Ocular hypertension results in retinotopic alterations in the visual cortex of adult mice.

Current Eye Research, Early Online, 1–15, 2015 ! Informa Healthcare USA, Inc. ISSN: 0271-3683 print / 1460-2202 online DOI: 10.3109/02713683.2014.990983

RESEARCH REPORT

Ocular Hypertension Results in Retinotopic Alterations in the Visual Cortex of Adult Mice Eline Dekeyster1*, Jeroen Aerts2*, Francisco Javier Valiente-Soriano3, Lies De Groef1, Samme Vreysen2, Manuel Salinas-Navarro1, Manuel Vidal-Sanz3, Lutgarde Arckens2*, and Lieve Moons1*

Curr Eye Res Downloaded from informahealthcare.com by Lakehead University on 03/18/15 For personal use only.

1

Neural Circuit Development and Regeneration Research Group, Department of Biology, KU Leuven, Leuven, Belgium, 2Laboratory of Neuroplasticity and Neuroproteomics, Department of Biology, KU Leuven, Leuven, Belgium, and 3Department of Ophthalmology, University of Murcia and IMIB-Arrixaca, Murcia, Spain

ABSTRACT Purpose: Glaucoma is a group of optic neuropathies characterized by the loss of retinal ganglion cells (RGCs). Since ocular hypertension (OHT) is a main risk factor, current therapies are predominantly based on lowering eye pressure. However, a subset of treated patients continues to lose vision. More research into pathological mechanisms underlying glaucoma is therefore warranted in order to develop novel therapeutic strategies. In this study we investigated the impact of OHT from eye to brain in mice. Methods: Monocular hypertension (mOHT) was induced in CD-1 mice by laser photocoagulation (LP) of the perilimbal and episcleral veins. The impact on the retina and its main direct target area, the superficial superior colliculus (sSC), was examined via immunostainings for Brn3a, VGluT2 and GFAP. Alterations in neuronal activity in V1 and extrastriate areas V2L and V2M were assessed using in situ hybridization for the activity reporter gene zif268. Results: Transient mOHT resulted in diffuse and sectorial RGC degeneration. In the sSC contralateral to the OHT eye, a decrease in VGluT2 immunopositive synaptic connections was detected one week post LP, which appeared to be retinotopically linked to the sectorial RGC degeneration patterns. In parallel, hypoactivity was discerned in contralateral retinotopic projection zones in V1 and V2. Despite complete cortical reactivation 4 weeks post LP, in the sSC no evidence for recovery of RGC synapse density was found and also the concomitant inflammation was not completely resolved. Nevertheless, sSC neurons appeared healthy upon histological inspection and subsequent analysis of cell density revealed no differences between the ipsi- and contralateral sSC. Conclusion: In addition to RGC death, OHT induces loss of synaptic connections and neuronal activity in the visual pathway and is accompanied by an extensive immune response. Our findings stress the importance of looking beyond the eye and including the whole visual system in glaucoma research. Keywords: Glaucoma, ocular hypertension, retinal ganglion cell, superior colliculus, visual cortex

INTRODUCTION

worldwide and an increasingly important public health concern due to the aging world population.1 While age is a significant causative factor, so far the only modifiable risk factor and sole target for clinical intervention is elevated intraocular pressure (IOP) or ocular hypertension (OHT).2–4 Glaucoma has long

Glaucoma refers to a group of optic neuropathies involving structural damage to the optic nerve (ON), retinal ganglion cell (RGC) death and visual field defects. It is a leading cause of irreversible blindness

*These authors contributed equally to this work. Received 14 July 2014; revised 17 October 2014; accepted 18 November 2014; published online 16 January 2015 Correspondence: Prof. Dr. Lieve Moons, Neural Circuit Development and Regeneration Research Group, Animal Physiology and Neurobiology Section, Department of Biology, KU Leuven, Naamsestraat 61, Box 2464, B-3000 Leuven, Belgium. Tel: (32)-16-32.39.91. Fax: (32)16-32.42.62. E-mail: [email protected]

1


2

E. Dekeyster et al.

been considered an eye disease, but recent anatomical and functional examinations in patients and animal models revealed degenerative changes in several retinal target structures in the brain,5–12 manifesting glaucoma as a disease beyond the eye. Postmortem histological analyses as well as magnetic resonance imaging disclosed atrophy of the lateral geniculate nucleus (LGN), reduced cortical thickness and activity changes in the primary visual cortex (V1) of glaucoma patients.9,10,13,14 A number of studies in primate OHT models revealed altered metabolic activity in the LGN and V1, as well as neuron loss, shrinkage of neurons, structural dendritic plasticity, microglial activation and gliosis in the LGN.5,7,8,15–24 In the murine optic nerve crush (ONC) model, cell loss in the superficial layers of the superior colliculus (sSC) has been described.25 In the murine N-methyl-D-aspartate (NMDA) excitotoxicity model, glial reactivity and neuron loss have been revealed in the LGN and the sSC.26,27 The glial response in these areas was confirmed in a rat OHT model and in DBA/2 mice, a genetic model for glaucoma.28 Furthermore, OHT induction in rats resulted in dendritic changes of both LGN and sSC neurons.29 Changes in cortical visual evoked potentials (VEPs), as a sign of reduced transmission of visual information, have been described in visual cortex of rats with severe RGC damage upon ONC.30 However, such VEP changes were not detected in rats subjected to an OHT model, despite reduced retinal function verified by histology and electroretinography (ERG).31 To our knowledge, effects on the primary visual cortex (V1) and higher order visual areas have not been described so far in any murine OHT glaucoma model. Further investigation of the visual brain areas in glaucoma is crucial to obtain a complete picture of the disease pathogenesis. The goal of the present study is to advance the knowledge on the effect of OHT on the adult visual system. Thereto, using a monocular hypertension (mOHT) mouse glaucoma model, RGC degeneration patterns were analyzed and linked to morphological changes in the sSC and functional changes in V1 and higher order visual areas V2 lateral (V2L) and medial (V2M) at an early and late time point after mOHT induction.

The mOHT Model: Laser Photocoagulation and IOP Measurements Monocular hypertension (mOHT) was induced in the left eye through laser photocoagulation (LP) of the perilimbal and episcleral veins as described previously, creating an increased resistance of aqueous humor outflow.32,33 Briefly, a 532 nm diode laser (Quantel Medical, Cedex, France) was used to deliver approximately 70 laser spots (0.5 s exposure time and 0.3 W power intensity) to the perilimbal and episcleral veins of animals anesthetized with xylazine hydrochloride (10 mg/kg, Rompu´n, Bayer, Leverkusen, Germany) and ketamine hydrochloride (75 mg/kg, Ketalar, Parke-Davis, Detroit, MI). During recovery, tobramycin eye ointment (Tobrex, Alcon, Hu¨nenberg, Switzerland) was applied to the cornea of both eyes to prevent desiccation. The intraocular pressure (IOP) was measured under general anesthesia (10 mg/kg xylazine and 75 mg/kg ketamine) before and at 24 h, 48 h and 7 days after LP using a calibrated rebound tonometer (Tono-Lab, Icare, Helsinki, Finland).

Tissue Processing At one and four weeks post LP and prior to sacrifice, mice underwent an overnight dark-exposure followed by 450 of bright light to obtain an optimal visually evoked immediate early gene (IEG) expression.34–38 Animals were anesthetized with sodium pentobarbital (200 mg/kg, Nembutal, Ceva Sante Animale, Libourne, France) prior to cervical dislocation. Upon dissection, eyes were fixed for 1 h in 4% paraformaldehyde (PFA) in 0.01 M phosphate buffered saline (PBS). Subsequently, retinas were dissected, flatmounted and post-fixed for 1 h in 4% PFA. Brains were dissected, immediately frozen in 2-methylbutane at 40 C and kept at 80 C until sectioning. Twentyfive micrometer-thick coronal sections were prepared on a cryostat (Microm HM 500 OM, Walldorf, Germany), mounted on 0.1% poly-L-lysine-coated (Sigma-Aldrich, St. Louis, MO) slides and stored at 20 C until further processing.

Immunohistochemistry (IHC) MATERIAL AND METHODS Animals All experiments were performed on male CD-1 mice of 10–12 weeks old, housed in standard laboratory conditions under a 12/12 h dark/light cycle with food and water ad libitum. The experiments were approved by the KU Leuven Animal Ethics Committee and followed the guidelines of the ARVO statement for the use of animals in ophthalmic and vision research.

