http://informahealthcare.com/hth ISSN: 0265-6736 (print), 1464-5157 (electronic) Int J Hyperthermia, 2014; 30(2): 96–101 ! 2014 Informa UK Ltd. DOI: 10.3109/02656736.2014.880857
RESEARCH ARTICLE
Optimum temperature for extracellular matrix production by articular chondrocytes Akira Ito1,2, Tomoki Aoyama3, Hirotaka Iijima1, Momoko Nagai1, Shoki Yamaguchi1, Junichi Tajino1, Xiangkai Zhang1, Haruhiko Akiyama4, and Hiroshi Kuroki1 1
Department of Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, 2Research Fellow of Japan Society for the Promotion of Science, Tokyo, Japan, 3Department of Development and Rehabilitation of Motor Function, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan, and 4Department of Orthopaedic Surgery, Graduate School of Medicine, Gifu University, Gifu, Japan Abstract
Keywords
Purpose: The purpose of this study was to investigate the influence of temperature on the ability of the chondrocytes to produce extracellular matrix (ECM). Materials and methods: Articular chondrocytes were isolated from porcine knee joints. The chondrocytes were cultured at three different temperatures: 32 C, 37 C, and 41 C. The ability to produce ECM was assessed by gene expression analysis, histological, and biochemical evaluation in a pellet culture system. Results: Wet weight of the pellets generated after 21 days, was significantly heavier when cultured at lower temperatures. Picrosirius red staining, employed to evaluate collagen production, was higher at lower temperatures, and safranin-O staining, used to evaluate sulphated glycosaminoglycan (GAG), was lower at 32 C than at 37 C and 41 C. Collagen type IIA1 mRNA expression was markedly up-regulated at 41 C. However, picrosirius red staining was inhibited at 41 C. GAG and DNA content were measured by 1,9-dimethylmethylene blue (DMMB) assay and PicoGreenÕ assay, respectively. The GAG content per pellet was significantly low at 41 C compared to that at 32 C and 37 C. The DNA content per pellet was larger at lower temperatures. The GAG content normalised with the DNA content per pellet was significantly lower at 32 C compared to that at 37 C and 41 C. Conclusion: Our results suggest that a culture temperature of approximately 41 C inhibits ECM production by decreasing DNA content and perhaps by collagen misfolding. Taken together, the optimum temperature for ECM production in articular chondrocytes may be between 32 C and 37 C.
Articular chondrocytes, extracellular matrix production, optimum temperature
Articular cartilage is a hyaline cartilage that exists at the epiphysis of the articular joints. It is composed of a dense cartilaginous extracellular matrix (ECM) with sparse distribution of highly specialised cells called chondrocytes. The ECM is primarily composed of water, collagen, and proteoglycans. Collagen is the most abundant structural macromolecule in ECM, and it makes up about 60% of the dry weight of cartilage. Type II collagen represents 90–95% of the collagen in ECM and forms fibrils and fibres intertwined with proteoglycan aggregates. Proteoglycans consist of a protein core with one or more linear glycosaminoglycan (GAG) chains. Aggrecan, which is one of the major proteoglycans of the articular cartilage, occupies the interfibrillar space of the ECM and facilitates the osmotic properties of the cartilage [1,2]. In this manner, the ECM plays a role in cushioning the joint to facilitate smooth movements. However, the ECM of the
Address for correspondence: Hiroshi Kuroki, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Tel: +81-75-751-3963. Fax: +81-75-751-3909. E-mail: [email protected]
Received 30 May 2013 Revised 3 January 2014 Accepted 4 January 2014 Published online 5 February 2014
articular cartilage is an avascular tissue, and therefore it cannot be regenerated in advanced degeneration of the ECM [3,4]. Fortunately, recent developments in regenerative medicine support the ability to regenerate articular cartilage. Brittberg et al. [5] reported the autologous chondrocyte transplantation (ACT) method, in which chondrocytes isolated from noncontact autologous articular cartilage debris were expanded by monolayer culture, and were then transplanted into chondral lesion sites. It was thought that a scaffold offering a three-dimensional (3D) nutrient environment with growth factors is critical for the regeneration of the cartilaginous ECM in which the chondrocytes are transplanted by ACT. Therefore, extensive research is being carried out on artificial scaffolding [6,7], various growth factors [8,9], or transgenic therapy [10,11], to enhance the cartilaginous ECM production. However, safety and cost are significant hurdles in this process. Hence, clinically simpler and safer methods for enhancing ECM production during cartilage regeneration are still elusive. We assume that mild hyperthermia could be one of the promising candidates for enhancing ECM production.
20 14
Introduction
History
DOI: 10.3109/02656736.2014.880857
Hyperthermia has been applied in the treatment of malignant diseases [12]. Recently, hyperthermia has also been applied to treat the articular cartilage in osteoarthritis [13]. However, there are few studies that have investigated the threshold for thermal damage to articular cartilage or chondrocytes and the chronic consequences of thermal exposure, especially on regenerating cartilage [14,15]. Temperature is one of the most important factors for the survival and metabolism of all types of cells. Homeotherms keep their body temperature constant in order to maintain normal metabolism. However, some tissues such as the skin and articular cartilage are influenced by environmental temperature. The actual temperature in a mammalian knee joint, including that of humans, is approximately 32 C, which is 4–5 C lower than the inner body temperature [16,17], indicating that it is influenced by the environmental temperature. However, most of the in vitro studies on articular chondrocytes have been conducted at 37 C, which may not reflect the in vivo environment. The effects of thermal stimulus or intra-articular temperatures in the cartilaginous ECM production are still unclear. The purpose of this study was to investigate the influence of different temperatures employed for culture, on the ability of the chondrocytes to produce ECM. We hypothesised that cartilage ECM formation is significantly enhanced at 37 C, which is approximately the inner body temperature.
