelial cells. NOD1 has also played an important role in the expression of interleukin in endothelial cells infected by these three pathogens. P. gingivalis, a gram-negative, anaerobic bacteria, is an important periodontal pathogen. P. gingivalis has also been detected in atherosclerotic plaques (7,8). This means that P. gingivalis has the potential to come into contact with endothelial cells. In vitro studies have shown that P. gingivalis actively invades endothelial cells (9). Associations between P. gingivalis infection and vascular endothelial activation have been reported, including lipopolysaccharide stimulation (10,11) and intracellular (12–15) upregulation of vascular cell adhesion
molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1). P. gingivalis-induced lipopolysaccharide stimulation occurs via Toll-like receptor 2 and Toll-like receptor 4 (10,16). How the endothelial cells recognize intracellular P. gingivalis and initiate this response is still unknown. The effect of NOD1 in endothelial cells infected with P. gingivalis remains to be identified. This study hypothesizes that NOD1 plays an important role in the increased expression of VCAM-1 and ICAM-1 in these endothelial cells.
Material and methods Bacterial strains culture
P. gingivalis W83 (supplied by Prof. Chern-Hsiung Lai of Kaohsiung Medical University, Taiwan, China) was cultured in brain–heart infusion (BHI; Bacto, Sparks, MD, USA) broth agar plates supplemented with 5% defibrinated sheep blood, 5 lg/mL hemin and 0.4 lg/mL menadione while under anaerobic conditions (5% CO2, 10% H2 and 85% N2) at 37°C. Cultures were grown for 5–7 d. They were then inoculated into fresh BHI broth (supplemented with 5 lg/mL hemin and 0.4 lg/mL menadione), grown for an additional 24 h and subsequently used for experimentation. Cell culture
Human umbilical vein endothelial cell line ECV-304 (obtained from the ATCC, Manassas, VA, USA) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco,
Paisley, Scotland, UK) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA) in 5% CO2 at 37°C. Cells were inoculated into cell culture dishes at a concentration of 106 cells/mL, grown overnight and subsequently used for experimentation. Infection protocol
P. gingivalis W83 was inoculated into fresh BHI broth (supplemented with 5 lg/mL hemin and 0.4 lg/mL menadione) and grown for 24 h. Cells were then washed three times with phosphate-buffered saline (PBS, pH 7.2), and resuspended in DMEM supplemented with 10% fetal bovine serum. Optical density of the bacterial resuspension was measured at 600 nm and further diluted to an optical density of 0.5, corresponding to a concentration of 108 CFU/mL. The bacterial resuspension were then inoculated on to the ECV-304 monolayer at a multiplicity of infection of 1 : 100. After incubating for 2 h, the supernatant was replaced with fresh DMEM containing 0.5 g/L gentamicin and 0.1 g/L metronidazole to kill extracellular bacteria (15). After an additional 2 h, cells were harvested and used for experimentation. The viabilities of ECV-304 infected with P. gingivalis, as assessed by 0.2% Trypan Blue exclusion tests, were shown to exceed 90%. Antibiotic protection and invasion assays
Invasion of P. gingivalis was quantified by detecting the number of CFU
NOD1 mediates ECV-304 cell activation recovered following antibiotic treatment (9,15). ECV-304 monolayers were infected by P. gingivalis at an MOI of 1 : 100 (108 CFU/mL bacteria to 106/mL cells). After incubating for 2 h, half of the cell monolayers were washed by PBS to remove the unattached bacteria and lysed with sterile H2O for 20 min. Then the lysates were diluted, plated on BHI broth agar and incubated under anaerobic conditions for 7 d. The CFUs of P. gingivalis that had adhered to and invaded cells were enumerated. For the other half of the cell monolayers, after P. gingivalis infection, PBS douche and antibiotic protection were down, the cells were lysed with sterile H2O for 20 min. Then the lysates were diluted, plated on BHI broth agar plate and incubated under anaerobic conditions for 7 d. The CFUs of invasive bacteria were counted, and the invasion efficiency was expressed as the percentage of the initial inoculum recovered after invasion assay. The invasion assays were performed in triplicate. RNA interference in EVC-304
RNA interference experiments were done as described previously (17): the siRNAs targeting NOD1 (sense: UUCUGUUUGGCUUUGGACAACAGCC; antisense: GGCUGUUG UCCAAAGCCAAACAGAA) were purchased from Invitrogen (San Diego, CA, USA). ECV-304 cells were transfected for 48 h using Lipofectamine 2000 (Invitrogen) and 100 pM siRNA. Cells transfected with Lipofectamine 2000 plus scrambled siRNA were used as a control group (Roche, Indianapolis, IN, USA). Transfection efficiency was assessed by BLOCK-iT Fluorescent Oligo (Invitrogen). Both control and test groups were infected with P. gingivalis. The expression levels of NOD1, VCAM-1 and ICAM-1 were determined using real-time polymerase chain reaction (PCR) and western blotting. The viabilities of ECV-304 cells after transfection, as assessed by 0.2% Trypan Blue exclusion test, were shown to exceed 90%.