Whole-mount retinas were stained for Brn3a, a POUdomain transcription factor and a reliable marker for healthy RGCs.39–41 Retinas were permeabilized in PBS containing 0.5% Triton X-100 (PBST), frozen at 80 C for 150 , rinsed in PBST and incubated overnight at room temperature (RT) with primary antibody (goat anti-Brn3a, Santa Cruz, Dallas, TX) diluted 1:500 in PBS containing 2% Triton X-100 and 2% donkey preimmune serum. The next day, retinas were rinsed in PBST and incubated for 2 h with secondary antibody Current Eye Research


OHT Induces Retinotopic Effects in the Brain (Alexa Fluor-568 conjugated donkey anti-goat IgG, Invitrogen, Carlsbad, CA) diluted 1:500 in PBS containing 2% Triton X-100. Retinas were subsequently rinsed in PBST and PBS before being mounted on glass slides with anti-fading mounting medium containing 50% glycerol and 0.4% I-phenylenediamine in 0.1 M sodium carbonate buffer (pH 9.0). RGC synapses and reactive astrocytes were visualized on serial 25 mm transverse brain sections throughout the sSC (every 100 mm) by IHC for vesicular glutamate transporter 2 (VGluT2) and glial fibrillary acidic protein (GFAP), respectively. Sections were postfixed in 4% PFA for 450 , rinsed in 0.01 M tris buffered saline (TBS) and incubated for 1 h in TBS containing 0.5% blocking reagents (Perkin Elmer, Waltham, MA) (TNB) and 20% normal goat serum, followed by overnight incubation at RT with primary antibody rabbit-anti-VGluT2 (1:250 in TNB, Invitrogen, Carlsbad, CA) or rabbit-anti-GFAP (1:1000 in TNB, Dako, Glostrup, Denmark). The next day, sections were rinsed in TBS, incubated for 2 h with secondary antibody (Alexa Fluor-488 conjugated goat-anti-rabbit IgG, 1:200 in TNB, Invitrogen) and rinsed in TBS. Finally, a 40 ,6-diamidino-2-phenylindole (DAPI) (1 mg/ ml in PBS, Dako) nuclear staining was performed for 30 minutes, before mounting with Mowiol solution (3.72 mM Mowiol (Sigma-Aldrich, St. Louis, MO), 3.13 M glycerol, 0.1% 1,4-diazabicyclo[2.2.2]octane (DABCO), 0.2 M Tris (pH8.5) in distilled water).

Analysis of IHC Patterns Brn3a-stained whole-mount retinas were imaged with an epifluorescence microscope (Axioscop 2 Plus, Zeiss, Oberkochen, Germany) equipped with a digital high-resolution ProgResTM C10 camera as previously described.39,42,43 Brn3a+ RGCs were automatically counted using the Image-Pro Plus 5.1 analysis program for Windows, as previously explained in detail.32,43,44 Next, images of the retinas were transformed into pseudocolor isodensity maps using SigmaPlot 9.0, to have a better view of the spatial differences in RGC density.32,43,44 The pseudocolor scale ranges from 0 (dark blue) to 5625 cells/ mm2 (red) in 45 different steps. Mice with less than 20% RGC death in the laser-treated eye as compared to the right control eye were excluded from the study. Brain sections immunostained for VGluT2 or GFAP were photographed with an epifluorescence microscope (Axio Imager Z.1, Zeiss, Oberkochen, Germany) equipped with an AxioCam MRm camera and analyses were performed using the Axiovision 4.8 digital image processing software (Zeiss, Oberkochen, Germany). The sSC area, including stratum zonale, stratum griseum superficiale and stratum opticum, was outlined and within this region the immunopositive area was detected.45 Analyses were performed !

2015 Informa Healthcare USA, Inc.

3

on 100 mm spaced 25 mm sections within the rostrocaudal region between Bregma 3.50 and 4.30 mm, with the operator blind to the procedure in order to avoid biased results. Results are shown as the percentage of the immunopositive area over the total sSC area, relative to values in naive mice. To visualize topographic changes in the VGluT2 signal within the sSC, false colour top view images representing VGluT2 levels were created, using a custom-made MATLAB script (MATLAB R2011b, The MathWorks Inc., Natick, MA). The sSC area between Bregma 3.50 and 4.30 mm was delineated in 100 mm spaced 25 mm brain sections. For each section the mean optical density relative to the white matter was calculated within 20 equally spaced segments positioned along the curvature of the sSC in each hemisphere. The acquired data were projected spatially along the dorso-ventral axis to the horizontal plane and linearly interpolated to acquire a smooth image. The relative color scale ranges from a low fluorescent signal (dark blue) to a high fluorescent signal (red).

Histology and Neuronal Cell Counts Cryostat sections of the sSC were Nissl-stained (Cresyl violet 1%, Fluka Chemika, Sigma-Aldrich) according to standard procedures, in order to visualize general morphology and cell density at four weeks post LP. Images of the stained coronal sections were obtained with a light microscope (Zeiss Axio Imager Z.1) equipped with an AxioCam MRm camera using the software program Axiovision Rel. 4.6 (Zeiss, Oberkochen, Germany). Cells exhibiting stained cytoplasm, pale nucleus and stained nucleolus were defined as healthy neurons.46 At four weeks post LP, healthy neurons were counted within 8 frames of 10,000mm2 located in the affected zone of the sSC contralateral to the OHT eye, as well as in corresponding frames in the ipsilateral sSC as an internal control. Affected zones of the sSC were outlined based on VGluT2 staining on adjacent sections. Nissl analyses were performed on sections within the rostrocaudal region between Bregma 3.50 and 4.30 mm, on two sections for each mouse (n = 4). Cell counts were performed with the operator blind to the procedure in order to avoid biased results.

In Situ Hybridization In situ hybridization (ISH) was performed with a mouse-specific synthetic oligonucleotide probe (Eurogentec, Seraing, Belgium) with sequence 50 -CC GTTGCTCAGCAGCATCATCTCCTCCAGTTTGGGG TAGTTGTCC-30 for zif268. This oligonucleotide probe has been used successfully for the analysis of


4

E. Dekeyster et al.

zif268 mRNA expression in the mouse brain in previous publications.47–49 As described earlier,50,51 the probe was 30 -end labeled with 33P-dATP using terminal deoxynucleotidyl transferase (Invitrogen, Paisley, UK). Unincorporated nucleotides were separated from the labeled probe with miniQuick SpinTM Oligo Columns (Roche Diagnostics, Brussels, Belgium). Series of cryostat sections spanning the primary visual cortex (every 50 mm, between Bregma 2.80 and 4.16 mm) were fixed, dehydrated and delipidated. The radioactively labeled probe was added to a hybridization cocktail (50% (vol/vol) formamide, 4 standard saline sodium citrate buffer, 1 Denhardt’s solution, 10% (wt/vol) dextran sulphate, 100 mg/ml herring sperm DNA, 250 mg/ml tRNA, 60 mM dithiothreitol, 1% (wt/vol) N-lauroyl sarcosine, 20 mM NaHPO4, pH 7.4) and applied to a series of cryostat sections (106cpm per section) for an overnight incubation at 37 C in a humid chamber. The following day, sections were rinsed in 1 standard saline sodium citrate buffer at a temperature of 42 C, dehydrated, air-dried and exposed to an autoradiographic film (Biomax MR, Kodak, Zaventem, Belgium). Films were developed in Kodak D19 developing solution after six days, followed by fixation in Rapid fixer (Ilford Hypam, Kodak, Rochester, NY). For each mouse, autoradiographic images from three sections were scanned at 1200 dpi (CanoScan LIDE 600F, Canon, Tokyo, Japan). Pseudocolor maps were generated with a custom-made MATLAB script (MATLAB R2011b, The MathWorks Inc., Natick, MA) and represent a false coloring of the grey values: a low grey value is represented in black/green, a high grey value in white/yellow, indicating a low signal response or a high signal response, respectively. This is done in accordance with a grey scale ranging from black (0) to white (255).

