GENOMICS

9,

445-445

(1’391)

Organization and Nucleotide Sequences of the Human Tyrosinase Gene and a Truncated Tyrosinase-Related Segment LUTZ Departments

of Medical

B. GIEBEL, KATHLEEN M. STRUNK, AND RICHARD A. SPRITZ’

Genetics and Pediatrics, 309 Laboratory Received

May

14,

1990.

of Genetics, University of Wisconsin, Madison, revised

the gene encoding human tyrosinase, the key enzyme in pigment biosynthesis. The human tyrosinase gene contains five exons and spans more than 50 kb of DNA on chromosome segment llq14+q21. We have also isolated a second segment in the human genome that is closely related to tyrosinase. The tyrosinase-related segment, located on 1 lpl l.Z+cen, contains only exons 4 and 5 plus adjacent noncoding regions. This segment is present in all human ethnic groups analyzed, and the noncoding nucleotide sequences shared by the llq tyrosinase gene and the llp tyrosinase-related segment differ by only 2.6%. This suggests that this segment of the tyrosinase gene was duplicated approximately 24 million years ago. !i‘ issi Academic press. IN.

AND

Isolation and Characterization Genomic Clones

METHODS of Human Tyrosinase

Several different normal human genomic phage libraries were screened by plaque hybridization (Benton and Davis, 1977) using as probe 32P-radiolabeled pMEL34 (Kwon et al., 1987), an almost full-length human tyrosinase cDNA.’ Nitrocellulose filters were prehybridized in 5% nonfat dry milk for 60 min at 42°C and hybridized in 6X SSC, 5~ Denhardt’s solution, 10 mM EDTA, and 0.5% SDS for 20 h at 68°C. Filters were washed twice in 2~ SSC, 0.1% SDS for 30 min at 68°C and autoradiographed. At least 10 independent human tyrosinase recombinant phage were isolated. Mapping of these recombinants using as probes PCR fragments corresponding to each of the five tyrosinase exons (Table 1, primers P7-P16) showed that they contained exons 1,3,4, and 5 (Fig. 1). Cosmid 7H3, containing tyrosinase exons 1 and 2, was the generous gift of Dr. D. Kaufman. Convenient restriction fragments containing each of the five exons were subcloned into plasmid Bluescript KS M13(+) (Stratagene, La Jolla, CA). Initial DNA sequence analysis of the plasmid sub-

Tyrosinase (monophenol monooxygenase; monophenol+dopa:oxygen oxidoreductase; EC 1.14.18.1) is a copper-containing enzyme that catalyzes the first two reactions in the melanin biosynthetic pathway: the hydroxylation of tyrosine to dihydroxyphenylalanine (dopa) and the subsequent oxidation of dopa to dopaquinone (reviewed by Witkop et al., 1989). Human tyrosinase cDNA clones have recently been described, and the sequence of the 529-amino-acid polypeptide has been deduced (Kwon et al., 1987; Shibahara et al., 1988; Bouchard et al., 1989). This has made possible the identification of tyrosinase gene mutations in several patients with the classic, tyrosinase-negative (type IA) form of oculocutaneous albinism (Tomita et al., 1989; Giebel et al., 1990; Kikuchi et al., 1990; Spritz et al., 1990, 1991), in whom defective melanin biosynthesis results from deficient tyrosinase activity in pigment cells (reviewed in King and Summers, 1988; Witkop et al., 1989). The human tyrosinase gene has been localized to the long arm of

should

1990

MATERIALS

INTRODUCTION

correspondence

26.

chromosome 11, to chromosome segment llq14+ 921, and a second “tyrosinase-related” sequence mapped to the short arm of chromosome 11, to segment llpll.2+cen (Barton et al., 1988). In this paper we describe the cloning and sequence analysis of the human tyrosinase genomic locus. We also define the structure of the tyrosinase-related segment and show that it consists only of t,yrosinase exons 4 and 5.

