Journal of Biotechnology 173 (2014) 41–46

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Optimization of eGFP expression using a modified baculovirus expression system Jingping Ge, Liying Jin, Xiaoyan Tang, Dongni Gao, Qi An, Wenxiang Ping ∗ Key Laboratory of Microbiology, College of Life Science, Heilongjiang University, Harbin 150080, PR China

a r t i c l e

i n f o

Article history: Received 27 August 2013 Received in revised form 21 December 2013 Accepted 2 January 2014 Available online 18 January 2014 Keywords: WSSV ie1 promoter WPRE ITRs VSV-GED Recombinant baculovirus

a b s t r a c t The baculovirus gene expression system is an efficient and safe protein expression system, since baculoviruses cannot replicate in mammalian cells. In order to improve the transduction efficiency and increase the reporter gene expression levels delivered by baculoviruses, we tested in the baculovirus expression cassette the Woodchuck hepatitis virus response element (WPRE), and AAV-derived inverted terminal repeats (ITRs) and the truncated vesicular stomatitis virus G protein (VSV-GED). The results showed that WPRE and VSV-GED have synergistic effects and could enhance the expression efficiency of enhanced green fluorescence protein (eGFP), and that ITRs effectively extended the duration of eGFP expression. We also demonstrated that the efficiency of eGFP expression varied under the control of the CMV, CBA, EF1-␣ or WSSV ie1 promoters in different cell lines. © 2014 Elsevier B.V. All rights reserved.

1. Introduction The baculovirus expression system is widely used for the expression of recombinant proteins in insect cells and for vaccine production in mammalian cells, due to its high yield of soluble protein in insect cells, efficient transduction and lack of cytopathic effects in mammalian cells even at an MOI (multiplicity of infection) of 10,000. However, the level of transgene expression in various cell types is generally different. There are several ways to enhance the baculovirus-mediated transduction efficiency and gene expression levels in vertebrate cells. The transduction efficiency can be markedly enhanced by the addition of sodium butyrate, trichostatin A, or microtubule depolymerizing agents, which have been shown to markedly increase transgene expression and transcription levels (Condreay et al., 1999; Airenne et al., 2000; van Loo et al., 2001; Salminen et al., 2005). However, these strategies are limited by their cytotoxic effects (Salminen et al., 2005; Hunt et al., 2002). The transduction efficiency of baculoviruses may be enhanced by extending the standard transduction time under suitable transduction conditions (Cheng et al., 2004; Mähönen et al., 2007). This strategy is advantageous since baculoviruses are not toxic to vertebrate cells (Wang and Wang, 2005). The Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is a powerful cis-acting RNA element located in the viral 3 untranslated

∗ Corresponding author. Tel.: +86 13836002907; fax: +86 0451 86609016. E-mail address: [email protected] (J. Ge). 0168-1656/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2014.01.003

region (3 UTR). WPRE improves gene expression at the posttranscriptional level by modifying RNA polyadenylation (Donello et al., 1998). It has been demonstrated that insertion of the WPRE into the 3 UTR of transgenes carried by baculovirus vectors may increase the expression rates in vertebrate cells (Mähönen et al., 2007). A straightforward method to increase the transduction efficiency of baculoviruses is displaying vesicular stomatitis virus G protein (VSV-G) (Barsoum et al., 1997; Pieroni et al., 2001; Tani et al., 2001, 2003), truncated vesicular stomatitis virus G protein (VSV-GED) (Kaikkonen et al., 2006), the Arg-Gly-Asp motif (RGDmotif) (Matilainen et al., 2006), tumor-homing peptides (Makela et al., 2006) or avidin on the viral envelope (Raty et al., 2004). Plasmid vectors with expression cassettes containing a gene of interest flanked by adeno-associated virus (AAV) cis-acting inverted terminal repeats (ITRs) have reportedly improved the efficiency of transgene expression in mammalian cells (Philip et al., 1994; Vieweg et al., 1995; Johnston et al., 1997; Lam et al., 2002; Wang and Wang, 2005), Xenopus embryos (Fu et al., 1998), and fishes (Hsiao et al., 2001). Research showed that after brain cells from rats were transduced by an AAV-containing plasmid vector with an astrocyte-specific promoter, most transduced brain cells appeared neuronal (Peel and Klein, 2000; Xu et al., 2001), possibly as AAV ITRs, which can function directly as promoters (Flotte et al., 1993), had overridden the cellular promoter (Fitzsimons et al., 2002). In the current study, we investigated the feasibility of using AAV ITRs to improve transgene expression levels in baculovirus vectors.