Nucleotide-binding oligomerization domain 1 activation by mesodiaminopimelic acid
Tri-DAP, an agonist of NOD1, was purchased from InvivoGen (San Diego, CA, USA). EVC-304 cells were stimulated for 24 h at a 10 lg/mL concentration of Tri-DAP. The expression levels of NOD1, VCAM-1 and ICAM-1 were then determined through real-time PCR and western blotting. Inhibition of NF-jB signaling pathway
Bay117082 (inhibitor of NF-jB) was purchased from Sigma (St. Louis, MO, USA). The endothelial cells were treated with 5 lM Bay117082 for 1 h before P. gingivalis infection. The expression levels of VCAM-1 and ICAM-1 were then determined through real-time PCR and western blotting. Real-time quantitative reverse transcription polymerase chain reaction analysis
Real-time quantitative reverse transcription (qRT)-PCR was performed in an ABI Prism 7000 Sequence Detection System (Applied Biosystems, LifeTechnologies, Warrington, UK) using SYBR green reagent (Roche). Standard real-time qRTPCR conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and finally 60°C for 1 min. All samples were performed in duplicate. In addition, all experiments were carried out in triplicate. Expression levels of the target transcripts in
191
each sample were calculated by the 2ΔΔCt method after normalization to b-actin, wherein b-actin was used as the endogenous gene control. The primers specific to NOD1, ICAM-1, VCAM-1 and b-actin are shown in Table 1. Western blot analysis
Cells were harvested and lysed in RIPA lysis buffer containing proteinase inhibitors. Western blot was then performed on cell extracts to detect protein expression levels of NOD1, VCAM-1 and ICAM-1. After measuring concentrations, protein samples were separated by electrophoresis in 10% sodium dodecyl sulfate polyacrylamide gels and transferred to polyvinylidene difluoride membranes by wet blotting. Following wet blotting, the membranes were blocked in 5% nonfat dry milk for 1 h, then exposed to antibodies specific to NOD1 (1 : 1000; Cell Signaling Technology, Danvers, MA, USA), VCAM-1 (1 : 1000; Santa Cruz, CA, USA), ICAM-1 (1 : 1000; Santa Cruz, CA, USA), phosphorylated (p)-P65 and total P65 (1 : 1000; Cell Signaling Technology), and b-actin (1 : 1000, ZSGB-BIO, Beijing, China). Membranes were maintained at 4°C and antibody exposure continued overnight. The following day they were incubated with secondary antibodies (ZSGB-BIO) for 1 h, and then observed for immunoreactive proteins using an ECL reagent (Thermo, Rockford, IL, USA). Data showed in figures represent one of three independent experiments.
Table 1. PCR primer used in this study Targer gene
Sequence 50 ? 30
Product size (bp)
NOD1
ACAGCCAGGGCGAGATAC AAAGGTGCTAAGCGAAGAG GCCTGGGAACAACCGGAAGGTG GGGTGCCAGTTCCACCCGTTC GGACCACATCTACGCTGACAATGAA TCCAGAGGGCCACTCAAATGAATCT CCTGGCACCCAGCACAAT CCGATCCACACGGAGTACTTG
189
ICAM-1 VCAM-1 b-actin
148 160 68
ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; VCAM-1, vascular cell adhesion molecule 1.
