Journal of Virological Methods 207 (2014) 1–5
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
One-step reverse transcription-loop-mediated isothermal amplification assay for sensitive and rapid detection of porcine kobuvirus Xinqiong Li a , Yuanchen Zhou a , Hongwei Ji a , Zhiwen Xu a,b , Ling Zhu a,b,∗ a b
Animal Biotechnology Center, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China Key Laboratory of Animal Disease and Human Health, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China
a b s t r a c t Article history: Received 19 February 2014 Received in revised form 9 June 2014 Accepted 17 June 2014 Available online 24 June 2014 Keywords: Porcine kobuvirus Reverse transcription loop-mediated isothermal amplification (RT-LAMP) Detection
Porcine kobuvirus (PKoV) is associated with swine gastroenteritis, but its pathogenesis is uncertain. In this study, a rapid one-step reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method for the detection of PKoV is developed. A set of four primers specific to six regions within the PKoV 3D gene was designed for the RT-LAMP assay using total RNA extracted from PKoV-infected tissues. The reaction temperature and time for this assay were optimized. Compared with reverse-transcription PCR, RT-LAMP was able to detect PKoV at a 100-fold lower dilution. No cross-reaction was observed with other similar viruses, indicating that the assay is highly specific for PKoV. To investigate the prevalence of PKoV in symptomatic pigs in Sichuan province, the newly developed method was used to detect PKoV in a panel of clinical specimens, yielding a positive rate of 86.7% (144/166) in piglets. The results showed that the RT-LAMP assay is highly feasible in clinical settings. The data confirm that the RT-LAMP assay is rapid, simple and cost-effective and is particularly suitable for simple diagnosis of PKoV both in the field and in the laboratory. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Porcine kobuvirus (PKoV) is assigned as new species Aichivirus C of the genus Kobuvirus in the family Picornaviridae, which is made up of small, non-enveloped viruses with single-stranded, positivesense genomic RNA (Reuter et al., 2011). It was first isolated in stool specimens from clinically healthy domestic pigs in Hungary (Reuter et al., 2008). The PKoV (S-1-HUN) genome is 8210 nucleotides in length and encodes three structural proteins, seven non-structural proteins and a leader (L) protein. The 3D gene region not only encodes a viral RNA-dependent RNA polymerase, but also represents a conserved region among kobuviruses (Reuter et al., 2011). PKoV has been detected in both healthy and diarrheic pigs (Verma et al., 2013). The viruses can persist for a long time in the host, further increasing the probability of recombination (Reuter et al., 2008). Statistical analysis of the porcine kobuvirus positive rate between diarrheic and healthy pigs by Park and his team revealed
∗ Corresponding author at: Animal Biotechnology Center, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China. Tel.: +86 139 8160 4765. E-mail addresses: [email protected] (X. Li), [email protected] (Y. Zhou), [email protected] (H. Ji), [email protected] (Z. Xu), [email protected] (L. Zhu). http://dx.doi.org/10.1016/j.jviromet.2014.06.012 0166-0934/© 2014 Elsevier B.V. All rights reserved.
that PKoV infection is significantly correlated with diarrhea (Park et al., 2010). Because diarrhea in pigs can result in huge economic losses, it is important to establish a method for the detection of PKoV. Although a reverse transcription-polymerase chain reaction (RT-PCR) assay used for the detection of PKoV has been developed (Reuter et al., 2009), it requires skilled technicians and specialized instrumentation and is not suitable for the detection of PKoV in the field. Therefore, a simpler, more rapid, and more sensitive diagnostic assay is needed. Loop-mediated isothermal amplification (LAMP) is an alternate amplification method that was developed by Notomi et al. (2000) (Blomström et al., 2008). The technique uses four primers that recognize six regions of the target DNA, including two inner primers (FIP and BIP) and two outer primers (F3 and B3). LAMP yields a high amount of DNA that can be visualized without the need for agarose gel electrophoresis, either directly by naked eyes upon the addition of an intercalating dye or through photometry to monitor the turbidity of the solution, which increases because of the production of the byproduct magnesium pyrophosphate during amplification (Notomi et al., 2000). The LAMP technology has also been applied successfully to the detection of other viruses (Chen et al., 2010; Li et al., 2013a; Yamazaki et al., 2013). However, use of RT-LAMP to detect PKoV has not yet been reported.
2
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
In this study, a one-step RT-LAMP assay was developed using primers directed against highly conserved regions that can specifically detect PKoV. With this RT-LAMP assay, an inexperienced person can quickly detect PKoV in the field, enabling epidemiological investigations that will provide valuable information to help understand the prevalence of PKoV in Sichuan province and the relationship between PKoV and diarrhea. 2. Material and methods
2.5. RT-PCR The PCR was carried out in a 25 L volume containing 12.5 L of 10× PCR Mix (TaKaRa, Dalian, PR China), 1 L each of forward and reverse primers, 5 L of cDNA and 4.5 L double-distilled H2 O. The reaction program was: 94 ◦ C for 5 min; 35 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension cycle at 72 ◦ C for 10 min. The products were analyzed by agarose gel electrophoresis (2% agarose, Tris–acetate–EDTA (TAE) buffer), and stained with ethidium bromide.
2.1. Viruses PKoV was obtained from the intestines of piglets with diarrhea. These samples were collected from several different farms in Sichuan province. Transmissible gastroenteritis virus (SC-T strain), porcine epidemic diarrhea virus (SC-P strain), porcine rotavirus (SC-R strain), Aichi virus (SC-U strain) and bovine kobuvirus (SC-Y strain), all known to be related to PKoV or to cause similar clinical signs, were provided by Animal Biotechnology Center. 2.2. Design of the RT-LAMP and RT-PCR primers Using the nucleic acid sequences of PKoV published on GenBank (accession number: NC 011829), the sequence encoding the 3D protein was chosen as the target sequence for RT-LAMP and RT-PCR. Four primers specific for 3D gene were designed with the Primer Explorer V4 software using default settings (http://primerexplorer.jp/elamp4.0.0/index.html). Primers for the RT-PCR amplification of the 3D gene were designed with Primer Premier 5 software. All primer sequences used in this study are shown in Table 1. 2.3. RNA extraction Intestinal mucosa (positive controls) known to be infected with PKoV were ground up under liquid nitrogen, then mixed with intestinal contents (positive controls), and the mixture was diluted in twice the volume (wt/vol) of phosphate-buffered saline (PBS, pH 7.4). These samples were clarified by low-speed centrifugation at 3000 × g for 10 min. The supernatants were subsequently collected and subjected to RNA extraction. Genomic viral RNA was extracted from 200 L of the original intestinal homogenate on an automated robotic platform using TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The resulting pellet of RNA was dissolved in 20 L diethylpyrocarbonate (DEPC)-treated water. Single stranded cDNA was synthesized by reverse transcriptase (RT) using the TaKaRa Reverse Transcription System. Both the RNA and cDNA were stored at −70 ◦ C before use. 2.4. Optimization of RT-LAMP conditions The initial amplification reaction was performed in a PCR reaction tube using a heating block set at 60–65 ◦ C for 1 h, followed by 10 min at 80 ◦ C to terminate the reaction. To determine the optimum reaction time, the LAMP reaction was carried out at 65 ◦ C for 30, 45 or 60 min. The concentrations of each component in the reaction mixture were as follow: 2 L of RNA, 0.2 M each of F3 and B3, 1.6 M each of FIP and BIP, 8 mM MgSO4 , 1 M of betaine (Sigma–Aldrich, St. Louis, MO, USA), 1.4 mM of dNTPs, 1 L of Bst DNA polymerase (8 U/L, New England Biolabs, MA, USA), 0.75 L of M-MuLV reverse transcriptase (200 U/L, Promega, USA), 0.5 L of RNasin (40 U/L, Promega, USA), 20 mM of Tris–HCl (pH 8.8), 10 mM of KCl, 10 mM of (NH4 )2 SO4 , 0.1% Triton X-100, and DEPCtreated water, in a final volume of 25 L. The amplified products (10 L) were then examined under UV irradiation following the addition of ethidium bromide.