42

J. Ge et al. / Journal of Biotechnology 173 (2014) 41–46

Finally, the choice of promoter may also affect expression levels. For example, in different cell lines, the transgene expression levels controlled by chicken beta-actin promoter (CBA) and the cytomegalovirus promoter (CMV) are completely different (Shoji et al., 1997). Also, cell-type specific gene expression may be achieved with tissue specific promoters (Park et al., 2001; Li et al., 2004). In addition, the White spot syndrome virus (WSSV) immediate-early promoter one (ie1) was shown to affect the transcription of genes controlled by non-baculovirus promoters in mammalian cells (He et al., 2008). To investigate the effects of the WPRE, VSV-GED and ITRs on baculovirus-mediated gene expression, we constructed baculovirus vectors containing various transgenes under the control of different promoters, in the absence and presence of the WPRE, VSVGED, and ITRs. Transgene expression levels were then determined in several cell lines by fluorescence microscopy and fluorescence activated cell sorting (FACS). Here, we demonstrate that inclusion of the WPRE, VSV-GED and ITRs provides a simple method of significantly enhancing baculovirus-mediated transgene expression in vertebrate cells. 2. Materials and methods 2.1. Cell culture Primary avian cells were cultured in 9-day-old embryonated specific-pathogen-free (SPF) chicken eggs. The primary avian cells were prepared according to a standard protocol (Spector et al., 1988), and were maintained in Dulbecco’s modified Eagle medium (DMEM, Hyclone, Logan, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, CA, USA), 2 mM glutamine and antibiotics (final concentration: penicillin, 100 U/mL; streptomycin, 100 ␮g/mL). CHO cells were cultured in the same medium. Cells were grown in dishes 10 cm in diameter at 37 ◦ C in 5% CO2 . Stock cells were passaged by treatment with 0.25% trypsin-EDTA (Gibco, CA, USA), and then replaced by fresh medium at appropriate cell densities for exponential growth. Sf9 insect cells were cultured at 28 ◦ C in Sf900II SFM medium containing 10% FBS (Gibco, CA, USA) and antibiotics. 2.2. Construction of baculovirus vectors In this study, five recombinant baculovirus vectors were constructed, including pX-control-eGFP, pX-WPRE-eGFP, pXVSV-GED-eGFP, pX-WPRE/VSV-GED -eGFP (pX-W/V-eGFP) and pX-ITRs-eGFP (Fig. 1). To construct the control baculovirus vectors pX-control-eGFP, a simian virus 40 (SV40) poly(A) signal from pEGFP-C3 was amplified with the forward primer 5 -CGGAATTCA CGCATGCTTGTCGACTAATCAGCCATACCACATTTGTAGAGGTTTT-3 and the reverse primer 5 -ATACGGTCCGTAAGATACATTGATGAGTTTGGACAAA CCAC-3 , and was then was cloned into the EcoRI and RsrII sites of pFastBac1 (Invitrogen, Carlsbad, CA). The promoter was inserted into pFastBac1 between the EcoRI and XbaI sites (WSSV ie1: the forward primer 5 -GGCTCTAGAGAG ATCCTAGAAAGAGGAGTG-3 , the reverse primer 5 -GCGGAATTCCG CTCGAGAT GGTACCCTTGAGTGGAGAGAGAGAGC-3 ; CBA: the forward primer 5 -GCTCTAGAGCCGTAATGAGACGCACAAACTAATATCACAAAC-3 , the reverse primer 5 -GTGAATTCCGGAGCTCTGCTCGAGCGAGGCCTAGCCG CCGGTCACACG CC-3 ; CMV: the forward primer 5 TGCTCTAGATAGTTATTA ATAGTAATCAATTACGGGGTCATTAGTTC-3 , the reverse primer 5 -GTGAATTCCGGAGCTCTGCTCGAGCGAGGCCTGATCTGACGGTTCACTAAACCAGCT CT-3 ; EF1␣: the forward primer 5 -TGCTCTAGACGTGAGGCTCCGGTGCCC-3 , the reverse primer 5 -CCGGAATTCCGGCGGCCGCTGATCGATTCACGACACC TGAAATGGAAGAAAAAA-3 ). The eGFP gene from pEGFP-C3 was used as the reporter gene for all