192
Wan et al. Kit (Pierce, Rockford, IL, USA). The DNA–protein complex samples were analyzed on a 6% polyacrylamide gel.
Electrophoretic mobility shift assays
Nuclear extraction and EMSA were performed as described previously (18). After infected by P. gingivalis, ECV304 monolayer was washed three times with ice-cold PBS then nuclear extracts from cells were detected using the nuclear-cytosol extraction kit (Applygen Technology, Shanghai, China) according to the manufacturer’s instruction. Then 5 lg of each nuclear extracts were subjected to EMSA using a P32-radiolabeled NF-jB oligonucleotide probe (50 -AGTTGAGGGGACTTTCCCAGGC-30 ). Binding reaction was performed using the LightShift Chemiluminescent EMSA
3.5
mRNA expression
3
C P
Data were evaluated using the Student t-test. Throughout the figures, p < 0.05 was labeled by one asterisk, p < 0.01 by two asterisks.
Results Invasion efficiency of P. gingivalis
The ability of P. gingivalis to invade endothelial cells was validated when the invasive P. gingivalis was
C
** **
Densitometric measurement
A
Statistics analysis
**
2.5 2 1.5 1 0.5 0
NOD1
VCAM-1
recovered after 7 d incubation on BHI broth agar plate. The CFUs of P. gingivalis that had adhered to and invaded cells were enumerated, and about 0.083 0.005% (8.27 9 104 CFU/mL) bacteria had a close contact with ECV-304 cells. The CFUs of invasive bacteria were also counted, and the invasion efficiency was about 0.026 0.008% (2.63 9 104 CFU/mL).
3 2.5
**
C P *
2 1.5 1 0.5 0
ICAM-1
*
NOD1
VCAM -1 ICAM -1
P. gingivalis induced nucleotidebinding oligomerization domain 1 expression in endothelial cells
Western blotting detected NOD1 protein expression in ECV-304 cells (Fig. 1B,C). NOD1 expression in cells infected with P. gingivalis was at a higher level than those observed in cells that were not infected. The mRNA expression of NOD1 in ECV-304 cells with and without P. gingivalis infection was also examined by real-time qRT-PCR (Fig. 1A). NOD1 mRNA levels in infected cells were seen to increase by 2.63 0.12-fold (p < 0.01) of that seen in healthy cells. These results show that expression of NOD1 increased significantly, both in terms of mRNA and protein levels, when ECV-304 cells were infected with P. gingivalis.
B
NOD1
P. gingivalis induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells
VCAM-1 ICAM-1 β-actin C
P
Fig. 1. P. gingivalis upregulated NOD1, VCAM-1 and ICAM-1 expression in ECV-304. ECV-304 was incubated with P. gingivalis at MOI 100 : 1 for 2 h. Significant upregulation of the NOD1 mRNA level (2.63 0.12-fold), VCAM-1 (3.07 0.22-fold) and ICAM-1 (2.67 0.08-fold) were shown in (A). The NOD1, VCAM-1 and ICAM-1 protein levels (B) in cells infected with P. gingivalis were at a higher level than those observed in cells that were not infected. The quantification of the bands in western blot (C) showed that NOD1, VCAM-1 and ICAM-1 expression increased to 2.14 0.34-fold, 2.22 0.12-fold and 1.82 0.20-fold. C, cells without treatment; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; P, cells infected by P. gingivalis; VCAM-1, vascular cell adhesion molecule 1.
Cellular expression levels of VCAM-1 and ICAM-1 were also examined. Compared with the control group, VCAM-1 and ICAM-1 mRNA levels increased by 3.07 0.22-fold and 2.67 0.08-fold (p < 0.01), respectively, in cells infected with P. gingivalis (Fig. 1A). The protein expression of VCAM-1 and ICAM-1 also increased (Fig. 1B,C). These results show that the expression of VCAM-1 and ICAM-1 both increased significantly in terms of mRNA and protein levels in ECV-304 cells infected with P. gingivalis.