We have isolated and sequenced

’ To whom

October

Wisconsin 53706

’ Abbreviations used: AMV, avian myeloblastosis virus; BSA, bovine serum albumin; CAMP, cyclic AMP; cDNA, DNA complementary to mRNA; DTT, dithiothreitol; MSH, melanocyte stimulating hormone; nt, nucleotide(s); PCR, polymerase chain reaction: SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCI, 0.015 M Na, . citrate, pH 7-8; TK, thymidine kinase.

he addressed. 435

All

Copyright icl 1991 rights of reproduction

by Academic Press, Inc. in any form reserved.

GIEBEL. WRIINK,

436

clones was performed by double-stranded DNA sequencing (Zhang et al., 1988) using primers derived from the sequences of the exons (Kwon et al., 1987; Spritz et al., 1990). These data were then used to derive reverse sequencing primers (not shown) for the flanking and intervening sequences. Accordingly, the great majority of the sequences shown in Fig. 2, including bases l-1562 (exon l), 1644-2068 (exon 2), 2153-2489 (exon 3), 2514-2861 (exon 4), 2963-3680 (exon 5), and the homologous “exon 4” and “exon 5” sequencesof the llp tyrosinase-related segment, were determined completely on both DNA strands, whereas the remaining sequences were derived by at least two determinations of one strand. DNA sequences were analyzed by computer using the DNASTAR (Madison, WI) software package. Cell Lines

Cell line VIIBHAT is a mouse 3T3 (TK-)/human fibroblast hybrid in which the only human segment is a marker chromosome (17pter-+l7q2l::llpl5-+ llcen; Barton et al., 1988). Cell lines XXI-22A-c-2c and XXI-54B-lj are hybrid subclones derived from fusions between human fibroblasts carrying a balanced t(11;15)(pIl.2;p12) translocation and Chinese hamster Don/a3 (TK-) cells. Subclone XXI-22A-c-2c contains the der(ll)(l5pter-+15pl2::llp11.2+ llqter) chromosome and XXI-54B-lj contains the der(l5)(llpter-+llpll.2::15pl2+l5qter) chromosome (Barton et al., 1988). FME is a human melanotic melanoma cell line (Tveit et al., 1980). Southern

Blot Analysis

Genomic DNAs (15 pug)from human, mouse (Balb/ c), and the mouse/human hybrid cell line VIIBHAT were digested with HindIII, fractionated in an 0.8% agarose gel, and transferred to a nitrocellulose filter. The filter was hybridized in 6X SSC, 3~ Denhardt’s, 0.5% SDS, and 200 hg/ml denatured sonicated salmon sperm DNA for 20 h at 68°C using as probe a mixture of 32P-radiolabeled PCR fragments corresponding to tyrosinase exons 1, 2, and 3. Filters were washed twice in 3~ SSC, 0.1% SDS for 30 min at 68°C and twice in 0.5~ SSC, 0.1% SDS for 30 min at 68’C. Preparation

of cDNA

Complementary DNA was synthesized from 10 pug FME total cellular RNA in 40 ~1 of a solution containing 50 mM Tris-HCl, pH 8.3,50 mM KCl, 10 mA4 MgCl,, 1 n&f DTT, 1 mM EDTA, 10 pug/ml BSA, 0.5 mA4 spermidine, 4 mM Na pyrophosphate, 1 mM of each dNTP, 500 ng of oligo(dT),,_,,, 40 U ribonuclease inhibitor, and 10 U AMV reverse transcriptase (Promega, Madison, WI) for 45 min at 42°C.