Materials and methods Chondrocyte isolation and expansion Two skeletally immature (6-month-old) pigs were purchased from a meat processor (Aotachikusan, Kyoto, Japan). Articular cartilage plugs were aseptically harvested from the femoral condyle of each pig by using a biopsy punch and kept separately. Chondrocytes were isolated as previously described [18]. The isolated cells were re-suspended in fresh Dulbecco’s modified Eagle medium/Ham’s F12 (DMEM/Ham’s F12, Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum (FBS, Hyclone, Logan, UT), 50 U/mL penicillin (Nacalai Tesque), and 50 mg/mL streptomycin (Nacalai Tesque), and were seeded in tissue culture dishes. The chondrocytes were expanded in a CO2 incubator (5% CO2, 37 C, 95% humidity) to obtain an adequate quantity of cells (2 passages). Pellet culture system To provide a 3D environment, a pellet culture system was used in this study. Pellet culture is widely used to evaluate chondrogenic potential and to study the signalling pathways involved in chondrogenesis [19,20]. The expanded chondrocytes were trypsinised and then washed with DMEM/Ham’s F12, resuspended with chondrogenic medium (chondrogenic basal medium, plus ITS + supplement, ascorbate, dexamethasone, L-glutamine, sodium pyruvate, proline, and GA-1000, Lonza, Walkersville, MD) supplemented with 10 ng/mL of recombinant human transforming growth factor-beta 3 (R&D Systems, Minneapolis, MN). Aliquots of 2.5 105 cells in 500 mL of the chondrogenic medium were centrifuged at 250 g for 5 min in 15 mL polypropylene conical tubes. The pelleted cells were pre-cultured at 37 C in a CO2 incubator
Optimum temperature for articular chondrocytes
97
(5% CO2, 95% humidity) for 3 days to form a spherical aggregate at the bottom of each tube. After pre-culture, these constructed pellets were cultured at three different temperatures: 32 C as normal intra-articular temperature, 37 C as inner body temperature, and 41 C as threshold temperature of mammalian cell survival [21,22]. The culture medium was changed every 3 days, and the pellets were harvested initially after 14 days to analyse the gene expression. After 21 days the pellets were harvested for analysing wet weight, histology, the GAG and DNA content. Total RNA extraction and real-time reverse transcription polymerase chain reaction (RT-PCR) The generated pellets were harvested after 14 days, and three pellets were pooled together and analysed as one sample. Total RNA was extracted using the RNeasy Mini Kit following the manufacturer’s protocol (Qiagen, Valencia, CA) and purified by RNase-free DNase on-column incubation. Extracted total RNA was tested for purity using a NanoDrop2000 (Thermo Scientific, Wilmington, MA), and then stored at 80 C until use. Real-time RT-PCR was performed as described previously [18]. Briefly, total RNA (100 ng) was reverse-transcribed to synthesise cDNA, and then real-time PCR was performed using the Applied Biosystems7500 Real-Time PCR System (Life Technologies Corporation, Carlsbad, CA). The PCR reaction was performed for 10 min at 95 C, followed by 40 amplification cycles (15 s at 95 C, 60 s at 60 C). The following target genes were examined (Table I): the chondrogenic markers collagen type IIA1 (COL2A1) and aggrecan, the dedifferentiation marker collagen type IA1 (COL1A1). Beta-actin was used as a housekeeping gene. The data obtained by real-time PCR were analysed by the comparative threshold cycle method. Briefly, the quantity of the target genes was normalised to that of beta-actin. The value of the calibration sample (the cells cultured at 32 C) was set to 1, and the values for each of the other conditions were shown relative to that of the calibration sample. Histochemical staining The wet weight of the generated pellets cultured at three different temperatures for 21 days were measured, and then fixed in 4% paraformaldehyde at 4 C overnight. These fixed pellets were dehydrated and embedded in paraffin, and 6-mm thick sections were prepared. To detect deposition of GAG and collagen, the sections were stained with safranin-O/fast green and picrosirius red, respectively (n ¼ 4). Measurement of the GAG and DNA content The total GAG content in the pellet was measured using a 1,9-dimethylmethylen blue (DMMB) colorimetric method [23]. Briefly, the pellets were digested in papain digestion solution at 60 C for 3 h and 20-mL aliquots of samples were mixed into 180 mL of DMMB reagent, and then the absorbance was measured at 530 nm. The papain-digested samples were also used for measuring DNA content by the Quant-iTÔ PicoGreenÕ assay (Invitrogen, Paisley, UK), following the manufacturer’s instructions. Briefly, 16 mL of each sample was added to 384 mL TE buffer, and the samples
98
A. Ito et al.
Int J Hyperthermia, 2014; 30(2): 96–101
Table I. Primer sequences for real-time RT-PCR.
COL2A1 COL1A1 aggrecan Beta-actin
Sense (50 –30 )
Antisense (50 –30 )
Length (bp)
GCTATGGAGATGACAACCTGGCTC CAGAACGGCCTCAGGTACCA GAATTTCCTGGCGTGAGAAC AAGCCAACCGTGAGAAGATG
CACTTACCGGTGTGTTTCGTGCAG CAGATCACGTCATCGCACAAC GGGGATGTTGCGTAAAAGAC TCCATCACGATGCCAGTG
256 101 107 124
Figure 1. Macroscopic observation and wet weight. (A) Representative photograph of the generated pellets cultured at 32 C, 37 C, and 41 C for 21 days. Scale bar, 1 mm, magnification 50. 32 C: n ¼ 5, 37 C: n ¼ 4, 41 C: n ¼ 5. (B) Wet weight of the pellets cultured at 32 C, 37 C, and 41 C for 21 days. Values represent the means and standard deviations. **p50.01, n ¼ 12.
were aliquoted in triplicate (100 mL) into a 96-well flat bottomed plate. To this, 100 mL PicoGreen reagent was added and the fluorescence of the samples was analysed at excitation and emission wavelengths of 485/535 nm using a fluorometer. Statistical analysis The gene expression (n ¼ 3), wet weight (n ¼ 12), GAG, DNA, and GAG/DNA (n ¼ 8) levels are expressed as means ± standard deviation (SD), and ‘n’ indicates the number of pellets obtained from one pig. In the gene expression analysis, to obtain sufficient amount of mRNA, three pellets were combined as one sample. Statistical significance was determined using one-way analysis of variance (ANOVA) with the post-hoc multiple comparison Tukey-Kramer test. The differences observed were considered to be significant if the P value was lower than 0.05. All experiments were repeated again using cells harvested from another pig to confirm the accuracy and reproducibility of the results, and similar results were confirmed (data not shown).
Results Wet weight Representative pellets generated at three different temperatures after 21 days culture are shown in Figure 1(A). These pellets showed an oval form, and seemed to be larger when the temperature was lower. Additionally, wet weight was also significantly heavier at the lower temperature (32 C: 0.84 mg ± 0.11, 37 C: 0.72 mg ± 0.08, 41 C: 0.51 mg ± 0.05) (Figure 1B).
Gene expression analysis The pellets were cultured for 14 days at three different temperatures and the mRNA expression of specific genes in the articular ECM was analysed. COL2A1 mRNA expression was markedly up-regulated at 41 C (9.96-fold compared to that at 32 C) (Figure 2A). There were no significant differences in the mRNA expression on COL1A1 (Figure 2B) and aggrecan (Figure 2C) between three different temperatures. Histological evaluation The pellets were cultured for 21 days at three different temperatures, and GAG and collagen production were assessed histologically. While safranin-O staining was observed in the peripheral zone in samples cultured at 32 C, staining in the central zone was low (Figure 3A). On the other hand, in samples cultured at 37 C, intense staining was detected, especially in the central zone (Figure 3C). At 41 C, staining with safranin-O was observed in the entire region (Figure 3E). Staining with picrosirius red at 32 C was observed in the entire region, especially in the superficial zone (Figure 3B). At 37 C, however, decreased staining was observed in the central zone, while distinct staining was observed in the peripheral zone (Figure 3D). At 41 C, decreased staining with picrosirius red was observed even in the peripheral zone, and was remarkably decreased in the central zone similar to that observed at 37 C (Figure 3F). GAG and DNA content The pellets were cultured for 21 days at three different temperatures, and the GAG and DNA content were
DOI: 10.3109/02656736.2014.880857
Optimum temperature for articular chondrocytes
99
Figure 2. Gene expression analysis. Relative mRNA expression of (A) COL2A1, (B) COL1A1, (C) Aggrecan of the pellets cultured at 32 C, 37 C, and 41 C for 14 days. Values represent the means and standard deviations. **p50.01, n ¼ 3 (n indicates one sample which contained a combination of 3 pellets harvested from one pig, i.e. 3 samples represent 9 pellets).