Localization of Visual Areal Boundaries with Cresyl Violet To anatomically delineate the areal borders of the different visual subdivisions in the visual cortex, a comparison was made with Nissl counterstained sections as described previously.47,52–54 All topographic denominations were adopted from these papers. This method allows for the generation of animal specific coronal atlases of the visual cortex and thus provides a reliable guide for the interpretation of zif268 in situ hybridization (ISH) results. In all figures, large arrowheads indicate the total extent of the visual cortex while small arrowheads indicate interareal borders. We here focus on three regions from medial to lateral: medial extrastriate cortex (V2M), primary visual cortex (V1) and lateral extrastriate cortex (V2L).38,47

Optical Density Profiles: Quantification of Cortical zif268 Expression As described before,48,54 optical density values (mean gray value per pixel) from the autoradiograms of different experimental and control groups were quantified using a custom-made MATLAB script (MATLAB R2011b, The MathWorks Inc., Natick, MA). In order to demarcate the region of interest in the hemisphere contralateral to the lasered eye, the top edge of the cortex and the boundary where layer VI meets the white matter were determined. These borders were computed by a contour smoothing algorithm based on the Gaussian weighted least squares fit55 from manually drawn lines on the autoradiogram. The different areal and functional boundaries as derived from Nissl patterns were subsequently registered to the curvature of the top and bottom boundaries. Next, the delineated region of interest was equally divided into 24 segments, each spanning the 6 cortical layers. To compensate for possible variation in brain size and morphology, the lattice was translated over the cortical curvature on each autoradiogram, fixing the border of a specific segment to an areal border. For each segment created this way, the relative optical density was calculated as the mean gray value of all pixels normalized to the mean gray value of a square measured in the thalamus (a defined region with no zif268 expression above background). This procedure was required to compare autoradiograms across experiments.47,56 These optical density profiles were assessed along the anatomically defined visual subdivisions V2L, V1 and V2M.

Statistics All data are presented as mean ± SEM. A normal distribution was verified using the Kolmogorov– Smirnov test and parallel equal variance between groups was tested. If the test requirements were fulfilled, a parametrical two-way ANOVA was used. Fisher’s Least Significant Difference post hoc tests were used for pairwise comparisons and a probability level (a-level was set to 0.05) of 50.05 was accepted as statistically significant (*p50.05, **p50.01, ***p50.001). When criteria for parametric statistics were not fulfilled, a non-parametrical Kruskal–Wallis analysis with a Mann–Whitney U-rank sum test for pairwise comparison of independent samples was applied. When no interaction between the two factors studied was observed, a one-way ANOVA with an unpaired Student t-test for pairwise comparison was used (*p50.05, **p50.01, ***p50.001). All statistical analyses were performed using SigmaStat 3.1 (SYSTAT software, San Jose, CA). Current Eye Research

OHT Induces Retinotopic Effects in the Brain

RESULTS

5

experimental eyes (Figure 1C), which is in line with previous publications.57


Laser-Induced IOP Elevation and RGC Degeneration Laser photocoagulation (LP) of the perilimbal and episcleral veins of the left eye resulted in a significant elevation of IOP at one and two days post LP (p50.001), which returned to baseline values after seven days (Figure 1A). The IOP of the right control eye (15.5 ± 0.1 mmHg; n = 12) did not change over time and equaled the basal IOP of naive control mice (15.2 ± 1.0 mmHg; n = 6). At one and four weeks following laser-treatment, surviving RGCs were visualized on retinal whole-mounts by IHC for the RGC marker Brn3a. The average number of RGCs in retinas of the right control eye of mice sacrificed at one (42,822 ± 1051; n = 7) and four weeks (44,497 ± 924; n = 5) after LP were similar to those in naive retinas (46,127 ± 1042; n = 6). Laser-treated eyes showed 56.8 ± 6.7% RGC survival at one week post LP (p50.001; n = 7), and 41.4 ± 8.5% (p50.01; n = 5) at four weeks post LP when normalized to the experimentally matched right control eyes (Figure 1B). Isodensity maps of the retinas showed a sectorial pattern of RGC death on top of diffuse RGC loss in all

Early Changes in sSC and the Visual Cortex Triggered by mOHT Induction In mice, almost all RGCs project to the sSC,43,58,59 making this brain center the most prominent direct retinal target and the area of choice to examine morphological changes in subcortical brain regions upon mOHT induction in this study. Astroglial reactivity was examined since degeneration processes are almost always preceded or accompanied by gliosis.60,61 At one week post LP, a significant enlargement of the GFAP+ area was observed within the sSC contralateral to the hypertensive eye (+327.8 ± 19.1%; n = 7; p50.001), as compared to naive mice (n = 4) (Figure 2A and B). Glial reactivity was also detectable in the ipsilateral sSC (+222.5 ± 13.3%; p50.001; Figure 2A and B), although less pronounced. RGC synaptic terminals were visualized using IHC for VGluT2, a presynaptic glutamatergic vesicle marker, and decreased VGluT2 IHC signal was used as a measure for loss of RGC synapses. In comparison

FIGURE 1 Effects of LP on IOP and RGC degeneration in the glaucomatous eye. (A) IOP measurements before and after LP of the perilimbal and episcleral vessels of the left eye reveal a transient IOP rise in this eye as compared to the right control eye at 24 h and 48 h post LP, and a return to baseline levels at 7 days post LP (n = 12). (B) Analysis of the density of Brn3a labeled RGCs in retinal whole-mounts, relative to the number in naive retinas, discloses a significantly reduced RGC survival in the photocoagulated OS both one and four weeks after LP, as compared to naive or control OD eyes (nnaive = 6; n1week = 7; n4weeks = 5). (C) Illustrative isodensity maps of a Brn3a-stained control and laser-treated retina with the latter showing a sectorial pattern of RGC death on top of diffuse RGC loss. The pseudocolor scale ranges from 0 RGCs/mm2 (dark blue) till 5625 or higher RGCs/mm2 (red). Scale bar: 1 mm. All data are mean ± SEM with *p50.05, **p50.01, ***p50.001. Abbreviations: LP, laser photocoagulation; IOP, intraocular pressure; RGC, retinal ganglion cell; OS, oculus sinister; OD, oculus dexter; D, dorsal; V, ventral; N, nasal; T, temporal. !



6

E. Dekeyster et al.

FIGURE 2 Astroglial reactivity and disregulation of RGC synapse function in the sSC at one and four weeks post LP. (A) Morphometric analyses of the GFAP density (GFAP+ area over total sSC area, relative to density in naive brain) in the sSC ispilateral and contralateral to the LP eye, reveal an increase in astrocyte reactivity within the sSC at one week after LP, both ipsilateral and contralateral to the hypertensive eye, although less pronounced ipsilaterally. At four weeks post LP the ipsilateral glial response is no longer detectable, while the contralateral sSC still shows a significant upregulation in GFAP expression, albeit lower than at one week post LP (nnaive = 6; n1week = 7; n4weeks = 5). Data are mean ± SEM with *p50.05, **p50.01, ***p50.001. The large asterisk indicates a significant difference with all other conditions. (B) GFAP immunopositive astrocytes in naive control, one week post LP, and four weeks post LP. Scale bars: 1 mm. (C) Morphometric analysis of the VGluT2 density (VGluT2+ area over total sSC area, relative to density in naive brain) in the sSC ispilateral and contralateral to the hypertensive eye, shows a clear and similar decrease in the RGC synapses in the contralateral sSC at one and four weeks post LP (nnaive = 6; n1week = 7; n4weeks = 5). Abbreviations: sSC, superficial superior colliculus; LP, laser photocoagulation; GFAP, glial fibrillary acidic protein, VGluT2, vesicular glutamate transporter 2; RGC, retinal ganglion cell; contra, contralateral; ipsi, ipsilateral.

to naive mice (n = 6), a clear decrease in VGluT2 immunopositive (VGluT2+) area was detected in the contralateral sSC of laser-treated mice at one week post LP (71.4% ± 7.9; n = 7; p50.001; Figure 2C). A more subtle reduction was also noticeable in the ipsilateral sSC, although not significant (Figure 2C). In a next step, we investigated whether the diminished VGluT2 immunoreactivity in the sSC could be linked to the sectorial RGC degeneration pattern observed in the retina. RGCs located in the dorsal, ventral, nasal and temporal mouse retina, project respectively to the lateral, medial, caudal and rostral sSC, thereby constructing the retinotopically organized map of the visual field in the midbrain.62 In all mice, the loss of VGluT2+ RGC terminals in the contralateral sSC was undeniably retinotopically linked to zones of extensive RGC death in the eye. Two representative examples are shown in Figure 3. Both in mice with low (530%) and high (460%) amounts of RGC death, a zone of low RGC density in the dorsonasal part of the retina was associated

with a decrease in VGluT2 immunoreactivity located caudolaterally in the sSC (asterisks in Figure 3, middle and right column). RGC degeneration in the dorsotemporal retina was linked to loss of RGC synapses in the rostrolateral region of the sSC (square in Figure 3, middle and right column). ISH for the activity reporter gene zif268, allowed the screening of striate and extrastriate cortical areas for neuronal activity changes triggered by mOHT. At one week post LP, the zif268 mRNA expression pattern revealed reduced neuronal activity in distinct areas across the mediolateral extent of the visual cortex, retinotopically linked to the RGC degeneration pattern in the retina (Figure 4A and B). Of note, representative mice used to illustrate cortical effects in Figure 4, are the same animals as depicted in Figure 3 concerning the related sSC effects. In mice with rather mild RGC death (530%), RGC loss in the dorsonasal part of the retina induces a reduced neuronal activity in all layers of the medial monocular part of V1 (asterisks in Figure 4, middle column). In this animal, Current Eye Research