2.6. Specificity and sensitivity of RT-LAMP assay The RT-PCR products were recovered, purified and cloned into E. coli DH5␣ using pGEM-T Easy Vector (Promega). The plasmids linearized with NdeI served as template for synthesizing cRNA by in vitro transcription with T7 RNA polymerase (TaKaRa, Dalian, PR China) according to the manufacturer’s instructions. Its concentration was determined by micro-spectrophotometer analysis and stored at −70 ◦ C. To evaluate the sensitivity of the RT-LAMP assay, 10-fold serial dilutions of RNA template (1 × 100 copies–1 × 108 copies) were used in RT-PCR and RT-LAMP. The amplification products were detected by 2% agarose gel electrophoresis and visualized under UV light or visually inspected by adding SYBR Green I (Invitrogen, Madison, USA). To evaluate the specificity of the RT-LAMP assay, viruses related to PKoV or known to cause similar clinical signs, including TGEV, PEDV, RV, Aichi virus and bovine kobuvirus, were tested together with PKoV. DEPC-treated water served as negative control under the same conditions. The products were detected via electrophoresis on 2% agarose gel or were observed with naked eyes by adding SYBR Green I (Invitrogen, Madison, USA). 2.7. Preliminary testing of clinical samples Samples from piglets (less than 6-weeks-old) were collected from different farms in Sichuan province, including Chengdu, Yaan, Meishan, Suining, Mianyang and Deyang. A number of samples were collected from piglets with diarrhea (120 out of 166), while the rest of the samples came from apparently healthy piglets. The RT-LAMP method and conventional RT-PCR assays were used for testing. Of note, all sampling procedures were reviewed and approved by the Institute of Animal Health Animal Care and Use Committee at Sichuan Agricultural University (approval number SYXK2014-187). 3. Results 3.1. The optimal temperature and time for PKoV RT-LAMP assay To find the optimal reaction conditions for a one-step RT-LAMP assay for PKoV detection, the reaction temperature was set at 60, 61, 62, 63, 64, or 65 ◦ C, based on the primers’ reference temperatures. A reaction temperature of 65 ◦ C yielded amplification products that exhibited the clearest ladder-like pattern upon agarose gel analysis (data not shown). After determining the optimal temperature, the RT-LAMP reaction was carried out at 65 ◦ C for 30, 45 or 60 min. The best results were achieved with a 45 min reaction (data not shown). 3.2. RT-PCR RT-PCR was performed on PKoV and the products were analyzed by agarose gel electrophoresis (2% agarose, Tris–acetate–EDTA (TAE) buffer), and stained with ethidium bromide (Fig. 1).
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
3
Table 1 Primer sets for RT-LAMP and RT-PCR of PKoV. Method
Primer
Sequence (5 –3 )
Length
Genome positiona
RT-LAMP
F3 B3 FIP BIP
GCCTTCCGCATTGTTGAGAA AGGATTCGGGAGAGAAGTCA AAGACATGGCGCGAGTGTCG-TCATTGGAGACGAACGGGTA CGTCTGGATGCGTTGGCACT-GGGTGTTGAATGAGAGCAGA
20 20 40 40
7372–7391 7581–7600 7447–7466 7502–7521
RT-PCR
Forward Reverse
TGGATTACAAGTGTTTTGATGC TGTCGTAGAACTCCTTGATGAA
22 22
7334–7355 7663–7684
a
Genome position refers to Porcine kobuvirus: GenBank NC 011829.
products were analyzed by agarose gel electrophoresis (2% agarose, TAE), and stained with ethidium bromide (Fig. 3B and C). The products were also observed by the naked eyes by adding SYBR Green I to the reaction mixture (Fig. 3A). The results demonstrated that RTLAMP could detect RNA at a dilution of 1 × 101 copies, while RT-PCR could only detect PKoV down to a dilution of 1 × 103 copies. 3.5. Clinical samples To evaluate the feasibility of RT-LAMP for detecting PKoV in clinical specimens, 166 samples from piglets were collected (120 samples from piglets with diarrhea and 46 samples from healthy piglets). The positive rate for the entire sample set was 86.7% (144/166) as measured by RT-LAMP, with 109 out of 120 diarrhea samples and 35 out of 46 healthy samples testing positive for PKoV (Table 2). However, the percentage of total positive samples was only 74.7% (124/166) as measured by RT-PCR. 94 out of 120 diarrhea samples and 30 out of 46 healthy samples tested positive for PKoV (Table 2). The data suggest that the new PKoV-RT-LAMP assay detects PKoV higher than the conventional PKoV-RT-PCR assay. Fig. 1. PKoV detection by RT-PCR with agarose gel electrophoresis. Lane M: DNA marker DL2000, lane 1: negative control, lane 2: PKoV.