AND SPRITZ Polymerase

Chain

Reaction

Oligonucleotide 20-mer primers (Table 1, primers Pl-P16) were used to amplify the corresponding gene fragments from 0.1-l pg of genomic DNA or 5 ng of cloned human tyrosinase cDNA (pMEL34; Kwon et al.. 1987). Forty cycles of PCR were performed in 100. ~1 volumes of 10 mM Tris-HCl, pH 8.3, 50 mM KCI, 1.5 mM MgCl,, 200 &J4 of each dNTP, 100 pg/mI gelatin, 100 pmol of each primer, and 2.5 U Tay DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) using an automated thermal cycler (Coy Laboratory Products Inc., Ann Arbor, MI). Each cycle consisted of 30 s at 94”C, 1 min at 5O”C, and 2 min at 72°C (Saiki et al., 1988). Primer

Extension

Primer extension was performed according to Kingston (1989), using 20 pg FME total cellular RNA and an antisense 20-mer oligonucleotide (5’-GGAGACACAGGCTCTAGGGA-3’; see Fig. 2, position 730-749). The extension products were analyzed by electrophoresis through a 6% denaturing polyacrylamide gel and autoradiography. RESULTS Isolation

of Human

Tyrosinase

Genomic

Clones

A human tyrosinase cDNA (Kwon et al., 1987) was used to screen several different human genomic recombinant phage libraries. At least 10 independent recombinants were isolated and mapped by separate hybridizations with probes specific for each of the five exons of the tyrosinase gene. As shown in Fig. 1, the clones contained either one or two tyrosinase exons. These were XhTyr34 (exon 1); XhTyrE (exon 3); hhTyr52 (exons 3 and 3); XhTyr21, hhTyr54, and XhTyr78 (all exon 4); and XhTyrl4 (exons 4 and 5). A number of other recombinants contained only exon 5, but were not characterized further. Several additional independent recombinants, including hhTyrl3 and XhTyrl6, contained sequences very similar to those of exon 4 and/or exon 5 of tyrosinase that derived from the truncated tyrosinase-related segment on 1lp (see below). None of the phage recombinants that we isolated contained any exon 2 sequences. However, cosmid clone 7H3 contained tyrosinase exons 1 and 2. Restriction endonuclease mapping of recombinant phage 21, 34, 52, 54, 78, 141, and cosmid 7H3 (Fig. 1) enabled us to estimate the sizes of three of the four tyrosinase intervening sequences. IVSl is 5-27 kb, IVS3 is approximately 9 kb, and IVS4 is approximately 10 kb in size. A gap within IVSB, not covered by any of the clones isolated, prevents our estimation of the size of this TVS.

HUMAN

TYROSINASE

AND

TYROSINASE-RELATED

k----l

AhTyrE hhTyr21

I hhTyr54 r cosTyr7H3

t-------

e--w------(

hhTyr34

FIG. 1. Map of the human tyrosinase positions of the recombinant tyrosinase was not determined.

Nucleotide

437

LOCI

4 4

AhTyr78

4 t

hhTyrl4

I

hhTyr52

gene and truncated phage and cosmid

pseudogene segment. Boxes denote exons. The size of IV%? is not known. The clones are shown. Dashed lines indicate that the precise position and/or extent

Sequence Analysis

The nucleotide sequence of the human tyrosinase gene is shown in Fig. 2. The sequences of the five exons are identical to the tyrosinase cDNA sequence report,ed by Shibahara et al. (1988). However, there are some minor differences between the sequence we determined and those reported by other groups. Position 1246 can be either cytosine (our data; Shibahara et al., 1988) or adenine (Kwon et al., 1987; Bouchard et al., 1989); therefore, codon 192 can encode either a serine (TCT) or a tyrosine (TAT) residue. We have recently shown that this sequence difference is a common polymorphism in Caucasians (Giebel and Spritz, 1990). Similarly, position 2625 can be either a guanine (our data; Shibahara et al., 1988; Bouchard et al., 1989) or an adenine (Kwon et al., 1987); therefore, codon 402 can encode either an arginine (CGA) or a glutamine (CAA) residue. We have found that this is also a common polymorphism in Caucasians (unpublished data). The sequence of the 5’ flanking region is identical to those previously reported for human tyrosinase 5’ flanking sequences (Kikuchi et al., 1989; Takeda et al., 1989), with the exception that Kikuchi et al. (1989) reported an additional cytosine residue between nucleotide positions 13 and 14 (see Fig. 2). We have confirmed the sequence shown in Fig. 2 in seven unrelated patients with type I oculocutaneous albinism (unpublished data); therefore, this difference represents either an error in the partial sequence of Kikuchi et al. (1989) or a polymorphism in the Japanese population. We have also identified a group of three differences in the 5’ flanking sequences: the presence or absence of a thymine at position 74, a guanine versus cytosine at position 139, and a cytosine versus