NOD1 mediates ECV-304 cell activation Activation of nucleotide-binding oligomerization domain 1 by mesodiaminopimelic acid, an agonist of nucleotide-binding oligomerization domain 1, upregulated the expression of vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 in endothelial cells
This test was used to see if upregulation of NOD1 played a role in VCAM-1 and ICAM-1 expression in ECV-304 cells. After being activated with 10 lg/mL Tri-DAP for 24 h, real-time qRT-PCR and western blot results showed that Tri-DAP successfully upregulated NOD1 in ECV-304 cells by 2.34 0.15-fold. In addition, mRNA levels showed that VCAM-1 and ICAM-1 were upregulated by 2.91 0.26-fold and 2.00 0.21fold, respectively (Fig. 2A). As shown in Fig. 2B,C, protein levels were also elevated.
3.5
mRNA expression
3 2.5
Control Tri-DAP
This test was used to see if downregulation of NOD1 played a role in VCAM-1 and ICAM-1 expression in ECV-304 cells infected with P. gingivalis. Both scrambled siRNA and the NOD1 siRNA did not affect the basal expression of VCAM-1 and ICAM-1 in endothelial cells. After siRNA transfection, cells were infected by P. gingivalis. The cells exposed to siRNA targeting NOD1 that specifically aimed to lower NOD1 expression (Fig. 3). This decreased NOD1 expression also significantly blocked the expression of VCAM-1 and ICAM-1 by nearly two times, both in mRNA (Fig. 3A) and protein levels
C
** **
2 1.5 1 0.5 0 NOD1
3
**
Densitometric measurement
A
Silence of nucleotide-binding oligomerization domain 1 downregulated the expression of vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 in endothelial cells infected by P. gingivalis
VCAM-1
B NOD1
2.5
**
* *
2 1.5
1 0.5 0
ICAM-1
Control Tri-DAP
NOD1
VCAM-1 ICAM-1
193
(Fig. 3B,C). In addition, NOD1, VCAM-1 and ICAM-1 expression levels were not affected by scrambled siRNA. P. gingivalis induced NF-jB activity in ECV-304, and NF-jB mediated vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression by P. gingivalis in endothelial cells
The NF-jB signaling pathway involved in P. gingivalis infection was measured. As shown in EMSA assay, compared with cells untreated, the NF-jB DNA-binding activity remarkably increased in endothelial cells infected by P. gingivalis (Fig. 4A). However, when NOD1 was downregulated by RNA interference, the NF-jB DNA-binding activity decreased (Fig. 4C). Then the cells were treated with Bay117082 (inhibitor of NF-jB) before P. gingivalis infection. The results showed that after adding 5 lM Bay117082 to the cells, the NF-jB DNA-binding activity decreased (Fig. 4A). Western blot result of p-P65 reconfirmed this result, while the total P65 were used to check equal loading (Fig. 4B,D,G). When NF-jB signaling pathway was inhibited by Bay117082, P. gingivalisinduced VCAM-1 and ICAM-1 was reduced to 0.47 0.048-fold and 0.55 0.02-fold in endothelial cells (Fig. 4E,F,H). The results suggested that NOD1-mediating VCAM-1 and ICAM-1 expression was NF-jB dependent in endothelial cells.
VCAM-1
Discussion
ICAM-1
β-actin Control
Tri-DAP
β-actin Control
Tri-DAP
Fig. 2. Tri-DAP (agonist for NOD1) increased the expression of VCAM-1 and ICAM-1 in ECV-304. After being stimulated by 10 lg/mL Tri-DAP for 24 h, the expression of VCAM-1 and ICAM-1 both at mRNA and protein level were examined. (A) The expression of NOD1 was successfully increased by almost 2.34 0.15-fold. In addition, mRNA levels showed that VCAM-1 and ICAM-1 were upregulated by 2.91 0.26-fold and 2.00 0.21-fold, respectively. The protein levels were also elevated (B). Quantification of the bands in western blot showed that expression of NOD1, VCAM-1 and ICAM-1 increased to 2.13 0.15-fold, 2.08 0.41-fold and 1.77 0.35-fold (C). Control, cells without treatment; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; Tri-DAP, meso-diaminopimelic acid, cells stimulated by TriDAP; VCAM-1, vascular cell adhesion molecule 1.