Discussion
Figure 3. Histological evaluation. Representative images of safranin-O/ fast green staining of the pellets cultured at (A) 32 C, (C) 37 C, (E) 41 C for 21 days, and representative images of picrosirius red staining of the pellets cultured at (B) 32 C, (D) 37 C, (F) 41 C for 21 days. Scale bar ¼ 500 mm, magnification 100, 32 C: n ¼ 5, 37 C: n ¼ 4, 41 C: n ¼ 5.
quantitatively analysed. The GAG content per pellet was significantly lower at 41 C compared to that at 32 C and 37 C (32 C: 7.92 mg ± 1.13, 37 C: 8.11 mg ± 0.58, 41 C: 5.24 mg ± 0.35) (Figure 4A). The DNA content was higher at lower temperatures (32 C: 0.72 mg ± 0.14, 37 C: 0.57 mg ± 0.07, 41 C: 0.36 mg ± 0.06) (Figure 4B). When the GAG content was normalised with the DNA content, the value was significantly lower at 32 C compared to that at 37 C and 41 C (32 C: 11.09 mg/mg ± 1.11, 37 C: 14.40 mg/mg ± 1.56, 41 C: 14.71 mg/mg ± 2.15) (Figure 4C).
In order to elucidate the effects of different temperatures on the ECM production of articular chondrocytes, we investigated chondrogenic gene expression, GAG, and collagen production by using a pellet culture system. Our results indicated that at temperatures between 32 C and 41 C, the wet weight of the generated pellet was greater at lower temperatures (Figure 1B). The production of the GAG and the collagen, which are the main structural contents of the cartilaginous ECM, was histologically assessed by safranin-O staining and picrosirius red staining, respectively. Staining with safranin-O at 32 C was low in the central zone (Figure 3A), whereas staining at 37 C was high in the central zone (Figure 3C). These results suggested that the GAG production domain would change with temperature. On the other hand, while staining with picrosirius red was observed in the entire region at 32 C (Figure 3B), staining at 37 C and 41 C was remarkably decreased in the central zone (Figures 3D and F). This suggests that the culture temperature could also affect the collagen production domain. Furthermore, staining with picrosirius red in the peripheral zone was decreased at 41 C compared to that at 32 C and 37 C, suggesting that collagen production is inhibited. However, in the gene expression analysis on the 14th day of cultivation, the expression of COL2A1 was upregulated at 41 C by approximately 10 times that at 32 C and 37 C (Figure 2A), and was not in agreement with the histological evaluation using picrosirius red staining. One of the reasons for this discrepancy is that the ECM might mainly consist of COL1 protein rather than COL2 protein. In this case, it might not be reflected in the histology even though the COL2A1 mRNA was up-regulated. Another reason for this discrepancy may be the potential inhibition of collagen production beyond a specific transcriptional threshold that may have arisen at 41 C. Peltonen et al. [24] reported that collagen cannot fold into a triple-helix conformation at a temperature of approximately 40 C. Although COL2A1 mRNA expression was up-regulated at 41 C, there is a possibility that appropriate folding of synthesised collagen was inhibited.
100
A. Ito et al.
Int J Hyperthermia, 2014; 30(2): 96–101
Figure 4. GAG and DNA content. (A) The GAG content per pellet and (B) the DNA content per pellet cultured at 32 C, 37 C, and 41 C for 21 days were analysed by DMMB assay and PicoGreen assay, respectively. (C) The GAG content normalised with the DNA content (GAG/DNA) was calculated to estimate the GAG production per chondrocyte. Values represent the means and standard deviations. *p50.05, **p50.01, n ¼ 8.
In order to quantitatively analyse GAG production, GAG and DNA content were analysed by DMMB and PicoGreen assay, respectively. Our results suggested that the GAG content per pellet was significantly less at 41 C compared to that at 32 C and 37 C (Figure 4A). In addition, the DNA content was higher at lower temperatures (Figure 4B). Furthermore, in order to estimate the GAG production per chondrocyte, the GAG content was normalised with the DNA content (GAG/DNA). Our results suggested that the value of GAG/DNA was significantly lower at 32 C compared to that at 37 C and 41 C (Figure 4C). From these results, although the GAG production ability per chondrocyte was lower at 32 C, it was thought that the GAG content per pellet was equivalent to 37 C since the pellet at 32 C was comprised of many cells. Furthermore, since there were fewer cells in the pellet at 41 C, the GAG content per pellet at 41 C was lower than that at 32 C and 37 C. The DNA content reflecting the number of cells decreased in a temperature-dependent manner. Dexheimer et al. [25] reported that about 50% of the human mesenchymal stem cells subjected to pellet culture were finally lost by apoptosis or other forms of cell death, and they concluded that the shift to high cell density and low nutrient and oxygen conditions could potentially facilitate cell loss. We speculate that the differences of the DNA content observed in this study were caused by the additional stress induced by the thermal environment. Several reports have suggested that intermittent mild heat stimulus (41 C) promoted ECM anabolism both in vitro [26] and in vivo [27]. Serrat et al. [28] also suggested that the chondrocyte proliferation and ECM volume are strongly correlated with tissue temperature in metatarsals cultured without vasculature in vitro. However, only a few studies have analysed the metabolic changes in chondrocytes at 32 C, which is the normal intra-articular temperature. Kocaoglu et al. [29] studied the effects of the irrigation fluid on the metabolism of articular chondrocytes at different temperatures. They assumed that the production of the ECM was higher at 32 C than at 4 C, 24 C, and 37 C, which is consistent with our wet weight and
picrosirius red staining results. On the basis of the GAG production, this study suggests that 32 C may not be the most optimum temperature for ECM production. However, this study also indicated that even at 32 C it is possible to produce equivalent ECM production similar to that produced at 37 C. We identified four limitations in this study. First, our results were obtained from in vitro experiments, and we did not validate the effects in vivo. Second, we used 6-month-old pigs in this study. These pigs are skeletally immature. Juvenile chondrocytes will react differently to temperature than adult chondrocytes. Third, the pellet culture system used in this study for providing the 3D environment is a simple method. However, when scaffolds such as alginate beads are used, or when they are exposed to hypoxic environment, the reaction to temperature may differ from that observed in this study. Fourth, the effects on other individual porcine cells and on other cell types that exist in the constituted synovial joint were not investigated. It has been reported that the metabolic reaction and the thermotolerance differ among cell types [30–32]. It is necessary to investigate its influence on cell types other than chondrocytes.