7

FIGURE 3 Retinotopic effects of mOHT induction in the sSC at one week post LP. (A) Isodensity maps of Brn3a stained retinas show both a diffuse RGC loss and a sectorial pattern of RGC degeneration one week after LP (middle and right) as compared to a naive control retina (left). Pseudocolor scale ranges from 0 RGCs/mm2 (dark blue) till 5625 or higher RGCs/mm2 (red). (B) Representative pictures of VGluT2 immunostained sSC contralateral and ipsilateral to the retinas shown in A, reveal that the loss of RGC synapses in the contralateral sSC is retinotopically linked to the retinal RGC degeneration pattern. Dotted lines mark the border between sSC and the deep layers of SC. Scale bars: 1 mm. (C) Top view images of the sSC surface contralateral to retinas shown in A to illustrate retinotopic effects on VGluT2 levels at one week post LP (middle and right) as compared to control (left). The pseudocolor scale represents VGluT2 immunofluorescence levels from low signal (dark blue) to high signal (red). Retinotopically linked positions in A, B and C are marked with an asterisk, circle and square. Abbreviations: mOHT, monocular hypertension; LP, laser photocoagulation; RGC, retinal ganglion cell; sSC, superficial superior colliculus; VGluT2, vesicular glutamate transporter 2; contra, contralateral; ipsi, ipsilateral.

the central retinal RGC death induced a reduction in zif268 expression in the retinotopically corresponding anterior part of the medial monocular zone of V1 (circle in Figure 4, middle column). A similar retinotopic pattern was discerned in mice with severe RGC death (460%) where dorsonasal retinal damage corresponded to a reduced activity in the medial !


monocular zone of V1 (asterisks in Figure 4, right column). In contrast to the mild RGC death condition, mice with severe RGC death in the dorsotemporal retina displayed an additional reduced neuronal activity in V2L (square in Figure 4, right column), indicative of a certain threshold before RGC death clearly affects this extrastriate visual area. In both


8

E. Dekeyster et al.

FIGURE 4 Retinotopic effects of mOHT induction in the visual cortex at one week post LP. (A) Isodensity maps of Brn3a stained retinas show both a diffuse RGC loss and a sectorial pattern of RGC degeneration one week after LP (middle and right) as compared to a naive control retina (left). Pseudocolor scale ranges from 0 RGCs/mm2 (dark blue) till 5625 or higher RGCs/mm2 (red). (B) Immediate early gene (zif268) expression in the visual cortex contralateral to the retinas shown in A disclose zones of reduced neuronal activity in V2L, V1 and V2M that are retinotopically linked to areas of extensive RGC death. The corresponding pseudocolor representations of signal intensity differences are displayed next to each section (between Bregma levels 2.80 and 4.16 mm) and represent a false coloring of the gray values: a low gray value is represented in black/green, a high gray value in white/yellow, indicating a low signal response or a high signal response respectively. (C) Optical density profiles of the three sections in B (1, 2, 3) visualize the spatial extent of cortical regions of reduced zif268 expression as seen qualitatively in panel B. Note how severe RGC loss leads to the largest fluctuation in low and high optical density values along the profiles. Retinotopically linked positions in A, B and C are marked with an asterisk and circle. Scale bars: 1 mm in A and 2 mm in B. Abbreviations: mOHT, monocular hypertension; LP, laser photocoagulation; RGC, retinal ganglion cell; V2M, medial extrastriate cortex; V1, primary visual cortex; V2L, lateral extrastriate cortex.

cases, area V2M was also characterized by a slightly reduced zif268 expression, mainly in the posterior part of the visual cortex and in the infragranular layers. Quantitative analysis of optical density values of the zif268 signal (Figure 4C) of all conditions confirmed these qualitative observations, emphasizing that IOP

elevation does reduce the functional integrity of the visual projection. Thus, besides a more diffuse astroglial response, our results show clear retinotopic effects in both sSC and distinct areas of the visual cortex studied at one week post mOHT induction. Current Eye Research



9

FIGURE 5 Long-term effects of mOHT induction throughout the visual pathway. (A) The isodensity map of a Brn3a stained retina at four weeks post LP shows a massive and sectorial degeneration of RGCs. Pseudocolor scale ranges from 0 RGCs/mm2 (dark blue) till 5625 or higher RGCs/mm2 (red). (B) In the sSC contralateral to the glaucomatous eye depicted in A, a drop in VGluT2 immunoreactive RGC synapses is still visible at four weeks post LP. (C) In V2L, V1 and V2M, the immediate early gene (zif268) expression pattern at four weeks post LP is comparable to control conditions, indicative for neural reactivation and cortical plasticity. The corresponding pseudocolor representation of signal intensity differences is displayed next to the in situ hybridization section (Bregma 3.40 mm) and represent a false coloring of the gray values: a low gray value is represented in black/green, a high gray value in white/yellow, indicating a low signal response or a high signal response respectively. Note how the related optical density profile matches the profile of section 3 of the control mouse in Figure 4C (left column), reflecting a recovery of activity to normal levels. Scale bars: 1 mm in A and B and 2 mm in C. Abbreviations: mOHT, monocular hypertension; LP, laser photocoagulation; RGC, retinal ganglion cell; VGluT2, vesicular glutamate transporter 2; contra, contralateral; V2M, medial extrastriate cortex; V1, primary visual cortex; V2L, lateral extrastriate cortex.

Long-Term Effects of mOHT Induction We previously showed a more elaborate hypoactivity in V1 after one week of monocular enucleation (ME) in adult mice followed by a complete cortical reactivation in the weeks weeks post injury.47 To investigate whether a similar cortical reactivation might occur in the mOHT model, we analyzed zif268 expression at a later time point after laser-treatment. At four weeks post LP, the activity patterns in V2L, V1 and V2M in mice with significant RGC degeneration in the retina (Figure 5A) were comparable to control mice (Figure 5C). In the sSC, however, no significant recovery of VGluT2 immunoreactivity was seen (Figure 2C and 5B). Thus, these data clearly indicate neuronal reactivation in all areas of the visual cortex, but no concomitant increase in VGluT2 immunoreactivity in the sSC at four weeks post mOHT induction. To survey whether the mOHT model has additional long-term effects in the sSC, such as a prolonged astroglial response, we also performed IHC for GFAP at four weeks post LP (Figure 2B). Remarkably, the ipsilateral GFAP immunoreactivity, which increased at one week post LP (p = 0.002), attenuated to control levels at four weeks (p = 0.612), while the contralateral sSC (+227.0% ± 33.6; p = 0.001) still showed a significant glial response, albeit lower than at one week post LP (p50.001; Figure 2A). Thus, these results illustrate !


that gliosis in the sSC is still present at four weeks after LP. Of note, in comparison to the retinotopic decrease of VGluT2+ signal (Figure 3), glial reactivity was found to be a rather diffuse phenomenon (Figure 2B) and may therefore reflect more the diffuse RGC loss at the level of the retina. As prolonged astroglial reactivity in the sSC contralateral to the OHT eye might point towards neuronal degeneration of the sSC neurons due to a lack of input, we further investigated the general morphology and density of these neurons. A Nissl staining performed at four weeks post LP showed that sSC neurons appeared healthy in both hemispheres and subsequent quantification revealed a normal neuronal density in affected zones (2081.9 cells/ mm2 ± 120.2) of the sSC contralateral to the lasertreated eye, in comparison to matched internal control regions (1939.4 cells/mm2 ± 55.8) in the ipsilateral sSC (n = 4; p = 0.633). Hence, sSC neurons did not degenerate upon mOHT induction at the time points analyzed.

DISCUSSION Over the past decade, glaucoma is increasingly being recognized as a disease of the entire visual system rather than an ‘‘eye disease’’.8–11,25,63,64 In this study we intended to contribute to a better understanding of

10 E. Dekeyster et al. the interplay between the eye and the brain in glaucoma pathology, by examining the impact of OHT on the sSC and the visual cortex in the mouse.