P. gingivalis is considered to be an important periodontal pathogen. It is reported as being found in atherosclerotic plaques (7,8). In vitro, P. gingivalis has the capability of invading endothelial cells (9) and inducing increased expression of VCAM-1 and ICAM-1 (13–15). How the cells recognize intracellular P. gingivalis and initiate this response is still unknown. This study proposed that NOD1, an intracellular PRR, might play an important role in how the endothelial cell responds to P. gingivalis infection.
194
Wan et al.
1.2
**
**
Control siRNA(–)
C B NOD1
Si-NOD1 VCAM-1
0.9 ICAM-1
0.6
NOD1
VCAM-1
ICAM-1
Si -N O D 1
0
Si R N A (– )
β-actin
0.3
C on tr ol
mRNA expression
**
Densitometric measurement
A 1.5
1.2
**
*
NOD1
VCAM-1
*
1
Control siRNA(–) Si-NOD1
0.8 0.6 0.4 0.2
0
ICAM-1
Fig. 3. Knockdown of NOD1 gene attenuated P. gingivalis-induced VCAM-1 and ICAM-1 expression in ECV-304. All cells left unaffected [siRNA()] or transfected by NOD1 siRNA (Si-NOD1) or scrambled siRNA (control) were infected by P. gingivalis. Gene-silencing ability of the RNA interference was assessed by real-time quantitative reverse transcription polymerase chain reaction analysis and western blot. Cells transfected by siRNA targeting NOD1 showed the mRNA expression of NOD1 was decreased to 31 3%-fold compared with cells transfected by scrambled siRNA, and scrambled siRNA did not affect NOD1 expression level (A). The upregulation of VCAM-1 and ICAM-1 triggered by P. gingivalis were decreased to 57 3% and 61 3% (A). The scrambled siRNA did not affect the expression of VCAM-1 and ICAM-1. The protein levels also showed the same tendency (B). Quantification of the bands in western blot showed that the expression of NOD1, VCAM-1 and ICAM-1 decreased to 38 6%-fold, 57 7%-fold and 67 3%-fold (C) in the group transfected by siRNA targeting NOD1 compared with control group. ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; VCAM-1, vascular cell adhesion molecule 1.
P. gingivalis was demonstrated to induce NOD1 expression in endothelial cells. Then two experiments were used to examine the effect of NOD1 in mediating VCAM-1 and ICAM-1 expression in endothelial cells. Exposure of endothelial cells to Tri-DAP led to an increase in NOD1 activity, which in turn caused an increase in the expression of VCAM-1 and ICAM-1. Silencing of NOD1 with siRNA decreased the VCAM-1 and ICAM-1 expression that would normally be induced by P. gingivalis. These results demonstrated that NOD1 plays an important role in regulating VCAM-1 and ICAM-1 expression in endothelial cells, improving the understanding of how P. gingivalis infection may contribute to endothelial cell activation. P. gingivalis induces NOD1 expression in endothelial cells. Studies have shown that human endothelial cells can express functional NOD1 when cells have been infected by three particular pathogens: Chlamydophila pneumonia (4), Listeria monocytogenes (5) and Orientia tsutsugamushi (6). All of these pathogens have been shown to invade endothelial cells and induce increased NOD1 expression. NOD1 is believed to play an important role in detecting infections of these microorganisms (4–6).