Conclusion We investigated the effects of culture temperature on ECM production by articular chondrocytes. Our results suggest that a culture temperature of approximately 41 C inhibits ECM production by decreasing the DNA content and perhaps by collagen misfolding. In addition, although maximum wet weight was observed at 32 C, the GAG/DNA at 32 C was lower than that at 37 C. Furthermore, the production domain of GAG and collagen changes with temperature. Although the optimum temperature for ECM production was not identified, this study indicated that ECM production at 32 C, which is the normal intra-articular temperature, was equivalent to that observed at 37 C. Taken together, we conclude that the optimum temperature for ECM production by articular chondrocytes may be between 32 C and 37 C.
DOI: 10.3109/02656736.2014.880857
Acknowledgements The authors wish to thank Rune Fujioka, Ryota Takaishi, Daisuke Inoue, and Taiki Hirose (Kyoto University, Kyoto) for their continuous support.
Declaration of interest This study was supported by Grant-in-Aid for Japan Society for the Promotion of Science Fellows (number 820130600018). The authors declare no competing interests associated with the manuscript.
References 1. Buckwalter JA, Mankin HJ. Articular cartilage: Tissue design and chondrocyte-matrix interactions. Instr Course Lect 1998;47: 477–86. 2. Sophia Fox AJ, Bedi A, Rodeo SA. The basic science of articular cartilage: Structure, composition, and function. Sports Health 2009; 1:461–8. 3. Kim HK, Moran ME, Salter RB. The potential for regeneration of articular cartilage in defects created by chondral shaving and subchondral abrasion. An experimental investigation in rabbits. J Bone Joint Surg Am 1991;73:1301–15. 4. Hayes Jr DW, Brower RL, John KJ. Articular cartilage. Anatomy, injury, and repair. Clin Podiatr Med Surg 2001;18:35–53. 5. Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L. Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med 1994;331: 889–95. 6. Grande DA, Halberstadt C, Naughton G, Schwartz R, Manji R. Evaluation of matrix scaffolds for tissue engineering of articular cartilage grafts. J Biomed Mater Res 1997;34:211–20. 7. Tuli R, Li WJ, Tuan RS. Current state of cartilage tissue engineering. Arthritis Res Ther 2003;5:235–8. 8. Fortier LA, Mohammed HO, Lust G, Nixon AJ. Insulin-like growth factor-I enhances cell-based repair of articular cartilage. J Bone Joint Surg Br 2002;84:276–88. 9. Fortier LA, Barker JU, Strauss EJ, McCarrel TM, Cole BJ. The role of growth factors in cartilage repair. Clin Orthop 2011;469: 2706–15. 10. Yokoo N, Saito T, Uesugi M, Kobayashi N, Xin KQ, Okuda K, et al. Repair of articular cartilage defect by autologous transplantation of basic fibroblast growth factor gene-transduced chondrocytes with adeno-associated virus vector. Arthritis Rheum 2005;52:164–70. 11. Steinert AF, Noth U, Tuan RS. Concepts in gene therapy for cartilage repair. Injury 2008;39:S97–113. 12. Falk MH, Issels RD. Hyperthermia in oncology. Int J Hyperthermia 2001;17:1–18. 13. Takahashi KA, Tonomura H, Arai Y, Terauchi R, Honjo K, Hiraoka N, et al. Hyperthermia for the treatment of articular cartilage with osteoarthritis. Int J Hyperthermia 2009;25: 661–7. 14. Dewhirst MW, Viglianti BL, Lora-Michiels M, Hanson M, Hoopes PJ. Basic principles of thermal dosimetry and thermal thresholds for tissue damage from hyperthermia. Int J Hyperthermia 2003;19: 267–94.
Optimum temperature for articular chondrocytes
101
15. Yarmolenko PS, Moon EJ, Landon C, Manzoor A, Hochman DW, Viglianti BL, et al. Thresholds for thermal damage to normal tissues: An update. Int J Hyperthermia 2011;27:320–43. 16. Oosterveld FG, Rasker JJ. Treating arthritis with locally applied heat or cold. Semin Arthritis Rheum 1994;24:82–90. 17. Sanchez-Inchausti G, Vaquero-Martin J, Vidal-Fernandez C. Effect of arthroscopy and continuous cryotherapy on the intra-articular temperature of the knee. Arthroscopy 2005;21:552–6. 18. Ito A, Aoyama T, Yamaguchi S, Zhang X, Akiyama H, Kuroki H. Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner. Ultrasound Med Biol 2012;38:1726–33. 19. Pelttari K, Steck E, Richter W. The use of mesenchymal stem cells for chondrogenesis. Injury 2008;39:S58–65. 20. Caron MM, Emans PJ, Coolsen MM, Voss L, Surtel DA, Cremers A, et al. Redifferentiation of dedifferentiated human articular chondrocytes: Comparison of 2D and 3D cultures. Osteoarthritis Cartilage 2012;20:1170–8. 21. Dewey WC, Hopwood LE, Sapareto SA, Gerweck LE. Cellular responses to combinations of hyperthermia and radiation. Radiology 1977;123:463–74. 22. Wheatley DN, Kerr C, Gregory DW. Heat-induced damage to HeLa-S3 cells: Correlation of viability, permeability, osmosensitivity, phase-contrast light-, scanning electron- and transmission electron-microscopical findings. Int J Hyperthermia 1989;5: 145–62. 23. Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 1986;883:173–7. 24. Peltonen L, Palotie A, Hayashi T, Prockop DJ. Thermal stability of type I and type III procollagens from normal human fibroblasts and from a patient with osteogenesis imperfecta. Proc Natl Acad Sci USA 1980;77:162–6. 25. Dexheimer V, Frank S, Richter W. Proliferation as a requirement for in vitro chondrogenesis of human mesenchymal stem cells. Stem Cells Dev 2012;21:2160–69. 26. Hojo T, Fujioka M, Otsuka G, Inoue S, Kim U, Kubo T. Effect of heat stimulation on viability and proteoglycan metabolism of cultured chondrocytes: Preliminary report. J Orthop Sci 2003;8: 396–9. 27. Tonomura H, Takahashi KA, Mazda O, Arai Y, Shin-Ya M, Inoue A, et al. Effects of heat stimulation via microwave applicator on cartilage matrix gene and HSP70 expression in the rabbit knee joint. J Orthop Res 2008;26:34–41. 28. Serrat MA, King D, Lovejoy CO. Temperature regulates limb length in homeotherms by directly modulating cartilage growth. Proc Natl Acad Sci USA 2008;105:19348–53. 29. Kocaoglu B, Martin J, Wolf B, Karahan M, Amendola A. The effect of irrigation solution at different temperatures on articular cartilage metabolism. Arthroscopy 2011;27:526–31. 30. Flour MP, Ronot X, Vincent F, Benoit B, Adolphe M. Differential temperature sensitivity of cultured cells from cartilaginous or bone origin. Biol Cell 1992;75:83–7. 31. Shui CX, Scutt A. Mild heat shock induces proliferation, alkaline phosphatase activity, and mineralization in human bone marrow stromal cells and Mg-63 cells in vitro. J Bone Miner Res 2001;16: 731–41. 32. Morrissey JJ, Higashikubo R, Goswami PC, Dixon P. Mild hyperthermia as a potential mechanism to locally enhance cell growth kinetics. J Drug Target 2009;17:719–23.