3.3. Specificity of the PKoV-RT-LAMP RT-LAMP with PKoV-specific primers was performed on PKoV, TGEV, PEDV, RV, Aichi virus and bovine kobuvirus and the resulting products were visualized on an agarose gel following electrophoresis. Only RT-LAMP of PKoV resulted in amplification as evidenced by a ladder-like pattern on the gel (Fig. 2B). Furthermore, SYBR Green I was used to help the observation of the results. The color of the RT-LAMP reaction containing PKoV changed from orange to green, there was no color change in the reaction tubes without PKoV (Fig. 2A). 3.4. Sensitivity of the PKoV RT-LAMP In this report, a dilution series of RNA was used to compare the sensitivity of the RT-LAMP assay with RT-PCR. All amplified
4. Discussion PKoV is a novel small RNA virus that has been detected in pigs in recent years. In China, a pig diarrhea epidemic started at the end of 2010 and led to huge economic losses in the pig industry. Researchers speculate that there may be a correlation between the diarrhea epidemic and PKoV (Park et al., 2010). To determine if PKoV is responsible for this epidemic, it is important to set up a sensitive and rapid method to detect PKoV. In this study, a first assay is developed using RT-LAMP to detect PKoV. PKoV is usually detected by conventional RT-PCR performed on total RNA, which requires 1.5–2 h to complete. In this study, the optimal time of PKoV-RT-LAMP to be only 45 min. This indicated that RT-LAMP is considerably more time-efficient. Moreover, unlike RT-PCR, the RT-LAMP assay is carried out in a heat block, and does not need a thermocycler (Curtis et al., 2008). This study also compared the sensitivity of the RT-LAMP assay with RT-PCR for the detection of PKoV. Conventional RT-PCR could
Fig. 2. The specificity of PKoV-RT-LAMP was tested. (A) LAMP products detected by 1000× SYBR Green I. (B) LAMP products detected by agarose gel electrophoresis strained by EB. Lane M: DNA marker DL1000, lane 1: PKoV, lanes 2–6: TGEV, RV, PEDV, Aichi virus, bovine kobuvirus, respectively, lane 7: negative control.
4
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
Fig. 3. Comparing the sensitivity of the PKoV-RT-LAMP and PKoV-RT-PCR assays. (A) PKoV-RT-LAMP products detected by 1000× SYBR Green I. (B) PKoV-RT-LAMP products detected by agarose gel electrophoresis strained by EB. Lane M, DNA marker DL1000. Lanes 1–9: RNA of PKoV with 10-fold dilutions (1 × 108 copies–1 × 100 copies), and lane 10: negative control. (C) PKoV-RT-PCR products detected by agarose gel electrophoresis strained by EB. Lane M, DNA marker DL2000. Lanes 1–9: the RNA of PKoV with 10-fold dilutions (1 × 108 copies–1 × 100 copies), and lane 10: negative control.
detect PKoV at a dilution of 1 × 103 copies; however, the RT-LAMP assay was able to detect PKoV at a dilution of 1 × 101 copies, 100fold lower than RT-PCR. This is similar to the earlier reports on RT-LAMP for the detection of other viruses (Wei et al., 2012; Fukuta et al., 2013; Li et al., 2013b; Zhang et al., 2013). The result indicated that RT-LAMP is more sensitive than RT-PCR. Since PKoV has the 3D gene, while other viruses known to be related to PKoV or to cause similar clinical signs, such as TGEV, PEDV and RV do not, four primers were designed for RT-LAMP to target this gene (Reuter et al., 2011; Gu et al., 2012; Li et al., 2013c; Zhu et al., 2013). The genetic identity of sequences associated with primers between PKoV, Aichi virus and bovine kobuvirus was very low. This leads to the RT-LAMP assay providing highly specific detection of PKoV. Resulting samples run on an agarose gel from these related viruses failed to produce visible bands and there was no color change without PKoV, confirming the specificity of the assay. The high specificity of RT-LAMP is also the result of 4 targeting regions, instead of 2 in RT-PCR. In clinical specimens, the RT-LAMP assay detected PKoV in 144 out of the 166 samples, while RT-PCR only identified 124 PKoV positive samples. One explanation for this is that samples collected from pigs with lower amounts of PKoV may have had too little virus to be
detected by the less sensitive RT-PCR method. Prevalence of PKoV in fecal samples decreases with host age and piglets under the age of 3 weeks are more likely to be infected with PKoV than older pigs (An et al., 2011; Barry et al., 2011; Ribeiro et al., 2013). Perhaps the samples collected from slightly older pigs may have had a lower viral titer. Overall, new RT-LAMP method seems to have several advantages over conventional RT-PCR for the detection of PKoV. A recent report indicated that endemic PKoV infection had no clinical signs, and that domestic pigs had a higher infection rate than wild pigs (Reuter et al., 2010). In different countries, the detection rates of kobuviruses among domestic pigs have been reported as 99%, 84.5%, 53%, 45.4%, and 16.7% in Thailand, Korea, Brazil, Japan and the Netherlands, respectively (Wang et al., 2011). In China, PKoV is widespread, but mainly concentrated in the central and eastern regions. In this report, new method is tested in an epidemiological investigation of PKoV in Sichuan province. The percentage of positive samples collected from piglets with diarrhea in Sichuan was 90.8% (109/120). Mianyang has the highest detection rate of PKoV (96.7%), and Chengdu and Yaan have the lowest detection rate, with only 80% of pigs positive for PKoV. 35 out of 46 samples collected from healthy piglets tested positive for PKoV. These pigs may have recovered from the clinical symptoms of the virus
Table 2 The PKoV detection results in Sichuan province based on PKoV-RT-LAMP and PKoV-RT-PCR. Origin of samples
Chengdu Yaan Meishan Suining Mianyang Deyang
Samples
Number of samples
Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea
5 10 5 10 8 20 10 30 10 30 8 20
Detection results RT-PCR (positive/total sample)
RT-LAMP (positive/total sample)
2/5 (40%) 6/10 (60%) 3/5 (60%) 5/10 (50%) 6/8 (75%) 16/20 (80%) 6/10 (60%) 26/30 (86.6%) 7/10 (70%) 25/30 (83.3%) 6/8 (75%) 16/20 (80%)
3/5 (60%) 8/10 (80%) 3/5 (60%) 8/10 (80%) 6/8 (75%) 17/20 (85%) 8/10 (80%) 28/30 (93.3%) 8/10 (80%) 29/30 (96.7%) 7/8 (87.5%) 19/20 (95%)
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
while still having detectable amounts remaining in their systems. Deyang has the highest rate (87.5%) of PKoV reported in apparently healthy pigs. The frequency of PKoV in pigs with diarrhea is higher than that in apparently healthy pigs, which is consistent with previous reports, indicating that PKoV may play a role in pig diarrhea (Khamrin et al., 2009; Park et al., 2010; Okitsu et al., 2012). PKoV has been detected in not only in fecal samples, but also in serum samples, indicating viremia (Barry et al., 2011; Ribeiro et al., 2013). This study did not collect serum samples, so it is unable to compare blood levels of PKoV with levels detected in the intestines. This study also did not test for the presence of other diarrheal pathogens (PEDV, TGEV and RV), so it is unable to exclude co-infection. Although small sample size may appear to be a limitation, the samples were collected from many different farms and can still give important insight into the prevalence of PKoV infection in Sichuan Province. 5. Conclusions In summary, RT-LAMP is suited for sensitive and rapid detection of PKoV. Because of its simplicity and efficiency, this method is likely to be used to detect PKoV in samples collected in the field. This will enable researchers to conduct epidemiological investigations that could provide the basis for prevention of PKoV. Acknowledgements This study was supported by Sichuan Province Science and Technology Support Project (2012NZ0001), Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT IRT13083) and Program for New Century Excellent Talents of Ministry of Education of China (NCET 11-1059). References An, D.-J., Jeoung, H.-Y., Jeong, W., Lee, H.S., Park, J.-Y., Kim, B., 2011. Porcine kobuvirus from pig stool in Korea. Virus Genes 42, 208–211. Barry, A.F., Ribeiro, J., Alfieri, A.F., van der Poel, W.H., Alfieri, A.A., 2011. First detection of kobuvirus in farm animals in Brazil and the Netherlands. Infect. Genet. Evol. 11, 1811–1814. Blomström, A.-L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147, 188–193. Chen, C., Cui, S., Zhang, C., Li, J., Wang, J., 2010. Development and validation of reverse transcription loop-mediated isothermal amplification for detection of PRRSV. Virus Genes 40, 76–83. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270.