plasmids, and was amplified with the forward primer 5 ACTGAATTCGCCACCATGGTGAGCAAGG-3 and the reverse primer 5 -TCAGTCGACTCACTTGTACAGCTCGTCCATGCC-3 , and then inserted downstream of the promoter (EcoRI/SalI). In addition, a baculovirus vector containing the WPRE was constructed by inserting an expression cassette containing a multiple cloning site, a simian virus 40 (SV40) poly(A) signal, and WPRE sequences from pWHV8 (the forward primer 5 -C GGAATTCACGCATGCTTGTCGACGTTAATCAACCTCTGGATTACAAAATTTGTGA-3 , the reverse prime 5 -TAAAACCTCTACAAATGTGGTATGGCTGATTAA AACAGGCGGGGAGGCGG-3 ) into pFastBac1 (RsrII/EcoRI). Then the gp64SP sequence from baculovirus and the VSV-GED sequence from pCMV-VSV-G, both driven by polyhedrin promoters were also inserted into the same vector (XbaI/HindIII). To construct a baculovirus vector with the ITRs from AAV, two ITRs sequences from pAAV-LacZ were inserted into the vector using the RsrII and XbaI sites (L-ITRs: the forward primer 5 -ATACGGTCCGATGTCTGGATCTCCGGAC ACGTG-3 , the reverse primer 5 -ATACGGTCCGGGAGAAAATACCGCATCAGG CG-3 ; R-ITRs: the forward primer 5 -TGCTCTAGATTGCTGGCCTTTTGCTCA CATGT-3 , the reverse primer 5 -TGCTCTAGAGTAATTGATTACTATTAATAAC TAGTACGCGTG CG-3 ). Recombinant baculovirus vectors carrying the WPRE were named pX-WPRE-eGFP. Recombinant baculovirus vectors carrying the VSV-GED were named pX-VSV-GED-eGFP. Recombinant baculovirus vectors carrying both WPRE and VSV-GED were named pX-WPRE/VSVGED-eGFP (pX-W/V-eGFP), and the vectors carrying WPRE, VSV-GED and ITRs were named pX-ITRs-eGFP. Recombinant baculovirus vectors were transfected with Cellfectin® Reagent (Invitrogen, Carlsbad, CA) and propagated in Sf9 insect cells according to the Bac-to-Bac baculovirus expression system manual (Invitrogen, Carlsbad, CA). The titers of the various viruses constructed were measured by plaque analysis. 2.3. Transduction and eGFP expression assays Cells were seeded in 6-well culture dishes at 5 × 105 cells/well. After 12 h, the culture medium was removed, the cells were washed three times with 2 mL of DMEM, then the media was replaced with baculovirus inoculums at a multiplicity of infection (MOI) of 50 and incubated for 12 h at 37 ◦ C. The inoculums were then replaced by 2 mL fresh medium containing 10% FBS. The cells were cultured for another 48 h or 240 h. Cells were harvested with 0.25% trypsinEDTA, washed and resuspended in PBS, and used for detection of eGFP expression levels using FACS (Becton Dickinson, Aria, 334078) and fluorescence microscopy. Flow cytometry analysis was usually performed 48 h or 240 h after transfection. Three independent experiments were carried out to obtain the mean values. EGFP expression is the percentage of eGFP-positive cells in transduced cells. 3. Results 3.1. Expression of eGFP in different cell lines by different promoters In order to investigate the dependency of promoter strength on cell type, plasmids containing different promoters (pie1-controleGFP, pCBA-control-eGFP, pCMV-control-eGFP, pEF1␣-controleGFP) controlling eGFP expression were transfected into CEF, CHO and Sf9 cells with Cellfectin® Reagent (Invitrogen). At 48 h post-transfection, eGFP expression was detected by fluorescence microscopy (Fig. 2) and flow cytometry (Fig. 3). We observed that the expression efficiency of eGFP was promoter-dependent. In Sf9 cells, the highest expression efficiency of eGFP was driven by the

J. Ge et al. / Journal of Biotechnology 173 (2014) 41–46

43

Fig. 1. Construction of the recombinant baculoviruses in this study. The eGFP expression cassettes were individually inserted under the control of different promoters. The gp64SP and VSV-GED expression cassettes were inserted under the polyhedrin promoter. WPRE expression cassettes included eGFP and were controlled by various promoters, including the WSSV ie1, CMV, CBA and EF1␣ promoters. ITRs: adeno-associated virus inverted terminal repeats; SV40 polyA: Simian virus 40 polyA; WPRE: Woodchuck hepatitis virus post-transcriptional regulatory element; PPH : Polyhedrin promoter; gp64SP: gp64 signal peptide; VSV-GED: truncated vesicular stomatitis virus G protein; polyhedrin locus is based on the pFastbac[PH] baculovirus vector of the Bac-to-Bac system.