Copyright of International Journal of Hyperthermia is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
RESEARCH ARTICLE
Optimum temperature for extracellular matrix production by articular chondrocytes Akira Ito1,2, Tomoki Aoyama3, Hirotaka Iijima1, Momoko Nagai1, Shoki Yamaguchi1, Junichi Tajino1, Xiangkai Zhang1, Haruhiko Akiyama4, and Hiroshi Kuroki1 1
Department of Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, 2Research Fellow of Japan Society for the Promotion of Science, Tokyo, Japan, 3Department of Development and Rehabilitation of Motor Function, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan, and 4Department of Orthopaedic Surgery, Graduate School of Medicine, Gifu University, Gifu, Japan Abstract
Keywords
Purpose: The purpose of this study was to investigate the influence of temperature on the ability of the chondrocytes to produce extracellular matrix (ECM). Materials and methods: Articular chondrocytes were isolated from porcine knee joints. The chondrocytes were cultured at three different temperatures: 32 C, 37 C, and 41 C. The ability to produce ECM was assessed by gene expression analysis, histological, and biochemical evaluation in a pellet culture system. Results: Wet weight of the pellets generated after 21 days, was significantly heavier when cultured at lower temperatures. Picrosirius red staining, employed to evaluate collagen production, was higher at lower temperatures, and safranin-O staining, used to evaluate sulphated glycosaminoglycan (GAG), was lower at 32 C than at 37 C and 41 C. Collagen type IIA1 mRNA expression was markedly up-regulated at 41 C. However, picrosirius red staining was inhibited at 41 C. GAG and DNA content were measured by 1,9-dimethylmethylene blue (DMMB) assay and PicoGreenÕ assay, respectively. The GAG content per pellet was significantly low at 41 C compared to that at 32 C and 37 C. The DNA content per pellet was larger at lower temperatures. The GAG content normalised with the DNA content per pellet was significantly lower at 32 C compared to that at 37 C and 41 C. Conclusion: Our results suggest that a culture temperature of approximately 41 C inhibits ECM production by decreasing DNA content and perhaps by collagen misfolding. Taken together, the optimum temperature for ECM production in articular chondrocytes may be between 32 C and 37 C.
Articular chondrocytes, extracellular matrix production, optimum temperature
Articular cartilage is a hyaline cartilage that exists at the epiphysis of the articular joints. It is composed of a dense cartilaginous extracellular matrix (ECM) with sparse distribution of highly specialised cells called chondrocytes. The ECM is primarily composed of water, collagen, and proteoglycans. Collagen is the most abundant structural macromolecule in ECM, and it makes up about 60% of the dry weight of cartilage. Type II collagen represents 90–95% of the collagen in ECM and forms fibrils and fibres intertwined with proteoglycan aggregates. Proteoglycans consist of a protein core with one or more linear glycosaminoglycan (GAG) chains. Aggrecan, which is one of the major proteoglycans of the articular cartilage, occupies the interfibrillar space of the ECM and facilitates the osmotic properties of the cartilage [1,2]. In this manner, the ECM plays a role in cushioning the joint to facilitate smooth movements. However, the ECM of the
Address for correspondence: Hiroshi Kuroki, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Tel: +81-75-751-3963. Fax: +81-75-751-3909. E-mail: [email protected]
Received 30 May 2013 Revised 3 January 2014 Accepted 4 January 2014 Published online 5 February 2014
articular cartilage is an avascular tissue, and therefore it cannot be regenerated in advanced degeneration of the ECM [3,4]. Fortunately, recent developments in regenerative medicine support the ability to regenerate articular cartilage. Brittberg et al. [5] reported the autologous chondrocyte transplantation (ACT) method, in which chondrocytes isolated from noncontact autologous articular cartilage debris were expanded by monolayer culture, and were then transplanted into chondral lesion sites. It was thought that a scaffold offering a three-dimensional (3D) nutrient environment with growth factors is critical for the regeneration of the cartilaginous ECM in which the chondrocytes are transplanted by ACT. Therefore, extensive research is being carried out on artificial scaffolding [6,7], various growth factors [8,9], or transgenic therapy [10,11], to enhance the cartilaginous ECM production. However, safety and cost are significant hurdles in this process. Hence, clinically simpler and safer methods for enhancing ECM production during cartilage regeneration are still elusive. We assume that mild hyperthermia could be one of the promising candidates for enhancing ECM production.
20 14
Introduction
History
DOI: 10.3109/02656736.2014.880857
Hyperthermia has been applied in the treatment of malignant diseases [12]. Recently, hyperthermia has also been applied to treat the articular cartilage in osteoarthritis [13]. However, there are few studies that have investigated the threshold for thermal damage to articular cartilage or chondrocytes and the chronic consequences of thermal exposure, especially on regenerating cartilage [14,15]. Temperature is one of the most important factors for the survival and metabolism of all types of cells. Homeotherms keep their body temperature constant in order to maintain normal metabolism. However, some tissues such as the skin and articular cartilage are influenced by environmental temperature. The actual temperature in a mammalian knee joint, including that of humans, is approximately 32 C, which is 4–5 C lower than the inner body temperature [16,17], indicating that it is influenced by the environmental temperature. However, most of the in vitro studies on articular chondrocytes have been conducted at 37 C, which may not reflect the in vivo environment. The effects of thermal stimulus or intra-articular temperatures in the cartilaginous ECM production are still unclear. The purpose of this study was to investigate the influence of different temperatures employed for culture, on the ability of the chondrocytes to produce ECM. We hypothesised that cartilage ECM formation is significantly enhanced at 37 C, which is approximately the inner body temperature.