5
Fukuta, S., Tamura, M., Maejima, H., Takahashi, R., Kuwayama, S., Tsuji, T., Yoshida, T., Itoh, K., Hashizume, H., Nakajima, Y., 2013. Differential detection of Wheat yellow mosaic virus, Japanese soil-borne wheat mosaic virus and Chinese wheat mosaic virus by reverse transcription loop-mediated isothermal amplification reaction. J. Virol. Methods 189, 348. Gu, J., Yue, X., Xing, R., Li, C., Yang, Z., 2012. Progress in genetically engineered vaccines for porcine transmissible gastroenteritis virus. Rev. Med. Vet. (Toulouse) 163, 107–111. Khamrin, P., Maneekarn, N., Kongkaew, A., Kongkaew, S., Okitsu, S., Ushijima, H., 2009. Porcine kobuvirus in piglets, Thailand. Emerg. Infect. Dis. 15, 2075–2076. Li, B., Sun, B., Du, L.-P., Mao, A.-H., Wen, L.-B., Ni, Y.-X., Zhang, X.-H., He, K.-W., 2013a. Development of a loop-mediated isothermal amplification assay for the detection of porcine hokovirus. J. Virol. Methods 193, 415–418. Li, J.-Y., Wei, Q.-W., Liu, Y., Tan, X.-Q., Zhang, W.-N., Wu, J.-Y., Charimbu, M.K., Hu, B.-S., Cheng, Z.-B., Yu, C., 2013b. One-step reverse transcription loop-mediated isothermal amplification for the rapid detection of cucumber green mottle mosaic virus. J. Virol. Methods 193, 583–588. Li, Z., Chen, F., Yuan, Y., Zeng, X., Wei, Z., Zhu, L., Sun, B., Xie, Q., Cao, Y., Xue, C., 2013c. Sequence and phylogenetic analysis of nucleocapsid genes of porcine epidemic diarrhea virus (PEDV) strains in China. Arch. Virol. 158, 1267–1273. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Okitsu, S., Khamrin, P., Thongprachum, A., Hidaka, S., Kongkaew, S., Kongkaew, A., Maneekarn, N., Mizuguchi, M., Hayakawa, S., Ushijima, H., 2012. Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand. Virus Genes 44, 253–257. Park, S.-J., Kim, H.-K., Moon, H.-J., Song, D.-S., Rho, S.-M., Han, J.-Y., Nguyen, V.-G., Park, B.-K., 2010. Molecular detection of porcine kobuviruses in pigs in Korea and their association with diarrhea. Arch. Virol. 155, 1803–1811. Reuter, G., Boldizsár, Á., Kiss, I., Pankovics, P., 2008. Candidate new species of Kobuvirus in porcine hosts. Emerg. Infect. Dis. 14, 1968. Reuter, G., Boldizsár, Á., Pankovics, P., 2009. Complete nucleotide and amino acid sequences and genetic organization of porcine kobuvirus, a member of a new species in the genus Kobuvirus, family Picornaviridae. Arch. Virol. 154, 101–108. Reuter, G., Boros, Á., Pankovics, P., 2011. Kobuviruses – a comprehensive review. Rev. Med. Virol. 21, 32–41. Reuter, G., Kecskeméti, S., Pankovics, P., 2010. Evolution of porcine kobuvirus infection, Hungary. Emerg. Infect. Dis. 16, 696. Ribeiro, J., de Arruda Leme, R., Alfieri, A.F., Alfieri, A.A., 2013. High frequency of Aichivirus C (porcine kobuvirus) infection in piglets from different geographic regions of Brazil. Trop. Anim. Health Prod. 45, 1757–1762. Verma, H., Mor, S.K., Abdel-Glil, M.Y., Goyal, S.M., 2013. Identification and molecular characterization of porcine kobuvirus in US swine. Virus Genes 46, 551–553. Wang, C., Lan, D., Hua, X., 2011. Porcine kobuvirus from pig stool specimens in Shanghai, China. Virus Genes 43, 350–352. Wei, Q.-W., Yu, C., Zhang, S.-Y., Yang, C.-Y., Miriam, K., Zhang, W.-N., Dou, D.-L., Tao, X.-R., 2012. One-step detection of Bean pod mottle virus in soybean seeds by the reverse-transcription loop-mediated isothermal amplification. Virol. J. 9, 187. Yamazaki, W., Mioulet, V., Murray, L., Madi, M., Haga, T., Misawa, N., Horii, Y., King, D.P., 2013. Development and evaluation of multiplex RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J. Virol. Methods 192, 18–24. Zhang, Q.-L., Yan, Y., Shen, J.-Y., Hao, G.-J., Shi, C.-Y., Wang, Q.-T., Liu, H., Huang, J., 2013. Development of a reverse transcription loop-mediated isothermal amplification assay for rapid detection of grass carp reovirus. J. Virol. Methods 187, 384–389. Zhu, J., Yang, Q., Cao, L., Dou, X., Zhao, J., Zhu, W., Ding, F., Bu, R.-E., Suo, S., Ren, Y., 2013. Development of porcine rotavirus vp6 protein based ELISA for differentiation of this virus and other viruses. Virol. J. 10, 91.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
One-step reverse transcription-loop-mediated isothermal amplification assay for sensitive and rapid detection of porcine kobuvirus Xinqiong Li a , Yuanchen Zhou a , Hongwei Ji a , Zhiwen Xu a,b , Ling Zhu a,b,∗ a b
Animal Biotechnology Center, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China Key Laboratory of Animal Disease and Human Health, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China
a b s t r a c t Article history: Received 19 February 2014 Received in revised form 9 June 2014 Accepted 17 June 2014 Available online 24 June 2014 Keywords: Porcine kobuvirus Reverse transcription loop-mediated isothermal amplification (RT-LAMP) Detection
Porcine kobuvirus (PKoV) is associated with swine gastroenteritis, but its pathogenesis is uncertain. In this study, a rapid one-step reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method for the detection of PKoV is developed. A set of four primers specific to six regions within the PKoV 3D gene was designed for the RT-LAMP assay using total RNA extracted from PKoV-infected tissues. The reaction temperature and time for this assay were optimized. Compared with reverse-transcription PCR, RT-LAMP was able to detect PKoV at a 100-fold lower dilution. No cross-reaction was observed with other similar viruses, indicating that the assay is highly specific for PKoV. To investigate the prevalence of PKoV in symptomatic pigs in Sichuan province, the newly developed method was used to detect PKoV in a panel of clinical specimens, yielding a positive rate of 86.7% (144/166) in piglets. The results showed that the RT-LAMP assay is highly feasible in clinical settings. The data confirm that the RT-LAMP assay is rapid, simple and cost-effective and is particularly suitable for simple diagnosis of PKoV both in the field and in the laboratory. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Porcine kobuvirus (PKoV) is assigned as new species Aichivirus C of the genus Kobuvirus in the family Picornaviridae, which is made up of small, non-enveloped viruses with single-stranded, positivesense genomic RNA (Reuter et al., 2011). It was first isolated in stool specimens from clinically healthy domestic pigs in Hungary (Reuter et al., 2008). The PKoV (S-1-HUN) genome is 8210 nucleotides in length and encodes three structural proteins, seven non-structural proteins and a leader (L) protein. The 3D gene region not only encodes a viral RNA-dependent RNA polymerase, but also represents a conserved region among kobuviruses (Reuter et al., 2011). PKoV has been detected in both healthy and diarrheic pigs (Verma et al., 2013). The viruses can persist for a long time in the host, further increasing the probability of recombination (Reuter et al., 2008). Statistical analysis of the porcine kobuvirus positive rate between diarrheic and healthy pigs by Park and his team revealed