WSSV iel promoter (mean 63.80%), followed by the EF1␣ and CMV promoters, while the lowest expression efficiency was driven by the CBA promoter (mean 0.40%). In CHO cells, the expression efficiency of eGFP under the CBA promoter (mean 44.87%) was slightly higher than that of the CMV promoter (mean 37.07%) and EF1␣ promoter (mean 36.10%), and was much higher than the WSSV ie1 promoter (mean 9.97%; Fig. 3). In CEF cells, the expression efficiency

of eGFP under the EF1␣ promoter (mean 11.60%) was slightly lower than that of the WSSV ie1 promoter (mean 14.57%), but much lower than that of the CBA and CMV promoters (means 29.27% and 29.40%, respectively; Fig. 3). These results suggest that promoter activity is cell type-dependent. In Sf9 cells, the WSSV ie1 promoter was the most active, which makes it a promising candidate for efficient protein expression in baculovirus-infected Sf9 cells.

Fig. 2. Fluorescence microscopy of Sf9, CHO and CEF cells showing the expression of eGFP controlled by different promoters at 48 h post-transfection (200×). (a) The expression of eGFP controlled by the CBA promoter. (b) The expression of eGFP controlled by the CMV promoter. (c) The expression of eGFP controlled by the EF1␣ promoter. (d) The expression of eGFP controlled by the ie1 promoter.

44

J. Ge et al. / Journal of Biotechnology 173 (2014) 41–46 Table 1 The titers of various viruses. Virus name

Fig. 3. Flow cytometric detection of eGFP expression controlled by different promoters at 48 h post-transfection in different cell types. In Sf9 cells, the WSSV iel promoter produced the highest eGFP expression levels (mean 63.80%). In CHO cells, the CBA promoter produced the highest eGFP expression levels (mean 44.80%). In CEF cells, the CMV and CBA promoters produced the highest eGFP expression levels (mean 29.40% and 29.27%, respectively). Statistical differences were calculated by one-way ANOVA; P < 0.05.

3.2. WPRE/VSV-GED enhances eGFP expression Baculoviruses can express transgenes in certain cells, but the transgene expression level is often weak. To enhance transgene expression levels, we studied the effects of the WPRE and VSV-GED on the expression of eGFP, constructed baculovirus vectors that included the WPRE or VSV-GED, and compared the eGFP expression levels, as analyzed by flow cytometry, relative to eGFP vectors lacking the WPRE or VSV-GED. A significant increase in eGFP expression was detected in two cell lines (Fig. 4). Specifically, the WPRE slightly enhanced the expression of the eGFP reporter gene in CHO and CEF cells, and WPRE activity in CEF cells was weaker than that in CHO cells. Meanwhile, the VSV-GED had the same effect as the WPRE, by enhancing the expression of the eGFP reporter gene in both cell lines.

3.3. WPRE and VSV-GED exert synergistic effects on eGFP expression It is known that VSV-GED improves gp64-mediated baculovirus gene delivery, and the WPRE can significantly increase foreign gene expression levels in mammalian cells. We questioned whether the combination of these two elements would have synergistic effects on gene expression. To test this hypothesis, baculovirus vectors were constructed that included the reporter gene eGFP under the control of different promoters, containing both WPRE and VSV-GED (W/V) (px-W/V-eGFP). The expression of eGFP was analyzed by flow cytometry and fluorescence microscopy. A significant increase in eGFP expression was detected for the vectors containing both WPRE and VSV-GED (px-W/V-eGFP) in CHO and CEF cells; eGFP expression by vectors containing both WPRE and VSV-GED was larger than that of vectors containing WPRE or VSV-GED alone. As shown in Fig. 4, in CEF cells, the highest expression efficiency was observed in Bac-CMV-W/V- eGFP-transduced cells (p < 0.05), followed by Bac-CMV-WPRE-eGFP-, Bac-CMV-VSV-GED-eGFP- and Bac-CMVcontrol-eGFP-transduced cells. A lower expression efficiency was observed in Bac-ie1-control-eGFP-transduced CHO cells (p < 0.05) compared to Bac-iel-WPRE-eGFP, Bac-iel-VSV-GED-eGFP- and Bacie1-W/V-eGFP-transduced cells. To the best of our knowledge, this is the first report of augmented gene delivery due to the synergistic actions of WPRE and VSV-GED, without adversely affecting virus titers (Table 1).