Materials and methods Chondrocyte isolation and expansion Two skeletally immature (6-month-old) pigs were purchased from a meat processor (Aotachikusan, Kyoto, Japan). Articular cartilage plugs were aseptically harvested from the femoral condyle of each pig by using a biopsy punch and kept separately. Chondrocytes were isolated as previously described [18]. The isolated cells were re-suspended in fresh Dulbecco’s modified Eagle medium/Ham’s F12 (DMEM/Ham’s F12, Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum (FBS, Hyclone, Logan, UT), 50 U/mL penicillin (Nacalai Tesque), and 50 mg/mL streptomycin (Nacalai Tesque), and were seeded in tissue culture dishes. The chondrocytes were expanded in a CO2 incubator (5% CO2, 37 C, 95% humidity) to obtain an adequate quantity of cells (2 passages). Pellet culture system To provide a 3D environment, a pellet culture system was used in this study. Pellet culture is widely used to evaluate chondrogenic potential and to study the signalling pathways involved in chondrogenesis [19,20]. The expanded chondrocytes were trypsinised and then washed with DMEM/Ham’s F12, resuspended with chondrogenic medium (chondrogenic basal medium, plus ITS + supplement, ascorbate, dexamethasone, L-glutamine, sodium pyruvate, proline, and GA-1000, Lonza, Walkersville, MD) supplemented with 10 ng/mL of recombinant human transforming growth factor-beta 3 (R&D Systems, Minneapolis, MN). Aliquots of 2.5 105 cells in 500 mL of the chondrogenic medium were centrifuged at 250 g for 5 min in 15 mL polypropylene conical tubes. The pelleted cells were pre-cultured at 37 C in a CO2 incubator
Optimum temperature for articular chondrocytes
97
(5% CO2, 95% humidity) for 3 days to form a spherical aggregate at the bottom of each tube. After pre-culture, these constructed pellets were cultured at three different temperatures: 32 C as normal intra-articular temperature, 37 C as inner body temperature, and 41 C as threshold temperature of mammalian cell survival [21,22]. The culture medium was changed every 3 days, and the pellets were harvested initially after 14 days to analyse the gene expression. After 21 days the pellets were harvested for analysing wet weight, histology, the GAG and DNA content. Total RNA extraction and real-time reverse transcription polymerase chain reaction (RT-PCR) The generated pellets were harvested after 14 days, and three pellets were pooled together and analysed as one sample. Total RNA was extracted using the RNeasy Mini Kit following the manufacturer’s protocol (Qiagen, Valencia, CA) and purified by RNase-free DNase on-column incubation. Extracted total RNA was tested for purity using a NanoDrop2000 (Thermo Scientific, Wilmington, MA), and then stored at 80 C until use. Real-time RT-PCR was performed as described previously [18]. Briefly, total RNA (100 ng) was reverse-transcribed to synthesise cDNA, and then real-time PCR was performed using the Applied Biosystems7500 Real-Time PCR System (Life Technologies Corporation, Carlsbad, CA). The PCR reaction was performed for 10 min at 95 C, followed by 40 amplification cycles (15 s at 95 C, 60 s at 60 C). The following target genes were examined (Table I): the chondrogenic markers collagen type IIA1 (COL2A1) and aggrecan, the dedifferentiation marker collagen type IA1 (COL1A1). Beta-actin was used as a housekeeping gene. The data obtained by real-time PCR were analysed by the comparative threshold cycle method. Briefly, the quantity of the target genes was normalised to that of beta-actin. The value of the calibration sample (the cells cultured at 32 C) was set to 1, and the values for each of the other conditions were shown relative to that of the calibration sample. Histochemical staining The wet weight of the generated pellets cultured at three different temperatures for 21 days were measured, and then fixed in 4% paraformaldehyde at 4 C overnight. These fixed pellets were dehydrated and embedded in paraffin, and 6-mm thick sections were prepared. To detect deposition of GAG and collagen, the sections were stained with safranin-O/fast green and picrosirius red, respectively (n ¼ 4). Measurement of the GAG and DNA content The total GAG content in the pellet was measured using a 1,9-dimethylmethylen blue (DMMB) colorimetric method [23]. Briefly, the pellets were digested in papain digestion solution at 60 C for 3 h and 20-mL aliquots of samples were mixed into 180 mL of DMMB reagent, and then the absorbance was measured at 530 nm. The papain-digested samples were also used for measuring DNA content by the Quant-iTÔ PicoGreenÕ assay (Invitrogen, Paisley, UK), following the manufacturer’s instructions. Briefly, 16 mL of each sample was added to 384 mL TE buffer, and the samples
98
A. Ito et al.
Int J Hyperthermia, 2014; 30(2): 96–101
Table I. Primer sequences for real-time RT-PCR.
COL2A1 COL1A1 aggrecan Beta-actin
Sense (50 –30 )
Antisense (50 –30 )
Length (bp)
GCTATGGAGATGACAACCTGGCTC CAGAACGGCCTCAGGTACCA GAATTTCCTGGCGTGAGAAC AAGCCAACCGTGAGAAGATG
CACTTACCGGTGTGTTTCGTGCAG CAGATCACGTCATCGCACAAC GGGGATGTTGCGTAAAAGAC TCCATCACGATGCCAGTG
256 101 107 124
Figure 1. Macroscopic observation and wet weight. (A) Representative photograph of the generated pellets cultured at 32 C, 37 C, and 41 C for 21 days. Scale bar, 1 mm, magnification 50. 32 C: n ¼ 5, 37 C: n ¼ 4, 41 C: n ¼ 5. (B) Wet weight of the pellets cultured at 32 C, 37 C, and 41 C for 21 days. Values represent the means and standard deviations. **p50.01, n ¼ 12.
were aliquoted in triplicate (100 mL) into a 96-well flat bottomed plate. To this, 100 mL PicoGreen reagent was added and the fluorescence of the samples was analysed at excitation and emission wavelengths of 485/535 nm using a fluorometer. Statistical analysis The gene expression (n ¼ 3), wet weight (n ¼ 12), GAG, DNA, and GAG/DNA (n ¼ 8) levels are expressed as means ± standard deviation (SD), and ‘n’ indicates the number of pellets obtained from one pig. In the gene expression analysis, to obtain sufficient amount of mRNA, three pellets were combined as one sample. Statistical significance was determined using one-way analysis of variance (ANOVA) with the post-hoc multiple comparison Tukey-Kramer test. The differences observed were considered to be significant if the P value was lower than 0.05. All experiments were repeated again using cells harvested from another pig to confirm the accuracy and reproducibility of the results, and similar results were confirmed (data not shown).
Results Wet weight Representative pellets generated at three different temperatures after 21 days culture are shown in Figure 1(A). These pellets showed an oval form, and seemed to be larger when the temperature was lower. Additionally, wet weight was also significantly heavier at the lower temperature (32 C: 0.84 mg ± 0.11, 37 C: 0.72 mg ± 0.08, 41 C: 0.51 mg ± 0.05) (Figure 1B).
Gene expression analysis The pellets were cultured for 14 days at three different temperatures and the mRNA expression of specific genes in the articular ECM was analysed. COL2A1 mRNA expression was markedly up-regulated at 41 C (9.96-fold compared to that at 32 C) (Figure 2A). There were no significant differences in the mRNA expression on COL1A1 (Figure 2B) and aggrecan (Figure 2C) between three different temperatures. Histological evaluation The pellets were cultured for 21 days at three different temperatures, and GAG and collagen production were assessed histologically. While safranin-O staining was observed in the peripheral zone in samples cultured at 32 C, staining in the central zone was low (Figure 3A). On the other hand, in samples cultured at 37 C, intense staining was detected, especially in the central zone (Figure 3C). At 41 C, staining with safranin-O was observed in the entire region (Figure 3E). Staining with picrosirius red at 32 C was observed in the entire region, especially in the superficial zone (Figure 3B). At 37 C, however, decreased staining was observed in the central zone, while distinct staining was observed in the peripheral zone (Figure 3D). At 41 C, decreased staining with picrosirius red was observed even in the peripheral zone, and was remarkably decreased in the central zone similar to that observed at 37 C (Figure 3F). GAG and DNA content The pellets were cultured for 21 days at three different temperatures, and the GAG and DNA content were
DOI: 10.3109/02656736.2014.880857
Optimum temperature for articular chondrocytes
99
Figure 2. Gene expression analysis. Relative mRNA expression of (A) COL2A1, (B) COL1A1, (C) Aggrecan of the pellets cultured at 32 C, 37 C, and 41 C for 14 days. Values represent the means and standard deviations. **p50.01, n ¼ 3 (n indicates one sample which contained a combination of 3 pellets harvested from one pig, i.e. 3 samples represent 9 pellets).