∗ Corresponding author at: Animal Biotechnology Center, College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China. Tel.: +86 139 8160 4765. E-mail addresses: [email protected] (X. Li), [email protected] (Y. Zhou), [email protected] (H. Ji), [email protected] (Z. Xu), [email protected] (L. Zhu). http://dx.doi.org/10.1016/j.jviromet.2014.06.012 0166-0934/© 2014 Elsevier B.V. All rights reserved.
that PKoV infection is significantly correlated with diarrhea (Park et al., 2010). Because diarrhea in pigs can result in huge economic losses, it is important to establish a method for the detection of PKoV. Although a reverse transcription-polymerase chain reaction (RT-PCR) assay used for the detection of PKoV has been developed (Reuter et al., 2009), it requires skilled technicians and specialized instrumentation and is not suitable for the detection of PKoV in the field. Therefore, a simpler, more rapid, and more sensitive diagnostic assay is needed. Loop-mediated isothermal amplification (LAMP) is an alternate amplification method that was developed by Notomi et al. (2000) (Blomström et al., 2008). The technique uses four primers that recognize six regions of the target DNA, including two inner primers (FIP and BIP) and two outer primers (F3 and B3). LAMP yields a high amount of DNA that can be visualized without the need for agarose gel electrophoresis, either directly by naked eyes upon the addition of an intercalating dye or through photometry to monitor the turbidity of the solution, which increases because of the production of the byproduct magnesium pyrophosphate during amplification (Notomi et al., 2000). The LAMP technology has also been applied successfully to the detection of other viruses (Chen et al., 2010; Li et al., 2013a; Yamazaki et al., 2013). However, use of RT-LAMP to detect PKoV has not yet been reported.
2
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
In this study, a one-step RT-LAMP assay was developed using primers directed against highly conserved regions that can specifically detect PKoV. With this RT-LAMP assay, an inexperienced person can quickly detect PKoV in the field, enabling epidemiological investigations that will provide valuable information to help understand the prevalence of PKoV in Sichuan province and the relationship between PKoV and diarrhea. 2. Material and methods
2.5. RT-PCR The PCR was carried out in a 25 L volume containing 12.5 L of 10× PCR Mix (TaKaRa, Dalian, PR China), 1 L each of forward and reverse primers, 5 L of cDNA and 4.5 L double-distilled H2 O. The reaction program was: 94 ◦ C for 5 min; 35 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension cycle at 72 ◦ C for 10 min. The products were analyzed by agarose gel electrophoresis (2% agarose, Tris–acetate–EDTA (TAE) buffer), and stained with ethidium bromide.
2.1. Viruses PKoV was obtained from the intestines of piglets with diarrhea. These samples were collected from several different farms in Sichuan province. Transmissible gastroenteritis virus (SC-T strain), porcine epidemic diarrhea virus (SC-P strain), porcine rotavirus (SC-R strain), Aichi virus (SC-U strain) and bovine kobuvirus (SC-Y strain), all known to be related to PKoV or to cause similar clinical signs, were provided by Animal Biotechnology Center. 2.2. Design of the RT-LAMP and RT-PCR primers Using the nucleic acid sequences of PKoV published on GenBank (accession number: NC 011829), the sequence encoding the 3D protein was chosen as the target sequence for RT-LAMP and RT-PCR. Four primers specific for 3D gene were designed with the Primer Explorer V4 software using default settings (http://primerexplorer.jp/elamp4.0.0/index.html). Primers for the RT-PCR amplification of the 3D gene were designed with Primer Premier 5 software. All primer sequences used in this study are shown in Table 1. 2.3. RNA extraction Intestinal mucosa (positive controls) known to be infected with PKoV were ground up under liquid nitrogen, then mixed with intestinal contents (positive controls), and the mixture was diluted in twice the volume (wt/vol) of phosphate-buffered saline (PBS, pH 7.4). These samples were clarified by low-speed centrifugation at 3000 × g for 10 min. The supernatants were subsequently collected and subjected to RNA extraction. Genomic viral RNA was extracted from 200 L of the original intestinal homogenate on an automated robotic platform using TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The resulting pellet of RNA was dissolved in 20 L diethylpyrocarbonate (DEPC)-treated water. Single stranded cDNA was synthesized by reverse transcriptase (RT) using the TaKaRa Reverse Transcription System. Both the RNA and cDNA were stored at −70 ◦ C before use. 2.4. Optimization of RT-LAMP conditions The initial amplification reaction was performed in a PCR reaction tube using a heating block set at 60–65 ◦ C for 1 h, followed by 10 min at 80 ◦ C to terminate the reaction. To determine the optimum reaction time, the LAMP reaction was carried out at 65 ◦ C for 30, 45 or 60 min. The concentrations of each component in the reaction mixture were as follow: 2 L of RNA, 0.2 M each of F3 and B3, 1.6 M each of FIP and BIP, 8 mM MgSO4 , 1 M of betaine (Sigma–Aldrich, St. Louis, MO, USA), 1.4 mM of dNTPs, 1 L of Bst DNA polymerase (8 U/L, New England Biolabs, MA, USA), 0.75 L of M-MuLV reverse transcriptase (200 U/L, Promega, USA), 0.5 L of RNasin (40 U/L, Promega, USA), 20 mM of Tris–HCl (pH 8.8), 10 mM of KCl, 10 mM of (NH4 )2 SO4 , 0.1% Triton X-100, and DEPCtreated water, in a final volume of 25 L. The amplified products (10 L) were then examined under UV irradiation following the addition of ethidium bromide.