P. gingivalis has been shown actively to invade endothelial cells (9). This study demonstrated that in addition to the aforementioned microorganisms, P. gingivalis is also capable of inducing NOD1 expression in endothelial cells, which implies that NOD1 may play a role in sensing P. gingivalis endothelial cell infection. NOD1 expression can also be induced in other cell types by various pathogens, such as in epithelial cells by Shigella (19), Campylobacter (20) and enteroinvasive Escherichia coli (21), and in periodontal fibroblasts by P. gingivalis (17). This study, however, is the first documented instance of P. gingivalisinduced NOD1 upregulation in endothelial cells. Because P. gingivalis is a relatively common organism of the oral cavity, dental activity has the potential to introduce the bacteria into systemic circulation (22,23). P. gingivalis has been shown to actively invade endothelial cells and induce changes that allow it to participate in the inflammatory response (24). Upregulation of adhesion molecules, such as VCAM-1 and ICAM-1, is one of the core changes of endothelial cell activation that can be linked to P. gingivalis infection (24,25). NF-jB is an important effector in transduction pathways of the inflam-
matory response. NOD1 have been known as a sensor to trigger activation of NF-jB (26). It is reported that C. pneumoniae were able to induce NF-jB -activation in NOD1-overexpressing HEK293 cells, while extracellular challenge failed to activate NF-jB in these HEK293 cells (4). In our present study, P. gingivalis induced NF-jB activation in endothelial cells; meanwhile, the P. gingivalisinduced activation of NF-jB was reduced by siRNA targeting NOD1. Therefore, these results confirmed the role of NOD1 in P. gingivalis-induced NF-jB activation in endothelial cells. The fact that downregulation of VCAM-1 and ICAM-1 by Bay117082 in P. gingivalis-infected endothelial cells confirmed the involvement NFjB in this process. Thus, NOD1 appears to contribute to P. gingivalismediated endothelial cell activation through the NF-jB signaling pathway. Adhesion molecules initiate leukocyte–endothelial cell contact, leading to leukocyte rolling and transendothelial migration into the vascular wall (27,28). VCAM-1 and ICAM-1 are members of this adhesion molecule family actively expressed on the cell surface (29). Both play a pivotal role in the initiation of atherosclerosis; thus, serum concentrations of VCAM-1 and ICAM-1 are signifi-
NOD1 mediates ECV-304 cell activation A
C
E
NF-κB
NF-κB
1.2 P(+) Bay(–)
mRNA expression
1
Free probe
Free probe
195
P(+) Bay(+) 0.8 0.6
**
*
0.4 0.2
y( +)
y( –)
P( +) Ba
C
P( +) Ba
–)
( NA
siR
B
D p-P65
l
D1
ro
t on
0
NO
-
C
Si
VCAM-1
ICAM-1
F
p-P65
VCAM-1
Total-P65
Total-P65 y( +)
P( +) Ba
y( –)
C
P( +) Ba
)
(–
NA
siR
l
ro
nt
Co
D1
ICAM-1
O
-N
Si
β-actin P(+) Bay(–)
2 1.5
*
1 0.5
l
D1
O
P(+) Bay(–) P(+) Bay(+)
1 0.8 0.6
*
*
0.4 0.2 0
VCAM-1
ICAM-1
-N
) (–
ro nt
1.2
P(+) Bay(+)
Si
NA
Co
y( Ba
+)
siR
C
y( +)
Ba
P(
P(
+)
0
Densitometric measurement
H
*
**
2.5
–)
Densitometric measurement
G
Fig. 4. NOD1 regulated P. gingivalis-induced VCAM-1 and ICAM-1 expression through the NF-jB signaling pathway. Electrophoretic mobility shift assays assay demonstrated the NF-jB DNA-binding activity remarkably increased in endothelial cells infected by P. gingivalis. While the cells were incubated with 5 lM Bay117082 for 1 h before infection by P. gingivalis, the NF-jB DNA-binding activity decreased (A). Western blot results showed p-P65 was increased in the groups infected by P. gingivalis, which was reduced when applying Bay117082. The total P65 was used to check equal loading (B). In addition, the quantification of the bands in western blot showed that the expression of p-P65 increased to 2.11 0.13-fold in the P. gingivalis-infected group, which decreased to 54 10% when applying Bay117082 (G). The P. gingivalis-induced NF-jB activation was reduced by siRNA targeting NOD1 compared with the control group, while the scrambled siRNA did not affect NF-jB activation (C). Western blot results showed P. gingivalis-induced p-P65 upregulation was reduced in the groups transfected by the siRNA targeting NOD1. The total P65 was used to check equal loading (D). Quantification of the bands in western blot showed that expression of p-P65 decreased to 71 2% in the NOD1-siRNA group, compared with the control group (G). When NF-jB signaling pathway was blocked, P. gingivalis-induced VCAM-1 and ICAM-1 high expression were statistically reduced to 47 4.8% and 55 2% in endothelial cells (E, F). Quantification of the bands in western blot showed that after transfection by siRNA targeting NOD1, P. gingivalis-induced VCAM-1 and ICAM-1 high expression were reduced to 49 7%-fold, 61 9%-fold (H). C, cells without any treatment; control, cells transfected by scrambled siRNA; ICAM-1, intercellular adhesion molecule 1; NOD1, nucleotide-binding oligomerization domain 1; P(+) Bay(), cells infected by P. gingivalis and untreated with Bay117082; P(+) Bay(+), cells infected by P. gingivalis and treated with Bay117082; p-P65; phosphorylated-P65; siRNA(), cells unaffected by RNA interfering before P. gingivalis infection; Si-NOD1, cells transfected by siRNA targeting NOD1; VCAM-1, vascular cell adhesion molecule 1.