BV-CBA-W/V-eGFP BV-CBA-ITRs-eGFP BV-CBA-WPRE-eGFP BV-CBA-VSV-GED-eGFP BV-CBA-control-eGFP BV-CMV-W/V-eGFP BV-CMV-ITRs-eGFP BV-CMV-WPRE-eGFP BV-CMV-VSV-GED-eGFP BV-CMV-control-eGFP BV-EF1␣-W/V-eGFP BV-EF1␣-ITRs-eGFP BV-EF1␣-WPRE-eGFP BV-EF1␣-VSV-GED-eGFP BV-EF1␣-control-eGFP BV-ie1-W/V-eGFP BV-ie1-ITRs-eGFP BV-ie1-WPRE-eGFP BV-ie1-VSV-GED-eGFP BV-ie1-control-eGFP

Virus titer (pfu/mL) 1.00 × 109 5.00 × 108 8.00 × 108 2.30 × 109 1.10 × 109 1.30 × 109 9.00 × 108 7.00 × 108 2.60 × 109 1.50 × 109 7.00 × 108 5.00 × 108 4.80 × 108 9.00 × 108 6.00 × 108 1.20 × 109 7.00 × 108 7.00 × 108 3.70 × 109 1.40 × 109

3.4. Sustained expression of eGFP by ITRs Baculovirus vectors can transduce mammalian cells and allow transient expression of transgenes, although they cannot reproduce. We have developed a new baculovirus vector including the AAV-derived ITRs in order to extend the duration of expression of the eGFP reporter gene. Cells were infected with the vectors at an MOI of 50 and eGFP expression was measured at 48 h and 240 h post-infection (Fig. 5). In CHO and CEF cells, only the vector containing ITRs was able to express eGFP for at least 240 h. In the BV-CMV group, eGFP expression levels by BV-CMV-W/V-eGFP, BV-CMV-WPRE-eGFP, BV-CMV-VSV-GEDeGFP and BV-CMV-ITRs-eGFP were increased by 1.5 to 2-fold compared to BV-CMV-control-eGFP in both cell lines after 48 h. EGFP expression by BV-CMV-W/V-eGFP, BV-CMV-WPRE-eGFP, BVCMV-VSV-GED-eGFP and BV-CMV-control-eGFP then decreased continuously to approximately 10% within 240 h (Fig. 5A and B). However, the BV-CMV-ITRs-eGFP vector provided 44.30% more eGFP expression than the other vectors of the BV-CMV group at 240 h in CHO cells (Fig. 5B). These findings demonstrate that ITRs can effectively extend the duration of expression of transgenes. 4. Discussion Insect baculovirus vectors are emerging as promising gene delivery agents capable of efficiently transferring genes of interest to a broad range of mammalian cell types (Ghosh et al., 2002; Kost and Condreay, 2002). The empirical advantages of baculoviruses as gene therapy vectors include the large cloning capacity conferred by the large viral genome, the easy preparation of large quantities of virus at high titers, and the inability of baculoviruses to replicate and express viral proteins in mammalian cells, thus significantly reducing the likelihood of vector neutralization caused by pre-existing antiviral immunity in patients. The efficiency of transient gene expression using the baculovirus gene delivery system is promoter- and cell type-dependent. In HeLa cells, the CAG promoter exhibited 10-fold higher luciferase activity than cells infected with the virus driven by the CMV promoter (Shoji et al., 1997). Palmer et al. compared the CMV, SV40, and MoMLV LTR promoters, and found that the CMV promoter was most effective for producing protein in normal human fibroblasts, but in mouse fibroblasts, the most effective promoter was MoMLV LTR, followed by CMV and SV40 (Palmer et al., 1989). The goal of this study was to compare the effects of different promoters on eGFP expression in