2.6. Specificity and sensitivity of RT-LAMP assay The RT-PCR products were recovered, purified and cloned into E. coli DH5␣ using pGEM-T Easy Vector (Promega). The plasmids linearized with NdeI served as template for synthesizing cRNA by in vitro transcription with T7 RNA polymerase (TaKaRa, Dalian, PR China) according to the manufacturer’s instructions. Its concentration was determined by micro-spectrophotometer analysis and stored at −70 ◦ C. To evaluate the sensitivity of the RT-LAMP assay, 10-fold serial dilutions of RNA template (1 × 100 copies–1 × 108 copies) were used in RT-PCR and RT-LAMP. The amplification products were detected by 2% agarose gel electrophoresis and visualized under UV light or visually inspected by adding SYBR Green I (Invitrogen, Madison, USA). To evaluate the specificity of the RT-LAMP assay, viruses related to PKoV or known to cause similar clinical signs, including TGEV, PEDV, RV, Aichi virus and bovine kobuvirus, were tested together with PKoV. DEPC-treated water served as negative control under the same conditions. The products were detected via electrophoresis on 2% agarose gel or were observed with naked eyes by adding SYBR Green I (Invitrogen, Madison, USA). 2.7. Preliminary testing of clinical samples Samples from piglets (less than 6-weeks-old) were collected from different farms in Sichuan province, including Chengdu, Yaan, Meishan, Suining, Mianyang and Deyang. A number of samples were collected from piglets with diarrhea (120 out of 166), while the rest of the samples came from apparently healthy piglets. The RT-LAMP method and conventional RT-PCR assays were used for testing. Of note, all sampling procedures were reviewed and approved by the Institute of Animal Health Animal Care and Use Committee at Sichuan Agricultural University (approval number SYXK2014-187). 3. Results 3.1. The optimal temperature and time for PKoV RT-LAMP assay To find the optimal reaction conditions for a one-step RT-LAMP assay for PKoV detection, the reaction temperature was set at 60, 61, 62, 63, 64, or 65 ◦ C, based on the primers’ reference temperatures. A reaction temperature of 65 ◦ C yielded amplification products that exhibited the clearest ladder-like pattern upon agarose gel analysis (data not shown). After determining the optimal temperature, the RT-LAMP reaction was carried out at 65 ◦ C for 30, 45 or 60 min. The best results were achieved with a 45 min reaction (data not shown). 3.2. RT-PCR RT-PCR was performed on PKoV and the products were analyzed by agarose gel electrophoresis (2% agarose, Tris–acetate–EDTA (TAE) buffer), and stained with ethidium bromide (Fig. 1).
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
3
Table 1 Primer sets for RT-LAMP and RT-PCR of PKoV. Method
Primer
Sequence (5 –3 )
Length
Genome positiona
RT-LAMP
F3 B3 FIP BIP
GCCTTCCGCATTGTTGAGAA AGGATTCGGGAGAGAAGTCA AAGACATGGCGCGAGTGTCG-TCATTGGAGACGAACGGGTA CGTCTGGATGCGTTGGCACT-GGGTGTTGAATGAGAGCAGA
20 20 40 40
7372–7391 7581–7600 7447–7466 7502–7521
RT-PCR
Forward Reverse
TGGATTACAAGTGTTTTGATGC TGTCGTAGAACTCCTTGATGAA
22 22
7334–7355 7663–7684
a
Genome position refers to Porcine kobuvirus: GenBank NC 011829.
products were analyzed by agarose gel electrophoresis (2% agarose, TAE), and stained with ethidium bromide (Fig. 3B and C). The products were also observed by the naked eyes by adding SYBR Green I to the reaction mixture (Fig. 3A). The results demonstrated that RTLAMP could detect RNA at a dilution of 1 × 101 copies, while RT-PCR could only detect PKoV down to a dilution of 1 × 103 copies. 3.5. Clinical samples To evaluate the feasibility of RT-LAMP for detecting PKoV in clinical specimens, 166 samples from piglets were collected (120 samples from piglets with diarrhea and 46 samples from healthy piglets). The positive rate for the entire sample set was 86.7% (144/166) as measured by RT-LAMP, with 109 out of 120 diarrhea samples and 35 out of 46 healthy samples testing positive for PKoV (Table 2). However, the percentage of total positive samples was only 74.7% (124/166) as measured by RT-PCR. 94 out of 120 diarrhea samples and 30 out of 46 healthy samples tested positive for PKoV (Table 2). The data suggest that the new PKoV-RT-LAMP assay detects PKoV higher than the conventional PKoV-RT-PCR assay. Fig. 1. PKoV detection by RT-PCR with agarose gel electrophoresis. Lane M: DNA marker DL2000, lane 1: negative control, lane 2: PKoV.