cantly higher in patients with coronary artery disease when compared with control groups (30). Increased soluble-ICAM levels also correlate with an increase in the amount of vascular inflammation seen in patients with atherosclerosis (31,32). Because P. gingivalis has been associated with increased expression
of VCAM-1 and ICAM-1, infection may also have close ties to endothelial cell inflammation. For this reason, analyzing the mechanism of P. gingivalis infection that leads to the upregulation of VCAM-1 and ICAM-1 is important. Results of this study showed that NOD1 is closely involved in this process, highlighting
the importance of NOD1 in endothelial cells. In conclusion, a signaling pathway involving NOD1 has been suggested in endothelial cells infected with P. gingivalis. When triggered, this pathway can lead to upregulation and high expression of VCAM-1 and ICAM-1. In addition, the participa-
196
Wan et al.
tion of the NF-jB signaling pathway in this process was also confirmed. The data presented may improve our understanding of inflammatory mechanisms in endothelial cells.
Acknowledgements Gratitude is extended to Prof. ChernHsiung Lai of the Kaohsiung Medical University and to the Central Laboratory PKU School of Stomatology. This work was funded by the National Natural Science Foundation of China (81070840).
References 1. Inohara N, Nunez G. NODs: intracellular proteins involved in inflammation and apoptosis. Nat Rev Immunol 2003;3:371–382. 2. Girardin SE, Boneca IG, Carneiro LA et al. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science 2003;300:1584–1587. 3. Meylan E, Tschopp J, Karin M. Intracellular pattern recognition receptors in the host response. Nature 2006;442:39–44. 4. Opitz B, Forster S, Hocke AC et al. Nod1-mediated endothelial cell activation by Chlamydophila pneumoniae. Circ Res 2005;96:319–326. 5. Opitz B, Puschel A, Beermann W et al. Listeria monocytogenes activated p38 MAPK and induced IL-8 secretion in a nucleotide-binding oligomerization domain 1-dependent manner in endothelial cells. J Immunol 2006;176:484–490. 6. Cho KA, Jun YH, Suh JW, Kang JS, Choi HJ, Woo SY. Orientia tsutsugamushi induced endothelial cell activation via the NOD1-IL-32 pathway. Microb Pathog 2010;49:95–104. 7. Kozarov E, Sweier D, Shelburne C, Progulske-Fox A, Lopatin D. Detection of bacterial DNA in atheromatous plaques by quantitative PCR. Microbes Infect 2006;8:687–693. 8. An N, Ou-yang XY, Han W. [Detection of periodental pathogens in atherosclerotic lesions in patients]. Beijing Da Xue Xue Bao 2010;42:33–36. 9. Deshpande RG, Khan MB, Genco CA. Invasion of aortic and heart endothelial cells by Porphyromonas gingivalis. Infect Immun 1998;66:5337–5343.