Retinotopic Effects of mOHT Induction: Reduced RGC Synapse Density in the sSC Since elevated IOP remains the most important modifiable risk factor, several murine OHT models have been developed to study mechanisms underlying glaucoma pathology. All of these models have their own advantages and drawbacks, thoroughly reviewed in57, none of them covering all aspects of human glaucoma. Nevertheless, these models are applicable to improve our understanding on the relation between OHT and vision loss. Within the model used in this study, IOP values had normalized and about 50% of the RGC had died at one week after successful mOHT induction. Although these features only partially mimic the chronic progression of glaucoma in human patients, transient OHT has previously been described to induce similar features as observed in the more chronic inherited DBA/2 mouse model of OHT, suggesting analogous pathological characteristics and underlying mechanisms.57 Indeed, the temporary mOHT in our model resulted in diffuse and sectorial RGC death, a typical glaucomatous retinal degeneration pattern described in human patients65 and several animal models.32,53,57,66 To further investigate whether RGC death is accompanied by morphological changes in subcortical brain regions upon mOHT induction, we focused on the sSC, since this is the main direct retinal target, receiving input from almost all RGCs in mice,43,58,59 and the 2D retinotopic organization of the retinocollicular projections is straightforward and thoroughly described,67,68 allowing retinotopic comparison of retinal degeneration patterns with morphological features in the sSC. Moreover, recently, alterations in saccadic eye movements have been reported in glaucoma patients.69–70 Thus, given that the SC is an important player in the neuronal network underlying saccade generation,70,72 studying this brain center in glaucoma research is very relevant. Our study demonstrated pronounced effects of mOHT on the sSC in mice. A clear reduction in VGluT2 immunoreactivity was observed in the sSC located contralaterally to the hypertensive eye, while in the ipsilateral sSC only a slight diminishing trend was visible. Although reduced VGluT2 immunoreactivity does not necessarily imply structural degeneration of RGC axon terminals, but might also be a consequence of downregulated VGluT2 expression in se, we believe that within the mOHT model, which is characterized by massive RGC death, diminished VGluT2 levels can be linked to RGC synapse loss.

In addition, the spatial location of VGluT2 depletion unequivocally reflected the sectorial RGC degeneration seen in the retina, a finding which is in line with our interpretation and with published results obtained in other experimentally induced or genetic rodent glaucoma models.15,28,75 Of note, the visualization of non-retinal-derived VGluT2+ synapses, e.g. those coming from cortical areas or local connections, cannot be entirely excluded, however, VGluT2+ axon terminals in the sSC are generally recognized as RGC synapses.28,73–75

Transient Retinotopic Effects Reflect Functional Recovery in the Visual Cortex After LP Our study revealed clear effects on activity levels in primary and extrastriate visual cortex in the murine mOHT model. Interestingly, Georgiou et al.31 did not find any VEP alterations in the visual cortex of mOHT rats. Their methodology of VEP recordings encompassed the use of sub-dermal electrodes, which may lack the sensitivity to detect small but significant changes in activity. In our study, ISH for zif268 revealed cortical hypoactivity in distinct subregions within area V1 and V2M, at one week post LP, which appeared to be retinotopically linked to the sectorial RGC loss in the retina.76–79 Hypoactivity in the monocular regions of V2L was however only observed in animals with severe RGC death. This suggests the existence of a certain threshold of RGC death before higher order visual areas are affected and may reflect the larger receptive fields of neurons in extrastriate areas. In comparison, previous studies from our research group also showed hypoactivity in all monocular driven zones of V2L, V1 and V2M after one week of ME in adult mice. Seven weeks post ME, a complete reactivation of all these visual areas was the result of potentiation of inputs from the remaining eye in combination with multimodal plasticity events.47 In the current study four weeks post LP the neuronal activity patterns across the entire mediolateral extent of the visual cortex were also comparable to control mice. Such a reactivation within four weeks was expected based on an earlier study by Keck et al., in which monocular retinal photocoagulator lesions resulted in a structural and functional reorganization in the monocular zone of V1 of adult mice between 2 and 3 weeks post lesion.80 Also, in our mOHT model the recovery of normal activity levels in V1 and extrastriate areas might be the result of the unmasking of local connections and potentiation of the adjacent binocular zones, including the central binocular zone and the binocular zone at the medial border of V2M.47,77,80,81 Taken together, these data indicate that the observed cortical reactivation in function of post LP survival time is most likely Current Eye Research

OHT Induces Retinotopic Effects in the Brain visually driven either via the spared eye or the remaining RGCs in the laser-treated eye.


No Recovery of RGC Synapse Density in the sSC In contrast to the activity patterns of the visual cortex, VGluT2 immunoreactivity in the sSC did not return to normal levels, suggesting that local sprouting of surviving RGC glutamatergic terminals did not occur to compensate for degenerated RGC synapses in our experimental setup. Similarly, Tropea et al. did not detect any axonal sprouting in the sSC from one to three weeks after induction of retinal lesions in adult rats.82 This is in line with the hypothesis that the critical period for reorganization of the retinofugal pathway is restricted to the first three postnatal weeks in mammals.82,83 Indeed, several reports describe that, although neonatal monocular enucleation or retinal lesions cause territorial expansion of the intact eye into the deafferented sSC zones,83–87 in adult rodents, RGCs lack the ability to reinnervate sSC areas that have lost their retinal input.82,83 Newly available synapse positions may, however, still be reoccupied. Following RGC synapse elimination, the postsynaptic sites might be conquered by non-retinal terminals from the immediate vicinity85 or from cortical origin.89,90 Another phenomenon, confirming adaptive capacities of the adult visual system, is the expansion in receptive-field size of retinal target neurons upon IOP increase,91 which might originate from dendritic field extension at the level of either surviving RGCs in the retina,91,92 or the retinal target neurons themselves.22,24 Glaucomainduced alterations in RGC synaptic strength21,91,93,94 possibly lead to activation of previously silent synapses, resulting in a broader activation area and thus larger receptive fields.94 In addition, decreased inhibition might account for unmasking of silent connections,94,95 since reorganization of intrinsic inhibitory GABAergic synaptic terminals in the sSC has been described upon loss of retinal innervations in adult rats.88

Prolonged Astroglial Reactivity in the sSC To survey whether the mOHT model has other longterm features in the sSC, we studied gliosis at one and four weeks post LP. Animals subjected to mOHT showed vigorous astroglial reactivity in both sSCi early after laser-induction, confirming studies in several animal models as well as human patients, reporting astrogliosis in the retinal projection areas, even at mild glaucoma stages.8,20,28,96–98 Conversely, three weeks later, this effect was only visible in the sSC contralateral to the experimental eye, albeit less !


11

pronounced than early post LP, suggesting that also the contralateral glial response will disappear over time. Transient subcortical astroglial activation has likewise been described in other glaucoma models, shortly in the sSC ipsilateral and more prolonged, although also temporary, in the sSC contralateral to the experimental eye.27,96 Studying glial reactivity in the brain in relation to glaucoma pathology is very relevant, since glial cells, in particular astrocytes, are becoming increasingly recognized as important players in the pathogenesis of various central nervous system disorders, such as epilepsy and Alzheimer’s disease.97 Moreover, noninvasive imaging of gliosis in the human LGN has recently been proposed as a possible diagnostic tool for glaucoma.99

OHT Does Not Cause Neuronal Degeneration in sSC Long-term glial reactivity detected in the sSC upon mOHT induction, might be indicative for neuronal degeneration of the RGC target neurons, possibly caused by the sustained reduction or loss of retinal input. Surprisingly, quantitiave analysis on Nissl stained sections from mice sacrificed four weeks post mOHT induction, revealed a normal cell density and cell morphology of sSC neurons in affected zones. At first sight, our observations might be in contrast with previous reports describing cell shrinkage and a reduced number of neurons in retinal target areas upon experimentally induced glaucoma. However, neurodegeneration in visual brain centers shown in these studies typically appears only at late stages of disease progression.16,27,100,101 Thus, our experimental setup might not have been long enough to detect delayed processes such as transsynaptic neurodegeneration.19 Nevertheless, dendritic shrinkage and loss in sSC neurons has been described in mOHT rats at four weeks after IOP elevation.29 Unfortunately, Nissl staining did not allow detailed examination of dendritic characteristics in the current study.

CONCLUSION Within the laser-induced mOHT model, we could largely confirm previous findings described for subcortical RGC projection areas in other glaucoma models, such as changes in RGC synapse functioning and intensive but transient astroglial reactivity. However, our data uniquely extend to findings in the visual cortex where mOHT results in reduced neuronal activity in V1 and extrastriate areas and is characterized by a complete recovery of neuronal activity over time. To our knowledge, this is the first

12 E. Dekeyster et al. study describing effects on activity patterns in the visual cortex in a murine OHT model.

ACKNOWLEDGEMENTS The authors thank Ria Vanlaer, Lut Noterdaeme and Marijke Christiaens for their technical assistance.