guanine at position 391 (unpublished data). These three differences typically segregate together as a common two-allele polymorphism in Caucasians:-, g, c versus t, c, t; no other combinations have been seen. Comparison of the complete sequence shown in Fig. 2 with the GenBank (r) DNA sequence database (Release 63) identified significant homology only to mammalian tyrosinase cDNAs. Comparison of the tyrosinase polypeptide sequence with the NBRF-PIR (r) protein sequence database identified major homology only to mammalian and Streptomyces tyrosinases and the mouse B-locus protein (Shibahara et al., 1986), and very little to Neurospora tyrosinase. Minor but significant homology to hemocyanin and cytochrome-c oxidase polypeptides, which also are copper-binding proteins, was identified. Tyrosinase expression is stimulated in uivo by a number of factors, including tyrosine, dopa, CAMP, MSH (via CAMP), and phorbol esters. Therefore, we searched for a number of sequence motifs that constitute putative promoter elements (reviewed in Mitchell and Tjian, 1989; Forman and Samuels, 1990; Polyanovsky and Stepchenko, 1990) using the DNASTAR Patterns program. Within the 5’ flanking region, four TATA motifs were found, at positions 95, 126, 561, and 563. The position 95 and 561 TATA motifs both fit the more extended TATA$A$ consensus, but only the double TATA motif at position 561/ 563 occurs in proximity to the observed transcriptional start sites, at positions 592, 597, and 626 (see below). One CPl motif (CCAAT) was found, at position 468; this also conforms to the binding site for CTF/NFl (GCCAAT). Computer search of both strands of the entire sequence found one SPl motif (GGGCGG), within exon 5 at position 3122. No sequences corresponding even to an extremely broad

GIEBEL.

438

STRUNK,

AND SPRITZ

gttatcaaagtgagctatccttaggagttgtcagaaaatgcatcaggattatcagagaaaagtatcagaaaga~tttttttttctgatacgttgtataaa

100

ataaacaaactgaaattcaataacatataaggaattct~tctgggctctgaagacaatctctctctgcatattgagttcttcaaacattgtagcctcttt

200

atggtctctgagaaataactaccttaaacccataatctttaatacttcctaaactttcttaataagagaagctctattcctgacactacctctcatttgc

300

aaggtcaaatcatcattagttttgtagtctattaactgggtttgcttaggtcaggcattattattactaaccttattgttaatattctaa~cataagaat

400

taaactattaatggtgaatagagtttttcactttaacataggcctatcccactggtgggatacgag~tcgaaagaaaagtcagtcatgtgcttttc

500

agaggatgaaagcttaagataaagactaaaagtgtttgatgctggaggtgggagtggtattatataggt~tcagcc~agac~tgtgataat~actg~agt

600

agtagctggaaagagaaatctgtga~t~caattagccagttcctgcagaccttgtgagga~tagaggaagaATGCTCCTGGCTGTTTTGTACTGCCTGCT

700 10

MetLeuLeuAlaValLeuTyrCysLeuLe GTGGAGTTTCCAGACCTCCGCTGGCCATTTCCCTAGAGCCTGTGTCTCCTCTAAGAACCTGATGGAGAAGGAATGCTGTCCACCGTGGAGCGGGGACAGG uTrpSerPheGlnThrSerAlaGlyHisPheProArgAlaCysValSerSerLysAsnLeuMetGluLysGluCysCysProProTrpSerGlyAspArg