10. Nakamura N, Yoshida M, Umeda M et al. Extended exposure of lipopolysaccharide fraction from Porphyromonas gingivalis facilitates mononuclear cell adhesion to vascular endothelium via Toll-like receptor-2 dependent mechanism. Atherosclerosis 2008;196:59–67. 11. Park HJ, Jeong SK, Kim SR et al. Resveratrol inhibits Porphyromonas gingivalis lipopolysaccharide-induced endothelial adhesion molecule expression by suppressing NF-kappaB activation. Arch Pharm Res 2009;32:583–591. 12. Roth GA, Moser B, Roth-Walter F et al. Infection with a periodontal pathogen increases mononuclear cell adhesion to human aortic endothelial cells. Atherosclerosis 2007;190:271–281. 13. Cai SY, Lin YX, Xiao L, He QM, Ge S, Qian MZ. [Effects of Porphyromonas gingivalis with different fimA genotypes on vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 production by human umbilical vein endothelial cells]. Zhonghua Kou Qiang Yi Xue Za Zhi 2011;46:332–337. 14. Hashizume T, Kurita-Ochiai T, Yamamoto M. Porphyromonas gingivalis stimulates monocyte adhesion to human umbilical vein endothelial cells. FEMS Immunol Med Microbiol 2011;62:57–65. 15. Zhang D, Zheng H, Zhao J et al. Porphyromonas gingivalis induces intracellular adhesion molecule-1 expression in endothelial cells through the nuclear factor-kappaB pathway, but not through the p38 MAPK pathway. J Periodontal Res 2011;46:31–38. 16. Kocgozlu L, Elkaim R, Tenenbaum H, Werner S. Variable cell responses to P. gingivalis lipopolysaccharide. J Dent Res 2009;88:741–745. 17. Liu J, Duan J, Wang Y, Ouyang X. ICAM-1 is regulated by Porphyromonas gingivalis through NOD1 and NOD2 molecules in periodontal fibroblasts. J Periodontol 2013;85:358–368. 18. Zhou S, Zhang J, Zheng H, Zhou Y, Chen F, Lin J. Inhibition of mechanical stress-induced NF-kappaB promotes bone formation. Oral Dis 2013;19:59–64. 19. Girardin SE, Tournebize R, Mavris M et al. CARD4/Nod1 mediates NFkappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2001;2:736– 742. 20. Zilbauer M, Dorrell N, Elmi A et al. A major role for intestinal epithelial nucleotide oligomerization domain 1 (NOD1) in eliciting host bactericidal immune
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
responses to Campylobacter jejuni. Cell Microbiol 2007;9:2404–2416. Kim JG, Lee SJ, Kagnoff MF. Nod1 is an essential signal transducer in intestinal epithelial cells infected with bacteria that avoid recognition by toll-like receptors. Infect Immun 2004;72:1487–1495. Silver JG, Martin AW, McBride BC. Experimental transient bacteraemias in human subjects with varying degrees of plaque accumulation and gingival inflammation. J Clin Periodontol 1977; 4:92–99. Amano A, Inaba H. [Cardiovascular diseases and periodontal diseases]. Clin Calcium 2012;22:43–48. Hunt BJ, Jurd KM. Endothelial cell activation. A central pathophysiological process. BMJ 1998;316:1328–1329. Pober JS. Warner-Lambert/Parke-Davis award lecture. Cytokine-mediated activation of vascular endothelium. Physiology and pathology. Am J Pathol 1988; 133:426–433. Rietdijk ST, Burwell T, Bertin J, Coyle AJ. Sensing intracellular pathogensNOD-like receptors. Curr Opin Pharmacol 2008;8:261–266. Kuldo JM, Ogawara KI, Werner N et al. Molecular pathways of endothelial cell activation for (targeted) pharmacological intervention of chronic inflammatory diseases. Curr Vasc Pharmacol 2005;3: 11–39. Libby P. Inflammatory mechanisms: the molecular basis of inflammation and disease. Nutr Rev 2007;65:S140–S146. Klein CL, Bittinger F, Kohler H et al. Comparative studies on vascular endothelium in vitro. 3. Effects of cytokines on the expression of E-selectin, ICAM-1 and VCAM-1 by cultured human endothelial cells obtained from different passages. Pathobiology 1995;63: 83–92. Damnjanovic G, Jelic M, Dindic B, Ilic S. [Serum concentration of soluble adhesive molecules in patients with different forms of coronary artery disease]. Vojnosanit Pregl 2009;66:265–270. Lu HH, Sheng ZQ, Wang Y, Zhang L. Levels of soluble adhesion molecules in patients with various clinical presentations of coronary atherosclerosis. Chin Med J (Engl) 2010;123:3123–3126. Roebuck KA, Finnegan A. Regulation of intercellular adhesion molecule-1 (CD54) gene expression. J Leukoc Biol 1999;66:876–888.