J. Ge et al. / Journal of Biotechnology 173 (2014) 41–46

45

Fig. 4. Flow cytometric analysis of the expression efficiency of eGFP by various recombinant baculoviruses in CEF (A) and CHO (B) cells at 48 h post-transfection. (A) In CEF cells, WPRE-, VSV-GED- and W/V- (WPRE and VSV-GED) containing vectors showed significantly increased gene expression levels. The expression efficiency of WPRE-, VSV-GED- and W/V-containing viruses were promoter-dependent. The CMV promoter produced the highest expression levels, while the EF1␣ promoter produced the lowest expression levels. In CEF cells, the average eGFP expression increased by 42.89%, 39.34% and 64.90% in the presence of WPRE, VSV-GED and W/V, respectively. (B) WPRE-, VSV-GED- and W/V-containing viruses also showed significantly increased gene expression in CHO cells. The CBA promoter produced the highest expression levels, and the WSSV ie1 promoter produced the lowest expression levels. The average eGFP expression increased by 57.69%, 53.28% and 81.65% for WPRE-, VSV-GED-, and W/V-containing viruses, respectively, and both were higher in CHO cells than in CEF cells. Statistical differences were calculated by one-way ANOVA with P < 0.05.

Fig. 5. Flow cytometric analysis of the differential expression efficiency of eGFP by different baculoviruses in CEF (A) and CHO (B) cells at 48 h and 240 h post-transfection. Statistical differences were calculated by one-way ANOVA with P < 0.05.

different cell types in the presence and absence of the WPRE, VSVGED and ITRs. Four strong promoters, CMV, CBA, EF1␣ and WSSV ie1 were compared in three cell lines. In CHO cells, CBA produced the highest expression of the eGFP reporter gene, followed by CMV and EF1␣, and then the WSSV ie1 promoter. In CEF cells, the CBA and CMV promoters were the most effective, while EF1␣ was the least effective. In contrast, the WSSV ie1 promoter was the most effective in Sf9 cells out of all the promoters in this study. These results demonstrated that promoter strength is cell type-dependent. We also observed increased eGFP expression for vectors carrying the WPRE for all promoters and both cell types. The fluorescence increase induced by WPRE in CEF cells was lower than that seen in CHO cells (Fig. 2). This result suggested that the WPRE can increase protein expression in multiple cell lines. To study the synergistic effects of WPRE and VSV-GED on eGFP expression, a gene encoding VSV-GED was inserted into the baculovirus genome under the control of the polyhedrin promoter, which was expressed at very high levels in infected insect cells, but not in mammalian cells. The expression of the eGFP reporter gene in mammalian cells was therefore driven by the CMV, CBA, EF1␣ and WSSV ie1 promoters, respectively, which were functional in Sf9, CHO and CEF cell lines. The results showed that the presence of VSV-GED and WPRE improved eGFP expression in both CHO and CEF cell lines, as measured by flow cytometry and fluorescence analysis.

To investigate the effects of the WPRE, VSV-GED and ITRs on baculovirus-mediated gene expression, baculovirus vectors containing the eGFP gene under the control of different promoters were constructed in the presence and absence of the WPRE, VSVGED, and ITRs. Transgene expression levels were then determined in several cell lines by fluorescence microscopy and flow cytometry. The results showed that the WPRE, VSV-GED and ITRs significantly enhanced baculovirus-mediated transgene expression in vertebrate cells. In addition, the WPRE, VSV-GED and ITRs are easy to incorporate into the baculoviral expression cassette and do not interfere with efficient virus production. Thus, they are powerful tools to achieve persistent high-level transgene expression in vertebrate cells. This study will facilitate the development of a baculovirus gene delivery system for future vaccine research. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (31270143), the National Natural Science Foundation of China (31070446), the National Natural Science Foundation of China (31270534), the High-level Talents (Innovation Team) Projects of Heilongjiang University (Hdtd2010-17) and the Innovation Team in Science and Technology of Heilongjiang Province (the Fermentation Technology of Agricultural Microbiology).