DECLARATION OF INTEREST The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. Eline Dekeyster is supported by a PhD fellowship of the Research Foundation Flanders (FWO). Jeroen Aerts is supported by a PhD fellowship of the Agency for Innovation through Science and Technology Flanders (IWT Vlaanderen). This study was also supported by the Flemisch Institute for the Promotion of Scientific Research (IWT) [SBO Optobrain 110086], the Research Foundation Flanders (FWO) [G.0A65.13], a type I Hercules Equipment grant [AKUL/09/038], national grants from the Research Council of KU Leuven [OT10/ 033] and a research grant from the Ministry of Economy and Competitiveness of Spain [SAF201238328].

REFERENCES 1. Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol 2006;90:262–267. 2. Morrison JC, Johnson EC, Cepurna W, Jia L. Understanding mechanisms of pressure-induced optic nerve damage. Prog Retin Eye Res 2005;24:217–240. 3. Morrison JC, Johnson E, Cepurna WO. Rat models for glaucoma research. Prog Brain Res 2008;173:285–301. 4. Morrison JC, Cepurna Ying Guo WO, Johnson EC. Pathophysiology of human glaucomatous optic nerve damage: insights from rodent models of glaucoma. Exp Eye Res 2011;93:156–164. 5. Crawford ML, Harwerth RS, Smith EL, Mills S, Ewing B. Experimental glaucoma in primates: changes in cytochrome oxidase blobs in V1 cortex. Invest Ophthalmol Vis Sci 2001;42:358–364. 6. Chan KC, So KF, Wu EX. Proton magnetic resonance spectroscopy revealed choline reduction in the visual cortex in an experimental model of chronic glaucoma. Esp Eye Res 2009;88:65–70. 7. Imamura K, Onoe H, Shimazawa M, Nozaki S, Wada Y, Kato K, et al. Molecular imaging reveals unique degenerative changes in experimental glaucoma. Neuroreport 2009; 20:139–144. 8. Lam D, Jim J, To E, Rasmussen C, Kaufman PL, Matsubara J. Astrocyte and microglial activation in the lateral geniculate nucleus and visual cortex of glaucomatous and optic nerve transected primates. Mol Vis 2009;15: 2217–2229.

9. Gupta N, Yucel YH. Should we treat the brain in glaucoma? Can J Ophthalmol 2007;42:409–413. 10. Gupta N, Greenberg G, de Tilly LN, Gray B, Polemidiotis M, Yucel YH. Atrophy of the lateral geniculate nucleus in human glaucoma detected by magnetic resonance imaging. Br J Ophthalmol 2009;93:56–60. 11. Boucard CC, Hernowo AT, Maguire RP, Jansonius NM, Roerdink JB, Hooymans JM, et al. Changes in cortical grey matter density associated with long-standing retinal visual field defects. Brain 2009;132:1898–1906. 12. Heiduschka P, Julien S, Schuettauf F, Schnichels S. Loss of retinal function in aged DBA/2J mice – new insights into retinal neurodegeneration. Exp Eye Res 2010; 91:779–783. 13. Duncan RO, Sample PA, Weinreb RN, Bowd C, Zangwill LM. Retinotopic organization of primary visual cortex in glaucoma: comparing fMRI measurements of cortical function with visual field loss. Progr Retinal Eye Res 2007;26:38–56. 14. Lee JY, Jeong HJ, Lee JH, Kim YJ, Kim EY, Kim YY, et al. An investigation of lateral geniculate nucleus volume in patients with primary open-angle glaucoma using 7 tesla magnetic resonance imaging. Invest Ophthalmol Vis Sci 2014;55:3468–3476. 15. Weber AJ, Chen H, Hubbard WC, Kaufman PL. Experimental glaucoma and cell size, density, and number in the primate lateral geniculate nucleus. Invest Ophthalmol Vis Sci 2000;41:1370–1379. 16. Yucel YH, Zhang Q, Gupta N, Kaufman PL, Weinreb RN. Loss of neurons in magnocellular and parvocellular layers of the lateral geniculate nucleus in glaucoma. Arch Ophthalmol 2000;118:378–384. 17. Yucel YH, Zhang Q, Weinreb RN, Kaufman PL, Gupta N. Atrophy of relay neurons in magno- and parvocellular layers in the lateral geniculate nucleus in experimental glaucoma. Invest Ophthalmol Vis Sci 2001;42:3216–3222. 18. Yucel YH, Zhang Q, Weinreb RN, Kaufman PL, Gupta N. Effects of retinal ganglion cell loss on magno-, parvo-, koniocellular pathways in the lateral geniculate nucleus and visual cortex in glaucoma. Prog Retin Eye Res 2003;22: 465–481. 19. Gupta N, Yucel YH. What changes can we expect in the brain of glaucoma patients? Surv Ophthalmol 2007;52: S122–S126. 20. Sasaoka M, Nakamura K, Shimazawa M, Ito Y, Araie M, Hara H. Changes in visual fields and lateral geniculate nucleus in monkey laser-induced high intraocular pressure model. Exp Eye Res 2008;86:770–782. 21. Ito Y, Shimazawa M, Chen YN, Tsuruma K, Yamashima T, Araie M, et al. Morphological changes in the visual pathway induced by experimental glaucoma in Japanese monkeys. Exp Eye Res 2009;89:246–255. 22. Ly T, Gupta N, Weinreb RN, Kaufman PL, Yucel YH. Dendrite plasticity in the lateral geniculate nucleus in primate glaucoma. Vision Res 2011;51:243–250. 23. Yucel Y. Central nervous system changes in glaucoma. J Glaucoma 2013;22:S24–S25. 24. Gupta N, Ly T, Zhang Q, Kaufman PL, Weinreb RN, Yucel YH. Chronic ocular hypertension induces dendrite pathology in the lateral geniculate nucleus of the brain. Exp Eye Res 2007;84:176–184. 25. Liu Y, McDowell CM, Zhang Z, Tebow HE, Wordinger RJ, Clark AF. Monitoring retinal morphological and functional changes in mice following optic nerve crush. Invest Ophthalmol Vis Sci 2014;55:3766–3774. 26. Ito Y, Shimazawa M, Hara H. REVIEW: an approach for neuroprotective therapies of secondary brain damage after excitotoxic retinal injury in mice. CNS Neurosci Therap 2010;16:e169–e179. Current Eye Research


OHT Induces Retinotopic Effects in the Brain 27. Tanaka H, Ito Y, Nakamura S, Shimazawa M, Hara H. Involvement of brain-derived neurotrophic factor in timedependent neurodegeneration in the murine superior colliculus after intravitreal injection of N-methyl-D-aspartate. Mol Vis 2009;15:662–669. 28. Crish SD, Dapper JD, MacNamee SE, Balaram P, Sidorova TN, Lambert WS, et al. Failure of axonal transport induces a spatially coincident increase in astrocyte BDNF prior to synapse loss in a central target. Neuroscience 2013;229:55–70. 29. Liu M, Guo L, Salt TE, Cordeiro MF. Dendritic changes in rat visual pathway associated with experimental ocular hypertension. Curr Eye Res 2014;39:953–963. 30. Klocker N, Zerfowski M, Gellrich NC, Bahr M. Morphological and functional analysis of an incomplete CNS fiber tract lesion: graded crush of the rat optic nerve. J Neurosci Meth 2001;110:147–153. 31. Georgiou AL, Guo L, Francesca Cordeiro M, Salt TE. Electroretinogram and visual-evoked potential assessment of retinal and central visual function in a rat ocular hypertension model of glaucoma. Curr Eye Res 2014;39: 472–486. 32. Salinas-Navarro M, Alarcon-Martinez L, ValienteSoriano FJ, Ortin-Martinez A, Jimenez-Lopez M, AvilesTrigueros M, et al. Functional and morphological effects of laser-induced ocular hypertension in retinas of adult albino Swiss mice. Mol Vis 2009;15:2578–2598. 33. Cuenca N, Pinilla I, Fernandez-Sanchez L, SalinasNavarro M, Alarcon-Martinez L, Aviles-Trigueros M, et al. Changes in the inner and outer retinal layers after acute increase of the intraocular pressure in adult albino Swiss mice. Exp Eye Res 2010;91:273–285. 34. Worley PF, Christy BA, Nakabeppu Y, Bhat RV, Cole AJ, Baraban JM. Constitutive expression of zif268 in neocortex is regulated by synaptic activity. Proc Natl Acad Sci USA 1991;88:5106–5110. 35. Arckens L, Van der Gucht E, Eysel UT, Orban GA, Vandesande F. Investigation of cortical reorganization in area 17 and nine extrastriate visual areas through the detection of changes in immediate early gene expression as induced by retinal lesions. J Comp Neurol 2000;425: 531–544. 36. Kaczmarek L, Chaudhuri A. Sensory regulation of immediate-early gene expression in mammalian visual cortex: implications for functional mapping and neural plasticity. Bran Res Brain Res Rev 1997;23:237–256. 37. Zangenehpour S, Chaudhuri A. Differential induction and decay curves of c-fos and zif268 revealed through dual activity maps. Brain Res Mol Brain Res 2002;109:221–225. 38. Van der Gucht E, Hof PR, Van Brussel L, Burnat K, Arckens L. Neurofilament protein and neuronal activity markers define regional architectonic parcellation in the mouse visual cortex. Cereb Cortex 2007;17:2805–2819. 39. Nadal-Nicolas FM, Jimenez-Lopez M, Sobrado-Calvo P, Nieto-Lopez L, Canovas-Martinez I, Salinas-Navarro M, et al. Brn3a as a marker of retinal ganglion cells: qualitative and quantitative time course studies in naive and optic nerve-injured retinas. Invest Ophthalmol Vis Sci 2009;50: 3860–3868. 40. Galindo-Romero C, Aviles-Trigueros M, Jimenez-Lopez M, Valiente-Soriano FJ, Salinas-Navarro M, Nadal-Nicolas F, et al. Axotomy-induced retinal ganglion cell death in adult mice: quantitative and topographic time course analyses. Exp Eye Res 2011;92:377–387. 41. Galindo-Romero C, Valiente-Soriano FJ, Jimenez-Lopez M, Garcia-Ayuso D, Villegas-Perez MP, Vidal-Sanz M, et al. Effect of brain-derived neurotrophic factor on mouse axotomized retinal ganglion cells and phagocytic microglia. Invest Ophthalmol Vis Sci 2013;54:974–985. !