800 43

AGTCCCTGTGGCCAGCTTTCAGGCAGAGGTTCCTGTCAGAATATCCTTCTGTCCAATGCACCACTTGGGCCTCAATTTCCCTTCACAGGGGTGGATGACC SerProCysGlyGlnLeuSerGlyArgGlySerCysGlnAsnIleLeuLeuSerAsnAlaProLeuGlyProGlnPheProPheThrGlyValAspAspA

900 77

GGGAGTCGTGGCCTTCCGTCTTTTATAATAGGACCTGCCAGTGCTCTGGCAACTTCATGGGATTCAACTGTGGAAACTGCAAGTTTGGCTTTTGGGGACC rgGluSerTrpProSerValPheTyrAsnArgThrCysGlnCysSerGlyAsnPheMetGlyPheAsnCysGlyAsnCysLysPheGlyPheTrpGlyPr

1000 110

AAACTGCACAGAGAGACGACTCTTGGTGAGAAGAAACATCTTCGATTTGAGTGCCCCAGAGAAGGACAAATTTTTTGCCTACCTCACTTTAGCAAAGCAT oAsnCysThrGluArgArgLeuLeuValArgArgAsnIlePheAspLeuSerAlaProGluLysAspLysPhePheAlaTyrLeuThrLeuAlaLysHis

1100 143

ACCATCAGCTCAGACTATGTCATCCCCATAGGGACCTATGGCCAAATGAAAAATGGATCAACACCCATGTTTAACGACATCAATATTTATGACCTCTTTG ThrIleSerSerAspTyrVallleProlleGlyThrTyrGlyGlnMetLysAsnGlySerThrProMetPheAsnAspIleAsnIleTyrAspLeuPheV

1200 177

TCTGGATGCATTATTATGTGTCAATGGATGCACTGCTTGGGGGAT~TGAAATCTGGAGAGACATTGATTTTGCCCATGAAGCACCAGCTTTTCTGCCTTG

1300

alTrpMetHisTyrTyrValSerMetAspAlaLeuLeuGlyGlySer

TyrGluIleTrpArgAspIleAspPheAlaHisGluAlaProAlaPheLeuProTr

210

GCATAGACTCTTCTTGTTGCGGTGGGAACAAGAAATCCAGAAGCTGACAGGAGATGAAAACTTCACTATTCCATATTGGGACTGGCGGGATGCAGAAAAG pHisArgLeuPheLeuLeuArgTrpGluGlnGluIleGlnLysLeuThrGlyAspGluAsnPheThrIleProTyrTrpAspTrpArgAspAlaGluLys

1400

TGTGACATTTGCACAGATGAGTACATGGGAGGTCAGCACCCCACAAATCCTAACTTACTCAGCCCAGCATCATTCTTCTCCTCTTGGCAGgtaagatatg CysAspIleCysThrAspGluTyrMetGlyGlyGlnHisProThrAsnProAsnLeuLeuSerProAlaSerPhePheSerSerTrpGln

lSO0

243 273 273

ctagatatacgatgtcagagtagggaggaaccttaacaatcacttcttcaggcagggtataaacttctcacctgaacactcattgcagcccccatcaagg

1600

acagaaatggtgccctgttaagaactctcaa-----/

1679

5-27

kb

/-----tgtagtaatctcctcaggagaagtctaacaacgataattaggagttcc

aacatttctgccttctcctactgactcagtggtggtgacaatttgtttaacatgagggtgttttgtacagATTGTCTGTAGCCGATTGGAGGAGTACAAC

1779 IleValCysSerArgLeuGluGluTyrAsn

283

274 AGCCATCAGTCTTTATGCAATGGAACGCCCGAGGGACCTTTACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTTCAGCTG SerHisGlnSerLeuCysAsnGlyThrProGluGlyProLeuArgArgAsnProGlyAsnHisAspLysSerArgThrProArgLeuProSerSerAlaA