46

J. Ge et al. / Journal of Biotechnology 173 (2014) 41–46

References Airenne, K.J., Hiltunen, M.O., Turunen, M.P., Turunen, A.M., Laitinen, O.H., Kulomaa, M.S., Ylä-Herttuala, S., 2000. Baculovirus-mediated periadventitial gene transfer to rabbit carotid artery. Gene Therapy 17, 1499–1504. Barsoum, J., Brown, R., McKee, M., Boyce, F.M., 1997. Efficient transduction of mammalian cells by a recombinant baculovirus having the vesicular stomatitis virus G glycoprotein. Human Gene Therapy 8, 2011–2018. Cheng, T., Xu, C.Y., Wang, Y.B., Chen, M., Wu, T., Zhang, J., Xia, N.S., 2004. A rapid and efficient method to express target genes in mammalian cells by baculovirus. World Journal of Gastroenterology 10, 1612–1618. Condreay, J.P., Witherspoon, S.M., Clay, W.C., Kost, T.A., 1999. Transient and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proceedings of the National Academy of Sciences 96, 127–132. Donello, J.E., Loeb, J.E., Hope, T.J., 1998. Woodchuck hepatitis virus contains a tri-partite posttranscriptional regulatory element. Journal of Virology 72, 5085–5092. Fitzsimons, H.L., Bland, R.J., During, M.J., 2002. Promoters and regulatory elements that improve adeno-associated virus transgene expression in the brain. Methods 28, 227–236. Flotte, T.R., Afione, S.A., Solow, R., Drumm, M.L., Markakis, D., Guggino, W.B., Zeitlin, P.L., Carter, B.J., 1993. Expression of the cystic fibrosis transmembrane conductance regulator from a novel adeno-associated virus promoter. Journal of Biological Chemistry 268, 3781–3790. Fu, Y., Wang, Y., Evans, S.M., 1998. Viral sequences enable efficient and tissuespecific expression of transgenes in Xenopus. Nature Biotechnology 16, 253–257. Ghosh, S., Parvez, M.K., Banergee, K., Sarin, S.K., Hasnain, S.E., 2002. Baculovirus as mammalian cell expression vector for gene therapy: an emerging strategy. Molecular Therapy 6, 5–11. He, F., Ho, Y., Yu, L., Kwang, J., 2008. WSSV ie1 promoter is more efficient than CMV promoter to express H5 hemagglutinin from influenza virus in baculovirus as a chicken vaccine. BioMed Central Microbiology 8, 1–10. Hsiao, C.D., Hsish, F.J., Tsai, H.J., 2001. Enhanced expression and stable transmission of transgenes flanked by inverted terminal repeats from adeno-associated virus in zebrafish. Developmental Dynamics 220, 323–336. Hunt, L., Batard, P., Jordan, M., Wurm, F.M., 2002. Fluorescent proteins in animal cells for process development: optimization of sodium butyrate treatment as an example. Biotechnology and Bioengineering 77, 528–537. Johnston, K.M., Jacoby, D., Pechan, P.A., Fraefel, C., Borghesani, P., Schuback, D., Dunn, R.J., Smith, F.I., Breakefield, X.O., 1997. HSV/AAV hybrid amplicon vectors extend transgene expression in human glioma cells. Human Gene Therapy 8, 359–370. Kaikkonen, M.U., Raty, J.K., Airenne, K.J., Wirth, T., Heikura, T., Yla-Herttuala, S., 2006. Truncated vesicular stomatitis virus G protein improves baculovirus transduction efficiency in vitro and in vivo. Gene Therapy 13, 304–312. Kost, T.A., Condreay, J.P., 2002. Recombinant baculoviruses as mammalian cell genedelivery vectors. Trends in Biotechnology 20, 173–180. Lam, P., Hui, K.M., Wang, Y., Allen, P.D., Louis, D.N., Yuan, C.J., Breakefield, X.O., 2002. Dynamics of transgene expression in human glioblastoma cells mediated by herpes simplex virus/adeno-associated virus amplicon vectors. Human Gene Therapy 13, 2147–2159. Li, Y., Wang, X., Guo, H., Wang, S., 2004. Axonal transport of recombinant baculovirus vectors. Molecular Therapy 10, 1121–1129. Mähönen, A.J., Airenne, K.J., Purola, S., Peltomaa, E., Kaikkonen, M.U., Riekkinen, M.S., Heikura, T., Kinnunen, K., Roschier, M.M., Wirth, T., Y¨laHerttuala, S., 2007. Post-transcriptional regulatory element boosts baculovirusmediated gene expression in vertebrate cells. Journal of Biotechnology 131, 1–8.