Discussion
Figure 3. Histological evaluation. Representative images of safranin-O/ fast green staining of the pellets cultured at (A) 32 C, (C) 37 C, (E) 41 C for 21 days, and representative images of picrosirius red staining of the pellets cultured at (B) 32 C, (D) 37 C, (F) 41 C for 21 days. Scale bar ¼ 500 mm, magnification 100, 32 C: n ¼ 5, 37 C: n ¼ 4, 41 C: n ¼ 5.
quantitatively analysed. The GAG content per pellet was significantly lower at 41 C compared to that at 32 C and 37 C (32 C: 7.92 mg ± 1.13, 37 C: 8.11 mg ± 0.58, 41 C: 5.24 mg ± 0.35) (Figure 4A). The DNA content was higher at lower temperatures (32 C: 0.72 mg ± 0.14, 37 C: 0.57 mg ± 0.07, 41 C: 0.36 mg ± 0.06) (Figure 4B). When the GAG content was normalised with the DNA content, the value was significantly lower at 32 C compared to that at 37 C and 41 C (32 C: 11.09 mg/mg ± 1.11, 37 C: 14.40 mg/mg ± 1.56, 41 C: 14.71 mg/mg ± 2.15) (Figure 4C).
In order to elucidate the effects of different temperatures on the ECM production of articular chondrocytes, we investigated chondrogenic gene expression, GAG, and collagen production by using a pellet culture system. Our results indicated that at temperatures between 32 C and 41 C, the wet weight of the generated pellet was greater at lower temperatures (Figure 1B). The production of the GAG and the collagen, which are the main structural contents of the cartilaginous ECM, was histologically assessed by safranin-O staining and picrosirius red staining, respectively. Staining with safranin-O at 32 C was low in the central zone (Figure 3A), whereas staining at 37 C was high in the central zone (Figure 3C). These results suggested that the GAG production domain would change with temperature. On the other hand, while staining with picrosirius red was observed in the entire region at 32 C (Figure 3B), staining at 37 C and 41 C was remarkably decreased in the central zone (Figures 3D and F). This suggests that the culture temperature could also affect the collagen production domain. Furthermore, staining with picrosirius red in the peripheral zone was decreased at 41 C compared to that at 32 C and 37 C, suggesting that collagen production is inhibited. However, in the gene expression analysis on the 14th day of cultivation, the expression of COL2A1 was upregulated at 41 C by approximately 10 times that at 32 C and 37 C (Figure 2A), and was not in agreement with the histological evaluation using picrosirius red staining. One of the reasons for this discrepancy is that the ECM might mainly consist of COL1 protein rather than COL2 protein. In this case, it might not be reflected in the histology even though the COL2A1 mRNA was up-regulated. Another reason for this discrepancy may be the potential inhibition of collagen production beyond a specific transcriptional threshold that may have arisen at 41 C. Peltonen et al. [24] reported that collagen cannot fold into a triple-helix conformation at a temperature of approximately 40 C. Although COL2A1 mRNA expression was up-regulated at 41 C, there is a possibility that appropriate folding of synthesised collagen was inhibited.
100
A. Ito et al.
Int J Hyperthermia, 2014; 30(2): 96–101
Figure 4. GAG and DNA content. (A) The GAG content per pellet and (B) the DNA content per pellet cultured at 32 C, 37 C, and 41 C for 21 days were analysed by DMMB assay and PicoGreen assay, respectively. (C) The GAG content normalised with the DNA content (GAG/DNA) was calculated to estimate the GAG production per chondrocyte. Values represent the means and standard deviations. *p50.05, **p50.01, n ¼ 8.
In order to quantitatively analyse GAG production, GAG and DNA content were analysed by DMMB and PicoGreen assay, respectively. Our results suggested that the GAG content per pellet was significantly less at 41 C compared to that at 32 C and 37 C (Figure 4A). In addition, the DNA content was higher at lower temperatures (Figure 4B). Furthermore, in order to estimate the GAG production per chondrocyte, the GAG content was normalised with the DNA content (GAG/DNA). Our results suggested that the value of GAG/DNA was significantly lower at 32 C compared to that at 37 C and 41 C (Figure 4C). From these results, although the GAG production ability per chondrocyte was lower at 32 C, it was thought that the GAG content per pellet was equivalent to 37 C since the pellet at 32 C was comprised of many cells. Furthermore, since there were fewer cells in the pellet at 41 C, the GAG content per pellet at 41 C was lower than that at 32 C and 37 C. The DNA content reflecting the number of cells decreased in a temperature-dependent manner. Dexheimer et al. [25] reported that about 50% of the human mesenchymal stem cells subjected to pellet culture were finally lost by apoptosis or other forms of cell death, and they concluded that the shift to high cell density and low nutrient and oxygen conditions could potentially facilitate cell loss. We speculate that the differences of the DNA content observed in this study were caused by the additional stress induced by the thermal environment. Several reports have suggested that intermittent mild heat stimulus (41 C) promoted ECM anabolism both in vitro [26] and in vivo [27]. Serrat et al. [28] also suggested that the chondrocyte proliferation and ECM volume are strongly correlated with tissue temperature in metatarsals cultured without vasculature in vitro. However, only a few studies have analysed the metabolic changes in chondrocytes at 32 C, which is the normal intra-articular temperature. Kocaoglu et al. [29] studied the effects of the irrigation fluid on the metabolism of articular chondrocytes at different temperatures. They assumed that the production of the ECM was higher at 32 C than at 4 C, 24 C, and 37 C, which is consistent with our wet weight and
picrosirius red staining results. On the basis of the GAG production, this study suggests that 32 C may not be the most optimum temperature for ECM production. However, this study also indicated that even at 32 C it is possible to produce equivalent ECM production similar to that produced at 37 C. We identified four limitations in this study. First, our results were obtained from in vitro experiments, and we did not validate the effects in vivo. Second, we used 6-month-old pigs in this study. These pigs are skeletally immature. Juvenile chondrocytes will react differently to temperature than adult chondrocytes. Third, the pellet culture system used in this study for providing the 3D environment is a simple method. However, when scaffolds such as alginate beads are used, or when they are exposed to hypoxic environment, the reaction to temperature may differ from that observed in this study. Fourth, the effects on other individual porcine cells and on other cell types that exist in the constituted synovial joint were not investigated. It has been reported that the metabolic reaction and the thermotolerance differ among cell types [30–32]. It is necessary to investigate its influence on cell types other than chondrocytes.
Conclusion We investigated the effects of culture temperature on ECM production by articular chondrocytes. Our results suggest that a culture temperature of approximately 41 C inhibits ECM production by decreasing the DNA content and perhaps by collagen misfolding. In addition, although maximum wet weight was observed at 32 C, the GAG/DNA at 32 C was lower than that at 37 C. Furthermore, the production domain of GAG and collagen changes with temperature. Although the optimum temperature for ECM production was not identified, this study indicated that ECM production at 32 C, which is the normal intra-articular temperature, was equivalent to that observed at 37 C. Taken together, we conclude that the optimum temperature for ECM production by articular chondrocytes may be between 32 C and 37 C.