1879

ATGTAGAATTTTGCCTGAGTTTGACCCAATATGAATCTGGTTCCATGGATAAAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGgtaatctctttct spValGluPheCysLeuSerLeuThrGlnTyrGluSerGlySerMetAspLysAlaAlaAsnPheSerPheArgAsnThrLeuGluG

1979

283

346 346

tttcacttttaattttttttctgaattcatatttacagtctcttatccaaagtcctaggaggtatttgagaattcagaatttctgagttgaccaagaata

2079

tgtgttgtatatactt-----/

2158

unknown

/-----gggccatttaattccacaaatatttattgaatacacactgggtatccagaatgtaaagagtct

caatacggaatgaattttatttttgattttatattttgaaacagtcttcaagttatagttataaatcaaatgggataatcacataggttttcagtcatta

2258

aagtaaacatatttttttcatttttttttaatgaacagGATTTGCTAGTCCACTTACTGGGATAGCGGATGCCTCTCAAAGCAGCATGCACAATGCCTTG lyPheAlaSerProLeuThrGlyIleAlaAspAlaSerGlnSerSerMetHisAsnAlaLeu

2358

366

346 CACATCTATATGAATGGAACAATGTCCCAGGTACAGGGATCTGCCAACGATCCTATCTTCCTTCTTCACCATGCATTTGTTGACAGgttggttaatattt HisIleTyrMetAsnGlyThrMetSerGlnValGlnGlySerAlaAsnAspProIlePheLeuLeuHisHisAlaPheValAspSe

2458

395 395

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..-..... ctttataaataacgtgctcattggatttaaa-----/

-9

kb

/-----aacatctttccatgtctccagattttaatatatgccttattttactttaa

TRS 2539

HUMAN

TYROSINASE

AND

. ..a.................................................c

TYROSINASE-RELATED

439

LOCI

. ..-........................................

1.

aaa-ttttcaaatgtttcttttatacacaatatgtttcttagtctgaataaccttttcctctgcagTATTTTTGAGCAGTGGCTCC~AAGGCACCGTCCT

TRS 2638

rIlePheGluGlnTrpLeu$[~ArgHisArgPro

406

395 MSPl . . . . . . . . . . . . . . . . .G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CTTCAAGAAGTTTATCCAGAAGCCAATGCACCCATTGGACATAACCGGGAATCCTACATGGTTCCTTTTATACCACTGTACAGAAATGGTGATTTCTTTA LeuGlnGluValTyrProGluAlaAsnAlaProIleGLyHisAsnArgGluSerTyrMetValProPheIleProLeuTyrArgAsnGlyAspPhePheI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..c......a......................... TTTCATCCAAAGATCTGGGCTATGACTATAGCTATCTACAAGATTCAGgtaaagtttactttctttcagaggaattgctgaatctagtgttaccaattta LeSerSerLysAspLeuGlyTyrAspTyrSerTyrLeuGlnAspSerA

TRS 2738

440 TRS 2838

456

456 . ..a................... ttttgagataacacaaaacttta-----/

. . . . . ..g.......-............a.....---.a...*..---......... -10

kb /-----ttttctgatgaagaaactgaggctttggtgtattaggtgtaactttcccaagctctt

TRS 2918

t . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..c.......................................... . . ..c................... acagttaataagtagtagagctggccttcaaacccaggtgtctactccaaaggactgtgaaaggatgaagatgatggtgatcgtaacaatggtggtaaca

TRS 3018

_....................................................................................~.............. ataaaaacaatgggatgtctttttatttcagACCCAGACTCTTTTCAAGACTACATTAAGTCCTATTTGGAACAAGCGAGTCGGATCTGGTCATGGCTCC spProAspSerPheGlnAspTyrIlelysSerTyrLeuGluGlnAlaSerArgIleTrpSerTrpLeuL