Makela, A.R., Matilainen, H., White, D.J., Ruoslahti, E., Oker-Blom, C., 2006. Enhanced baculovirus-mediated transduction of human cancer cells by tumor-homing peptides. Journal of Virology 80, 6603–6611. Matilainen, H., Makela, A.R., Riikonen, R., Saloniemi, T., Korhonen, E., Hyypia, T., Heino, J., Grabherr, R., Oker-Blom, C., 2006. RGD motifs on the surface of baculovirus enhance transduction of human lung carcinoma cells. Journal of Biotechnology 125, 114–126. Palmer, T.D., Thompson, A.R., Miller, A.D., 1989. Production of human factor IX in animals by genetically modified skin fibroblasts: potential therapy for hemophilia B. Blood 73, 438–445. Park, S.W., Lee, H.K., Kim, T.G., Yoon, S.K., Paik, S.Y., 2001. Hepatocyte-specific gene expression by baculovirus pseudotyped with vesicular stomatitis virus envelope glycoprotein. Biochemical and Biophysical Research Communications 289, 444–450. Peel, A.L., Klein, R.L., 2000. Adeno-associated virus vectors: activity and applications in the CNS. Journal of Neuroscience Methods 98, 95–104. Philip, R., Brunette, E., Kilinski, L., Murugesh, D., McNally, M.A., Ucar, K., Rosen-blatt, J., Okarma, T.B., Lebkowski, J.S., 1994. Efficient and sustained gene expression in primary T lymphocytes and primary and cultured tumor cells mediated by adeno-associated virus plasmid DNA complexed to cationic liposomes. Molecular and Cellular Biology 14, 2411–2418. Pieroni, L., Maione, D., La Monica, N., 2001. In vivo gene transfer in mouse skeletal muscle mediated by baculovirus vectors. Human Gene Therapy 12, 871–881. Raty, J.K., Airenne, K.J., Marttila, A.T., Marjomaki, V., Hytonen, V.P., Lehto-lainen, P., Laitinen, O.H., Mähönen, A.J., Kulomaa, M.S., Yla-Herttuala, S., 2004. Enhanced gene delivery by avidin-displaying baculovirus. Molecular Therapy 9, 282–291. Salminen, M., Airenne, K.J., Rinnankoski, R., Reimari, J., Välilehto, O., Rinne, J., Suikkanen, S., Kukkonen, S., Ylä-Herttuala, S., Kulomaa, M.S., Ranta, M.V., 2005. Improvement in nuclear entry and transgene expression of baculoviruses by disintegration of microtubules in human hepatocytes. Journal of Virology 795 (27), 0–2728. Shoji, I., Aizaki, H., Tani, H., Ishii, K., Chiba, T., Saito, I., Miyamura, T., Matsuura, Y., 1997. Efficient gene transfer into various mammalian cells, including nonhepatic cells by baculovirus vectors. Journal of General Virology 78, 2657–2664. Spector, D.L., Goldman, R.D., Leinwand, L.A., 1988. Cells. Cold Spring Harbor Laboratory Press, New York. Tani, H., Limn, C.K., Yap, C.C., Onishi, M., Nozaki, M., Nishimune, Y., Okahashi, N., Kitagawa, Y., Watanabe, R., Mochizuki, R., Moriishi, K., Matsuura, Y., 2003. In vitro and in vivo gene delivery by recombinant baculoviruses. Journal of Virology 77, 9799–9808. Tani, H., Nishijima, M., Ushijima, H., Miyamura, T., Matsuura, Y., 2001. Characterization of cell surface determinants important for baculovirus infection. Journal of Virology 279, 343–353. van Loo, N.D., Fortunati, E., Ehlert, E., Rabelink, M., Grosveld, F., Scholte, B.J., 2001. Baculovirus infection of nondividing mammalian cells: mechanisms of entry and nuclear transport of capsids. Journal of Virology 75, 961–970. Vieweg, J., Boczkowski, D., Roberson, K.M., Roberson, K.M., Edwards, D.W., Philip, M., Philip, R., Rudoll, T., Smith, C., Robertson, C., Gilboa, E., 1995. Efficient gene transfer with adeno-associated virus-based plasmids complexed to cationic liposomes for gene therapy of human prostate cancer. Cancer Research 55, 2366–2372. Wang, C.Y., Wang, S., 2005. Adeno-associated virus inverted terminal repeats improve neuronal transgene expression mediated by baculovirus vectors in rat brain. Human Gene Therapy 16, 1219–1226. Xu, R., Janson, C.G., Mastakov, M., Lawlor, P., Young, D., Mouravlev, A., Fitzsimons, H., Choi, K.L., Ma, H., Dragunow, M., Leone, P., Chen, Q., Dicker, B., During, M.J., 2001. Quantitative comparison of expression with adenoassociated virus (AAV-2) brain-specific gene cassettes. Gene Therapy 8, 1323–1332.