DOI: 10.3109/02656736.2014.880857
Acknowledgements The authors wish to thank Rune Fujioka, Ryota Takaishi, Daisuke Inoue, and Taiki Hirose (Kyoto University, Kyoto) for their continuous support.
Declaration of interest This study was supported by Grant-in-Aid for Japan Society for the Promotion of Science Fellows (number 820130600018). The authors declare no competing interests associated with the manuscript.
References 1. Buckwalter JA, Mankin HJ. Articular cartilage: Tissue design and chondrocyte-matrix interactions. Instr Course Lect 1998;47: 477–86. 2. Sophia Fox AJ, Bedi A, Rodeo SA. The basic science of articular cartilage: Structure, composition, and function. Sports Health 2009; 1:461–8. 3. Kim HK, Moran ME, Salter RB. The potential for regeneration of articular cartilage in defects created by chondral shaving and subchondral abrasion. An experimental investigation in rabbits. J Bone Joint Surg Am 1991;73:1301–15. 4. Hayes Jr DW, Brower RL, John KJ. Articular cartilage. Anatomy, injury, and repair. Clin Podiatr Med Surg 2001;18:35–53. 5. Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L. Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med 1994;331: 889–95. 6. Grande DA, Halberstadt C, Naughton G, Schwartz R, Manji R. Evaluation of matrix scaffolds for tissue engineering of articular cartilage grafts. J Biomed Mater Res 1997;34:211–20. 7. Tuli R, Li WJ, Tuan RS. Current state of cartilage tissue engineering. Arthritis Res Ther 2003;5:235–8. 8. Fortier LA, Mohammed HO, Lust G, Nixon AJ. Insulin-like growth factor-I enhances cell-based repair of articular cartilage. J Bone Joint Surg Br 2002;84:276–88. 9. Fortier LA, Barker JU, Strauss EJ, McCarrel TM, Cole BJ. The role of growth factors in cartilage repair. Clin Orthop 2011;469: 2706–15. 10. Yokoo N, Saito T, Uesugi M, Kobayashi N, Xin KQ, Okuda K, et al. Repair of articular cartilage defect by autologous transplantation of basic fibroblast growth factor gene-transduced chondrocytes with adeno-associated virus vector. Arthritis Rheum 2005;52:164–70. 11. Steinert AF, Noth U, Tuan RS. Concepts in gene therapy for cartilage repair. Injury 2008;39:S97–113. 12. Falk MH, Issels RD. Hyperthermia in oncology. Int J Hyperthermia 2001;17:1–18. 13. Takahashi KA, Tonomura H, Arai Y, Terauchi R, Honjo K, Hiraoka N, et al. Hyperthermia for the treatment of articular cartilage with osteoarthritis. Int J Hyperthermia 2009;25: 661–7. 14. Dewhirst MW, Viglianti BL, Lora-Michiels M, Hanson M, Hoopes PJ. Basic principles of thermal dosimetry and thermal thresholds for tissue damage from hyperthermia. Int J Hyperthermia 2003;19: 267–94.
Optimum temperature for articular chondrocytes
101
15. Yarmolenko PS, Moon EJ, Landon C, Manzoor A, Hochman DW, Viglianti BL, et al. Thresholds for thermal damage to normal tissues: An update. Int J Hyperthermia 2011;27:320–43. 16. Oosterveld FG, Rasker JJ. Treating arthritis with locally applied heat or cold. Semin Arthritis Rheum 1994;24:82–90. 17. Sanchez-Inchausti G, Vaquero-Martin J, Vidal-Fernandez C. Effect of arthroscopy and continuous cryotherapy on the intra-articular temperature of the knee. Arthroscopy 2005;21:552–6. 18. Ito A, Aoyama T, Yamaguchi S, Zhang X, Akiyama H, Kuroki H. Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner. Ultrasound Med Biol 2012;38:1726–33. 19. Pelttari K, Steck E, Richter W. The use of mesenchymal stem cells for chondrogenesis. Injury 2008;39:S58–65. 20. Caron MM, Emans PJ, Coolsen MM, Voss L, Surtel DA, Cremers A, et al. Redifferentiation of dedifferentiated human articular chondrocytes: Comparison of 2D and 3D cultures. Osteoarthritis Cartilage 2012;20:1170–8. 21. Dewey WC, Hopwood LE, Sapareto SA, Gerweck LE. Cellular responses to combinations of hyperthermia and radiation. Radiology 1977;123:463–74. 22. Wheatley DN, Kerr C, Gregory DW. Heat-induced damage to HeLa-S3 cells: Correlation of viability, permeability, osmosensitivity, phase-contrast light-, scanning electron- and transmission electron-microscopical findings. Int J Hyperthermia 1989;5: 145–62. 23. Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 1986;883:173–7. 24. Peltonen L, Palotie A, Hayashi T, Prockop DJ. Thermal stability of type I and type III procollagens from normal human fibroblasts and from a patient with osteogenesis imperfecta. Proc Natl Acad Sci USA 1980;77:162–6. 25. Dexheimer V, Frank S, Richter W. Proliferation as a requirement for in vitro chondrogenesis of human mesenchymal stem cells. Stem Cells Dev 2012;21:2160–69. 26. Hojo T, Fujioka M, Otsuka G, Inoue S, Kim U, Kubo T. Effect of heat stimulation on viability and proteoglycan metabolism of cultured chondrocytes: Preliminary report. J Orthop Sci 2003;8: 396–9. 27. Tonomura H, Takahashi KA, Mazda O, Arai Y, Shin-Ya M, Inoue A, et al. Effects of heat stimulation via microwave applicator on cartilage matrix gene and HSP70 expression in the rabbit knee joint. J Orthop Res 2008;26:34–41. 28. Serrat MA, King D, Lovejoy CO. Temperature regulates limb length in homeotherms by directly modulating cartilage growth. Proc Natl Acad Sci USA 2008;105:19348–53. 29. Kocaoglu B, Martin J, Wolf B, Karahan M, Amendola A. The effect of irrigation solution at different temperatures on articular cartilage metabolism. Arthroscopy 2011;27:526–31. 30. Flour MP, Ronot X, Vincent F, Benoit B, Adolphe M. Differential temperature sensitivity of cultured cells from cartilaginous or bone origin. Biol Cell 1992;75:83–7. 31. Shui CX, Scutt A. Mild heat shock induces proliferation, alkaline phosphatase activity, and mineralization in human bone marrow stromal cells and Mg-63 cells in vitro. J Bone Miner Res 2001;16: 731–41. 32. Morrissey JJ, Higashikubo R, Goswami PC, Dixon P. Mild hyperthermia as a potential mechanism to locally enhance cell growth kinetics. J Drug Target 2009;17:719–23.
Copyright of International Journal of Hyperthermia is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