TRS 3118

479

456 NcoI . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..-............. TTGGGGCGGCGATGGTAGGGGCCGTCCTCACTGCCCTGCTGGCAGGGCTTGTGAGCTTGCTGTGTCGTCACAAGAGAAAGCAGCTTCCTGAAGAAAAGCA euGlyAlaAlaMetValGlyALaValLeuThrAlaLeuLeuAlaGlyLeuValSerLeuLeuCysArgHisLysArgLysGlnLeuProGluGluLysGl _..~~~*.....~.....‘~.*...*~*~...*....~*.......~..*.~...**....*.....*.........~.~...*...*.__.**_*.~*. GCCACTCCTCATGGAGAAAGAGGATTACCACAGCTTGTATCAGAGCCATTTATAAaaggcttaggcaatagagtagggccaaaaagcctgacctcactct nProLeuLeuMetGluLysGluAspTyrHisSerLeuTyrGlnSerHisLeuTER

TRS 3218

512 TRS 3318

529

529 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..a...............................................a........... aactcaaagtaatgtccaggttcccagagaatatctgctggtatttttctgtaaagaccatttgcaaaattgtaacctaatacaaagtgtagccttcttc

TRS 3418

. . . . . . . . . . . . . ..g...................~...........................~...........................c........ caactcaggtagaacacacctgtctttgtcttgctgttttcactcagcccttttaacattttcccctaagcccatatgtctaaggaaaggatgctatttg

TRS 3518

. . . . . . . . . . . . . . . ..c......................ttc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..a.. gtaatgaggaactgttatttgtatgtgaattaaagtgctc---ttattttaaaaaattgaaataattttgatttttgccttctgattatttaaagatcta

TRS 3615

.*................_-......***_--............. tatatgttttattggccccttctttattttaataaaacagtgagaaatctacattaactgactcctttaggcttcagaaacacatttttattctcttcag

TRS 3715

aaaggatgatattccc

3731

FIG. 2. Nucleotide sequences of the human tyrosinase gene and llp tyrosinase-related segment. Uppercase, exon sequences; lowercase, flanking and intervening sequences. The DNA sequence of the llp tyrosinase-related segment (TRS) is indicated over and the deduced amino acid sequence of the tyrosinase polypeptide is indicated under the DNA sequence of the tyrosinase gene. Dots above the tyrosinase gene sequence denote identical nucleotides in the llp tyrosinase-related segment. Nucleotide and amino acid positions are numbered to the right of each line. The positions of intervening sequences are also indicated under the amino acid sequence. Letters denote divergent bases and dashes denot.e absent bases. The double TATA motif (position 561/563), CCAAT motif (position 468), and potential polyadenylation signals (AAUAAA, position 3646 and AAUUAAA, position 3546) are underlined. Polymorphic bases and amino acids are indicated. Asterisks indicate transcription start sites. The MspI and NcoI sites unique to the tyrosinase-related segment are shown.

consensus for the TPA/cAMP stimulatory factor CREB (I!$GTE) were found on either strand in the 5’ flanking region, and no potential binding sites for the TPA/cAMP stimulatory factor AP-2 (CCCCAGGC) were found on either strand of the entire sequence. In addition, no potential binding sites were found on either strand of the entire sequence for transcription factors OTF-l/OTF-2 [OCT-l/OCT-21 (ATTTGCAT), AP-1 (TGAETZA), COUP-TF (GTCAAAGGTCA), C/EBP (TGTGGAAAG), KBFl (GGGGATTCCCCAT), and SRF (GATGTC-

CATATTAGGACATC) or the glucocorticoid receptor (GGTACANNNTGTTCT), steroid receptor (AGAACANNNTGTTCT), thyroid/retinoid receptor (AGGTCATGACCT), or estrogen receptor (AGGTCANNNTGACCT). The site at which tyrosinase mRNA is polyadenylated has not been determined experimentally. All of the reported human tyrosinase cDNAs lack a poly(A) tail (Kwon et al., 1987; Shibahara et al., 1988; Bouchard et al., 1989) and the most extensive is colinear with the sequence shown in Fig. 2 to position 3571.