3.3. Specificity of the PKoV-RT-LAMP RT-LAMP with PKoV-specific primers was performed on PKoV, TGEV, PEDV, RV, Aichi virus and bovine kobuvirus and the resulting products were visualized on an agarose gel following electrophoresis. Only RT-LAMP of PKoV resulted in amplification as evidenced by a ladder-like pattern on the gel (Fig. 2B). Furthermore, SYBR Green I was used to help the observation of the results. The color of the RT-LAMP reaction containing PKoV changed from orange to green, there was no color change in the reaction tubes without PKoV (Fig. 2A). 3.4. Sensitivity of the PKoV RT-LAMP In this report, a dilution series of RNA was used to compare the sensitivity of the RT-LAMP assay with RT-PCR. All amplified
4. Discussion PKoV is a novel small RNA virus that has been detected in pigs in recent years. In China, a pig diarrhea epidemic started at the end of 2010 and led to huge economic losses in the pig industry. Researchers speculate that there may be a correlation between the diarrhea epidemic and PKoV (Park et al., 2010). To determine if PKoV is responsible for this epidemic, it is important to set up a sensitive and rapid method to detect PKoV. In this study, a first assay is developed using RT-LAMP to detect PKoV. PKoV is usually detected by conventional RT-PCR performed on total RNA, which requires 1.5–2 h to complete. In this study, the optimal time of PKoV-RT-LAMP to be only 45 min. This indicated that RT-LAMP is considerably more time-efficient. Moreover, unlike RT-PCR, the RT-LAMP assay is carried out in a heat block, and does not need a thermocycler (Curtis et al., 2008). This study also compared the sensitivity of the RT-LAMP assay with RT-PCR for the detection of PKoV. Conventional RT-PCR could
Fig. 2. The specificity of PKoV-RT-LAMP was tested. (A) LAMP products detected by 1000× SYBR Green I. (B) LAMP products detected by agarose gel electrophoresis strained by EB. Lane M: DNA marker DL1000, lane 1: PKoV, lanes 2–6: TGEV, RV, PEDV, Aichi virus, bovine kobuvirus, respectively, lane 7: negative control.
4
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
Fig. 3. Comparing the sensitivity of the PKoV-RT-LAMP and PKoV-RT-PCR assays. (A) PKoV-RT-LAMP products detected by 1000× SYBR Green I. (B) PKoV-RT-LAMP products detected by agarose gel electrophoresis strained by EB. Lane M, DNA marker DL1000. Lanes 1–9: RNA of PKoV with 10-fold dilutions (1 × 108 copies–1 × 100 copies), and lane 10: negative control. (C) PKoV-RT-PCR products detected by agarose gel electrophoresis strained by EB. Lane M, DNA marker DL2000. Lanes 1–9: the RNA of PKoV with 10-fold dilutions (1 × 108 copies–1 × 100 copies), and lane 10: negative control.
detect PKoV at a dilution of 1 × 103 copies; however, the RT-LAMP assay was able to detect PKoV at a dilution of 1 × 101 copies, 100fold lower than RT-PCR. This is similar to the earlier reports on RT-LAMP for the detection of other viruses (Wei et al., 2012; Fukuta et al., 2013; Li et al., 2013b; Zhang et al., 2013). The result indicated that RT-LAMP is more sensitive than RT-PCR. Since PKoV has the 3D gene, while other viruses known to be related to PKoV or to cause similar clinical signs, such as TGEV, PEDV and RV do not, four primers were designed for RT-LAMP to target this gene (Reuter et al., 2011; Gu et al., 2012; Li et al., 2013c; Zhu et al., 2013). The genetic identity of sequences associated with primers between PKoV, Aichi virus and bovine kobuvirus was very low. This leads to the RT-LAMP assay providing highly specific detection of PKoV. Resulting samples run on an agarose gel from these related viruses failed to produce visible bands and there was no color change without PKoV, confirming the specificity of the assay. The high specificity of RT-LAMP is also the result of 4 targeting regions, instead of 2 in RT-PCR. In clinical specimens, the RT-LAMP assay detected PKoV in 144 out of the 166 samples, while RT-PCR only identified 124 PKoV positive samples. One explanation for this is that samples collected from pigs with lower amounts of PKoV may have had too little virus to be
detected by the less sensitive RT-PCR method. Prevalence of PKoV in fecal samples decreases with host age and piglets under the age of 3 weeks are more likely to be infected with PKoV than older pigs (An et al., 2011; Barry et al., 2011; Ribeiro et al., 2013). Perhaps the samples collected from slightly older pigs may have had a lower viral titer. Overall, new RT-LAMP method seems to have several advantages over conventional RT-PCR for the detection of PKoV. A recent report indicated that endemic PKoV infection had no clinical signs, and that domestic pigs had a higher infection rate than wild pigs (Reuter et al., 2010). In different countries, the detection rates of kobuviruses among domestic pigs have been reported as 99%, 84.5%, 53%, 45.4%, and 16.7% in Thailand, Korea, Brazil, Japan and the Netherlands, respectively (Wang et al., 2011). In China, PKoV is widespread, but mainly concentrated in the central and eastern regions. In this report, new method is tested in an epidemiological investigation of PKoV in Sichuan province. The percentage of positive samples collected from piglets with diarrhea in Sichuan was 90.8% (109/120). Mianyang has the highest detection rate of PKoV (96.7%), and Chengdu and Yaan have the lowest detection rate, with only 80% of pigs positive for PKoV. 35 out of 46 samples collected from healthy piglets tested positive for PKoV. These pigs may have recovered from the clinical symptoms of the virus
Table 2 The PKoV detection results in Sichuan province based on PKoV-RT-LAMP and PKoV-RT-PCR. Origin of samples
Chengdu Yaan Meishan Suining Mianyang Deyang
Samples
Number of samples
Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea Healthy feces Diarrhea
5 10 5 10 8 20 10 30 10 30 8 20
Detection results RT-PCR (positive/total sample)
RT-LAMP (positive/total sample)
2/5 (40%) 6/10 (60%) 3/5 (60%) 5/10 (50%) 6/8 (75%) 16/20 (80%) 6/10 (60%) 26/30 (86.6%) 7/10 (70%) 25/30 (83.3%) 6/8 (75%) 16/20 (80%)
3/5 (60%) 8/10 (80%) 3/5 (60%) 8/10 (80%) 6/8 (75%) 17/20 (85%) 8/10 (80%) 28/30 (93.3%) 8/10 (80%) 29/30 (96.7%) 7/8 (87.5%) 19/20 (95%)
X. Li et al. / Journal of Virological Methods 207 (2014) 1–5
while still having detectable amounts remaining in their systems. Deyang has the highest rate (87.5%) of PKoV reported in apparently healthy pigs. The frequency of PKoV in pigs with diarrhea is higher than that in apparently healthy pigs, which is consistent with previous reports, indicating that PKoV may play a role in pig diarrhea (Khamrin et al., 2009; Park et al., 2010; Okitsu et al., 2012). PKoV has been detected in not only in fecal samples, but also in serum samples, indicating viremia (Barry et al., 2011; Ribeiro et al., 2013). This study did not collect serum samples, so it is unable to compare blood levels of PKoV with levels detected in the intestines. This study also did not test for the presence of other diarrheal pathogens (PEDV, TGEV and RV), so it is unable to exclude co-infection. Although small sample size may appear to be a limitation, the samples were collected from many different farms and can still give important insight into the prevalence of PKoV infection in Sichuan Province. 5. Conclusions In summary, RT-LAMP is suited for sensitive and rapid detection of PKoV. Because of its simplicity and efficiency, this method is likely to be used to detect PKoV in samples collected in the field. This will enable researchers to conduct epidemiological investigations that could provide the basis for prevention of PKoV. Acknowledgements This study was supported by Sichuan Province Science and Technology Support Project (2012NZ0001), Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT IRT13083) and Program for New Century Excellent Talents of Ministry of Education of China (NCET 11-1059). References An, D.-J., Jeoung, H.-Y., Jeong, W., Lee, H.S., Park, J.-Y., Kim, B., 2011. Porcine kobuvirus from pig stool in Korea. Virus Genes 42, 208–211. Barry, A.F., Ribeiro, J., Alfieri, A.F., van der Poel, W.H., Alfieri, A.A., 2011. First detection of kobuvirus in farm animals in Brazil and the Netherlands. Infect. Genet. Evol. 11, 1811–1814. Blomström, A.-L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147, 188–193. Chen, C., Cui, S., Zhang, C., Li, J., Wang, J., 2010. Development and validation of reverse transcription loop-mediated isothermal amplification for detection of PRRSV. Virus Genes 40, 76–83. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270.