13

42. Salinas-Navarro M, Alarcon-Martinez L, ValienteSoriano FJ, Jimenez-Lopez M, Mayor-Torroglosa S, Aviles-Trigueros M, et al. Ocular hypertension impairs optic nerve axonal transport leading to progressive retinal ganglion cell degeneration. Exp Eye Res 2010;90:168–183. 43. Salinas-Navarro M, Jimenez-Lopez M, Valiente-Soriano FJ, Alarcon-Martinez L, Aviles-Trigueros M, Mayor S, et al. Retinal ganglion cell population in adult albino and pigmented mice: a computerized analysis of the entire population and its spatial distribution. Vision Res 2009;49: 637–647. 44. Salinas-Navarro M, Mayor-Torroglosa S, Jimenez-Lopez M, Aviles-Trigueros M, Holmes TM, Lund RD, et al. A computerized analysis of the entire retinal ganglion cell population and its spatial distribution in adult rats. Vision Res 2009;49:115–126. 45. Buyens T, Gaublomme D, Van Hove I, De Groef L, Moons L. Quantitative assessment of neurite outgrowth in mouse retinal explants. Axon growth and regeneration: methods and protocols. New-York: Murray AJ; 2014. 46. Wong AA, Brown RE. A neurobehavioral analysis of the prevention of visual impairment in the DBA/2J mouse model of glaucoma. Invest Ophthalmol Vis Sci 2012;53: 5956–5966. 47. Van Brussel L, Gerits A, Arckens L. Evidence for crossmodal plasticity in adult mouse visual cortex following monocular enucleation. Cereb Cortex 2011;21:2133–2146. 48. Nys J, Aerts J, Ytebrouck E, Vreysen S, Laeremans A, Arckens L. The cross-modal aspect of mouse visual cortex plasticity induced by monocular enucleation is age dependent. J Comp Neurol 2014;522:950–970. 49. Woolley DG, Laeremans A, Gantois I, Mantini D, Vermaercke B, Op de Beeck HP, et al. Homologous involvement of striatum and prefrontal cortex in rodent and human water maze learning. Proc Natl Acad Sci USA 2013;110:3131–3136. 50. Arckens L, Zhang F, Vanduffel W, Mailleux P, Vanderhaeghen JJ, Orban GA, et al. Localization of the two protein kinase C beta-mRNA subtypes in cat visual system. J Chem Neuroanat 1995;8:117–124. 51. Cnops L, Hu TT, Vanden Broeck J, Burnat K, Van Den Bergh G, Arckens L. Age- and experience-dependent expression of dynamin I and synaptotagmin I in cat visual system. J Comp Neurol 2007;504:254–264. 52. Van Brussel L, Gerits A, Arckens L. Identification and localization of functional subdivisions in the visual cortex of the adult mouse. J Comp Neurol 2009;514:107–116. 53. Jakobs TC, Libby RT, Ben Y, John SW, Masland RH. Retinal ganglion cell degeneration is topological but not cell type specific in DBA/2J mice. J Cell Biol 2005;171:313–325. 54. Aerts J, Nys J, Moons L, Hu TT, Arckens L. Altered neuronal architecture and plasticity in the visual cortex of adult MMP-3-deficient mice. Brain Struct Funct 2014;25:25. 55. Birdal T. Smoothing 2D contours using local regression lines. MATLAB Central File Exchange; 2011. 56. Paulussen M, Jacobs S, Van der Gucht E, Hof PR, Arckens L. Cytoarchitecture of the mouse neocortex revealed by the low-molecular-weight neurofilament protein subunit. Brain Struct Funct 2011;216:183–199. 57. Vidal-Sanz M, Salinas-Navarro M, Nadal-Nicolas FM, Alarcon-Martinez L, Valiente-Soriano FJ, de Imperial JM, et al. Understanding glaucomatous damage: anatomical and functional data from ocular hypertensive rodent retinas. Prog Retin Eye Res 2012;31:1–27. 58. Huberman AD, Wei W, Elstrott J, Stafford BK, Feller MB, Barres BA. Genetic identification of an On-Off directionselective retinal ganglion cell subtype reveals a layerspecific subcortical map of posterior motion. Neuron 2009; 62:327–334.


14 E. Dekeyster et al. 59. Hofbauer A, Drager UC. Depth segregation of retinal ganglion cells projecting to mouse superior colliculus. J Comp Neurol 1985;234:465–474. 60. Chader GJ. Advances in glaucoma treatment and management: neurotrophic agents. Invest Ophthalmol Vis Sci 2012; 53:2501–2505. 61. Tezel G. Immune regulation toward immunomodulation for neuroprotection in glaucoma. Curr Opin Pharmacol 2013;13:23–31. 62. Plas DT, Lopez JE, Crair MC. Pretarget sorting of retinocollicular axons in the mouse. J Comp Neurol 2005; 491:305–319. 63. You Y, Gupta VK, Graham SL, Klistorner A. Anterograde degeneration along the visual pathway after optic nerve injury. PLoS One 2012;7:e52061. 64. Williams AL, Lackey J, Wizov SS, Chia TM, Gatla S, Moster ML, et al. Evidence for widespread structural brain changes in glaucoma: a preliminary voxel-based MRI study. Invest Ophthalmol Vis Sci 2013;54:5880–5887. 65. Lei Y, Garrahan N, Hermann B, Fautsch MP, Johnson DH, Hernandez MR, et al. Topography of neuron loss in the retinal ganglion cell layer in human glaucoma. The Br J Ophthalmol 2009;93:1676–1679. 66. Fu CT, Sretavan D. Laser-induced ocular hypertension in albino CD-1 mice. Invest Ophthalmol Vis Sci 2010;51: 980–990. 67. Drager UC, Hubel DH. Topography of visual and somatosensory projections to mouse superior colliculus. J Neurophysiol 1976;39:91–101. 68. Mrsic-Flogel TD, Hofer SB, Creutzfeldt C, Cloez-Tayarani I, Changeux JP, Bonhoeffer T, et al. Altered map of visual space in the superior colliculus of mice lacking early retinal waves. J Neurosci 2005;25:6921–6928. 69. Lamirel C, Milea D, Cochereau I, Duong MH, Lorenceau J. Impaired saccadic eye movement in primary open-angle glaucoma. J Glaucoma 2014;23:23–32. 70. Kanjee R YY, Steinbach MJ, Gonza´lez EG, Gupta N. Delayed saccadic eye movements in glaucoma. Eye Brain 2012;4:63–68. 71. Smith ND, Glen FC, Crabb DP. Eye movements during visual search in patients with glaucoma. BMC Ophthalmol 2012;12:45. 72. Vokoun CR, Huang X, Jackson MB, Basso MA. Response normalization in the superficial layers of the superior colliculus as a possible mechanism for saccadic averaging. J Neurosci 2014;34:7976–7987. 73. Fujiyama F, Hioki H, Tomioka R, Taki K, Tamamaki N, Nomura S, et al. Changes of immunocytochemical localization of vesicular glutamate transporters in the rat visual system after the retinofugal denervation. J Comp Neurol 2003;465:234–249. 74. de Lima S, Koriyama Y, Kurimoto T, Oliveira JT, Yin Y, Li Y, et al. Full-length axon regeneration in the adult mouse optic nerve and partial recovery of simple visual behaviors. Proc Natl Acad Sci USA 2012;109:9149–9154. 75. Crish SD, Sappington RM, Inman DM, Horner PJ, Calkins DJ. Distal axonopathy with structural persistence in glaucomatous neurodegeneration. Proc Natl Acad Sci USA 2010;107:5196–5201. 76. Drager UC. Receptive fields of single cells and topography in mouse visual cortex. J Comp Neurol 1975;160:269–290. 77. Wagor E, Mangini NJ, Pearlman AL. Retinotopic organization of striate and extrastriate visual cortex in the mouse. J Comp Neurol 1980;193:187–202. 78. Wang Q, Burkhalter A. Area map of mouse visual cortex. J Comp Neurol 2007;502:339–357. 79. Schuett S, Bonhoeffer T, Hubener M. Mapping retinotopic structure in mouse visual cortex with optical imaging. J Neurosci 2002;22:6549–6559.