5
Fukuta, S., Tamura, M., Maejima, H., Takahashi, R., Kuwayama, S., Tsuji, T., Yoshida, T., Itoh, K., Hashizume, H., Nakajima, Y., 2013. Differential detection of Wheat yellow mosaic virus, Japanese soil-borne wheat mosaic virus and Chinese wheat mosaic virus by reverse transcription loop-mediated isothermal amplification reaction. J. Virol. Methods 189, 348. Gu, J., Yue, X., Xing, R., Li, C., Yang, Z., 2012. Progress in genetically engineered vaccines for porcine transmissible gastroenteritis virus. Rev. Med. Vet. (Toulouse) 163, 107–111. Khamrin, P., Maneekarn, N., Kongkaew, A., Kongkaew, S., Okitsu, S., Ushijima, H., 2009. Porcine kobuvirus in piglets, Thailand. Emerg. Infect. Dis. 15, 2075–2076. Li, B., Sun, B., Du, L.-P., Mao, A.-H., Wen, L.-B., Ni, Y.-X., Zhang, X.-H., He, K.-W., 2013a. Development of a loop-mediated isothermal amplification assay for the detection of porcine hokovirus. J. Virol. Methods 193, 415–418. Li, J.-Y., Wei, Q.-W., Liu, Y., Tan, X.-Q., Zhang, W.-N., Wu, J.-Y., Charimbu, M.K., Hu, B.-S., Cheng, Z.-B., Yu, C., 2013b. One-step reverse transcription loop-mediated isothermal amplification for the rapid detection of cucumber green mottle mosaic virus. J. Virol. Methods 193, 583–588. Li, Z., Chen, F., Yuan, Y., Zeng, X., Wei, Z., Zhu, L., Sun, B., Xie, Q., Cao, Y., Xue, C., 2013c. Sequence and phylogenetic analysis of nucleocapsid genes of porcine epidemic diarrhea virus (PEDV) strains in China. Arch. Virol. 158, 1267–1273. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Okitsu, S., Khamrin, P., Thongprachum, A., Hidaka, S., Kongkaew, S., Kongkaew, A., Maneekarn, N., Mizuguchi, M., Hayakawa, S., Ushijima, H., 2012. Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand. Virus Genes 44, 253–257. Park, S.-J., Kim, H.-K., Moon, H.-J., Song, D.-S., Rho, S.-M., Han, J.-Y., Nguyen, V.-G., Park, B.-K., 2010. Molecular detection of porcine kobuviruses in pigs in Korea and their association with diarrhea. Arch. Virol. 155, 1803–1811. Reuter, G., Boldizsár, Á., Kiss, I., Pankovics, P., 2008. Candidate new species of Kobuvirus in porcine hosts. Emerg. Infect. Dis. 14, 1968. Reuter, G., Boldizsár, Á., Pankovics, P., 2009. Complete nucleotide and amino acid sequences and genetic organization of porcine kobuvirus, a member of a new species in the genus Kobuvirus, family Picornaviridae. Arch. Virol. 154, 101–108. Reuter, G., Boros, Á., Pankovics, P., 2011. Kobuviruses – a comprehensive review. Rev. Med. Virol. 21, 32–41. Reuter, G., Kecskeméti, S., Pankovics, P., 2010. Evolution of porcine kobuvirus infection, Hungary. Emerg. Infect. Dis. 16, 696. Ribeiro, J., de Arruda Leme, R., Alfieri, A.F., Alfieri, A.A., 2013. High frequency of Aichivirus C (porcine kobuvirus) infection in piglets from different geographic regions of Brazil. Trop. Anim. Health Prod. 45, 1757–1762. Verma, H., Mor, S.K., Abdel-Glil, M.Y., Goyal, S.M., 2013. Identification and molecular characterization of porcine kobuvirus in US swine. Virus Genes 46, 551–553. Wang, C., Lan, D., Hua, X., 2011. Porcine kobuvirus from pig stool specimens in Shanghai, China. Virus Genes 43, 350–352. Wei, Q.-W., Yu, C., Zhang, S.-Y., Yang, C.-Y., Miriam, K., Zhang, W.-N., Dou, D.-L., Tao, X.-R., 2012. One-step detection of Bean pod mottle virus in soybean seeds by the reverse-transcription loop-mediated isothermal amplification. Virol. J. 9, 187. Yamazaki, W., Mioulet, V., Murray, L., Madi, M., Haga, T., Misawa, N., Horii, Y., King, D.P., 2013. Development and evaluation of multiplex RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J. Virol. Methods 192, 18–24. Zhang, Q.-L., Yan, Y., Shen, J.-Y., Hao, G.-J., Shi, C.-Y., Wang, Q.-T., Liu, H., Huang, J., 2013. Development of a reverse transcription loop-mediated isothermal amplification assay for rapid detection of grass carp reovirus. J. Virol. Methods 187, 384–389. Zhu, J., Yang, Q., Cao, L., Dou, X., Zhao, J., Zhu, W., Ding, F., Bu, R.-E., Suo, S., Ren, Y., 2013. Development of porcine rotavirus vp6 protein based ELISA for differentiation of this virus and other viruses. Virol. J. 10, 91.