80. Keck T, Mrsic-Flogel TD, Vaz Afonso M, Eysel UT, Bonhoeffer T, Hubener M. Massive restructuring of neuronal circuits during functional reorganization of adult visual cortex. Nat Neurosci 2008;11:1162–1167. 81. Harauzov A, Spolidoro M, DiCristo G, De Pasquale R, Cancedda L, Pizzorusso T, et al. Reducing intracortical inhibition in the adult visual cortex promotes ocular dominance plasticity. J Neurosci 2010;30:361–371. 82. Tropea D, Caleo M, Maffei L. Synergistic effects of brain-derived neurotrophic factor and chondroitinase ABC on retinal fiber sprouting after denervation of the superior colliculus in adult rats. J Neurosci 2003;23: 7034–7044. 83. Bastos EF, Marcelino JL, Amaral AR, Serfaty CA. Fluoxetine-induced plasticity in the rodent visual system. Brain Res 1999;824:28–35. 84. Rhoades RW. Effects of neonatal enucleation on the functional organization of the superior colliculus in the golden hamster. J Physiol 1980;301:383–399. 85. Lund RD, Lund JS. Reorganization of the retinotectal pathway in rats after neonatal retinal lesions. Exp Neurol 1973;40:377–390. 86. Colonnese MT, Constantine-Paton M. Chronic NMDA receptor blockade from birth increases the sprouting capacity of ipsilateral retinocollicular axons without disrupting their early segregation. J Neurosci 2001;21: 1557–1568. 87. Serfaty CA, Campello-Costa P, Linden R. Rapid and longterm plasticity in the neonatal and adult retinotectal pathways following a retinal lesion. Brain Res Bull 2005; 66:128–134. 88. Houser CR, Lee M, Vaughn JE. Immunocytochemical localization of glutamic acid decarboxylase in normal and deafferented superior colliculus: evidence for reorganization of gamma-aminobutyric acid synapses. J Neurosci 1983;3:2030–2042. 89. Garcia del Cano G, Gerrikagoitia I, Martinez-Millan L. Plastic reaction of the rat visual corticocollicular connection after contralateral retinal deafferentiation at the neonatal or adult stage: axonal growth versus reactive synaptogenesis. J Comp Neurol 2002;446:166–178. 90. Thurlow GA, Cooper RM. Increased dependence of superior colliculus metabolic activity on visual cortex after eye enucleation. Exp Neurol 1985;90:594–600. 91. King WM, Sarup V, Sauve Y, Moreland CM, Carpenter DO, Sharma SC. Expansion of visual receptive fields in experimental glaucoma. Vis Neurosci 2006;23:137–142. 92. Ahmed FA, Chaudhary P, Sharma SC. Effects of increased intraocular pressure on rat retinal ganglion cells. Int J Dev Neurosci 2001;19:209–218. 93. Georgiou AL, Guo L, Cordeiro MF, Salt TE. Changes in the modulation of retinocollicular transmission through group III mGluRs long after an increase in intraocular pressure in a rat model of glaucoma. Vis Neurosci 2012;29:237–246. 94. Carrasco MM, Pallas SL. Early visual experience prevents but cannot reverse deprivation-induced loss of refinement in adult superior colliculus. Vis Neurosci 2006;23:845–852. 95. Turner JP, Sauve Y, Varela-Rodriguez C, Lund RD, Salt TE. Recruitment of local excitatory circuits in the superior colliculus following deafferentation and the regeneration of retinocollicular inputs. Eur J Neurosci 2005;22: 1643–1654. 96. Ito Y, Nakamura S, Tanaka H, Shimazawa M, Araie M, Hara H. Memantine protects against secondary neuronal degeneration in lateral geniculate nucleus and superior colliculus after retinal damage in mice. CNS Neurosci Ther 2008;14:192–202. Current Eye Research



97. Zhang S, Wang H, Lu Q, Qing G, Wang N, Wang Y, et al. Detection of early neuron degeneration and accompanying glial responses in the visual pathway in a rat model of acute intraocular hypertension. Brain Res 2009;1303: 131–143. 98. Shimazawa M, Ito Y, Inokuchi Y, Yamanaka H, Nakanishi T, Hayashi T, et al. An alteration in the lateral geniculate nucleus of experimental glaucoma monkeys: in vivo positron emission tomography imaging of glial activation. PLoS One 2012;7:e30526.

!


15

99. Drager UC, Olsen JF. Origins of crossed and uncrossed retinal projections in pigmented and albino mice. J Comp Neurol 1980;191:383–412. 100. Ito Y, Shimazawa M, Inokuchi Y, Fukumitsu H, Furukawa S, Araie M, et al. Degenerative alterations in the visual pathway after NMDA-induced retinal damage in mice. Brain Res 2008;1212:89–101. 101. Liu Y, McDowell CM, Zhang Z, Tebow HE, Wordinger RJ, Clark AF. Monitoring retinal morphologic and functional changes in mice following optic nerve crush. Invest Ophthalmol Vis Sci 2014;55:3766–3774.

Oculomotor Remapping of Visual Information to Foveal Retinotopic Cortex.

Pattern visual evoked potential in ocular hypertension.

Effects of ocular hypertension in the visual system of pigmented mice.

Neural associations of the early retinotopic cortex with the lateral occipital complex during visual perception.

Altered neuronal architecture and plasticity in the visual cortex of adult MMP-3-deficient mice.

GAP-43 in adult visual cortex.

The Roles of Non-retinotopic Motions in Visual Search.

A Small Motor Cortex Lesion Abolished Ocular Dominance Plasticity in the Adult Mouse Primary Visual Cortex and Impaired Experience-Dependent Visual Improvements.

Lithium reduces ocular dominance plasticity in kitten visual cortex.

Correspondences between retinotopic areas and myelin maps in human visual cortex.

Cannabinoid neuromodulation in the adult early visual cortex.

Lynx1 Limits Dendritic Spine Turnover in the Adult Visual Cortex.

Cortico-cortical interactions influence binocularity of the primary visual cortex of adult mice.

Thalamic afferents to the visual cortex in congenitally anophthalmic mice.

Ocular dominance in layer IV of the cat's visual cortex and the effects of monocular deprivation.

Receptive field dynamics in adult primary visual cortex.

Stimulus dependence of ocular dominance of complex cells in area 17 of the feline visual cortex.

Gremlin Induces Ocular Hypertension in Mice Through Smad3-Dependent Signaling.

A lymphatic defect causes ocular hypertension and glaucoma in mice.

Physical Exercise Preserves Adult Visual Plasticity in Mice and Restores it after a Stroke in the Somatosensory Cortex.

Long-Term Protection of Retinal Ganglion Cells and Visual Function by Brain-Derived Neurotrophic Factor in Mice With Ocular Hypertension.

Mechanisms in ocular hypertension.

Blue versus white stimuli in ocular hypertension with the Friedmann Mark 1 Visual Field Analyser.

Retinotopic organization of extrastriate cortex in the owl monkey--dorsal and lateral areas.