440

GIEBEI,,

STRUNK,

TABLE Oligonucleotide

Primers

Oligonucleotide

AND

SPRITZ

1

Used for DNA

Position

Amplification

in Fig. 2

Sequence

amplified

P1:5’-ACAATATGTTTCTTAGTCTGX P2:5’-TTGGTAACACTAGATTCAGC-3’

2565-2584 2815-2834”

Exon

4 plus adjacent

regions

P3:5’-CTCCAAAGGACTGTGAAAGGX P4:5’-GGAGTCAGTTAATGTAGATTX’

296S2982 3662-3681”

Exon

5 plus adjacent

regions

P5:5’-TATTTTTGAGCAGTGGCTN-:? P6:5’-ATAAGAGCACTTTAATTCAC:?

260.5-‘2624 3544-3563”

Exon

4 plus exon

P7:5’-ATGCTCCTGGCTGTTTTGTA-:I’ P&5-CTGCCAAGAGGAGAAGAATG-:I’

672-691 1471-1490”

Exon

I

P9:5’-ATTGTCTGTAGCCGATTGGA-3’ P10:5’-CTTCCAGTGTATTTCTAAAGX

1749.-1768 1936-1955”

Exon

2

Pll:Fi’-GATTTGCTAGTCCACTTACT-3’ P12:5’-CTGTCAACAAATGCATGG’H-:I’

2296-2315 2424-244X”

Exun

:(

P13:5’-TATTTTTGAG,CAGTGGCT(Y-3 P14:5’-CTGAATCTTGTAGATAGCTA-3’

26(~5-2624

Exon

4

P15:.5’-ACCCAGACTCTTTTCAA(:A(::1’ P16:5’-ATAAGAGCACTTTAATTCAC-:I’

3050-3069 3544-3563”

Exon

5 plus 3’ untranslated

5 plus 3’ untranslated

region

2767-2786” region

Note. P6 is the same as Pl3. and I’6 is the same as Pl6. a Primer sequence is complementary to that in Fig. 2.

The site of poly(A) addition is typically 10 to 30 bases 3’ to an AAUAAA consensus polyadenylation signal (reviewed in Birnstiel et al., 1985). Computer analysis of the sequences distal to the translational termination codon at position 3271 identified two potential polyadenylation signals, at positions 3546 (AAUUAAA) and 3646 (AAUAAA). The potential signal at position 3546 is an imperfect match to the typical AAUAAA consensus and is unlikely to be utilized efficiently in vivo (Wickens and Stephenson, 1984). PCR amplification of an exon 4/5 fragment from cDNA from FME melanoma cells using primers P13P4 (P4 is complementary to bases 3662-3681; Table 1) yielded the expected abundant 814-bp product (data not shown). This indicates that there are no occult intervening sequences in the 3’ untranslated region and demonstrates that some or all tyrosinase mRNA is polyadenylated downstream of the AAUAAA at position 3646 in vivo. Primer Extension Analysis To precisely locate the 5’ end of human tyrosinase mRNA, we performed primer extension analysis of total cellular RNA from cultured FME pigmented human melanoma cells (Tveit et al., 1980) using a 20mer oligonucleotide primer complementary to nt 730-749 within exon 1 (seeFig. 2). As shown in Fig. 3, we observed a major extension product of 124 nt and two minor products of 153 and 158 nt. These data

indicate a major transcriptional start site of the human tyrosinase gene at position 626 (see Fig. 2) and two minor transcriptional start sites at positions 592 and 597. Characterization of a Truncated Related” Sequence on 1lp

‘Tyrosinase-

The sequences of two recombinant phage clones containing both exons 4 and 5, XhTyrl3 and XhTyrl6, isolated independently from different recombinant genomic libraries, are slightly divergent from that of the tyrosinase gene (Fig. 2). Barton et al. (1988) have previously mapped a “tyrosinase-related” sequence to chromosome segment llpll.2*cen, distinct from the tyrosinase gene on llq. To determine whether these divergent exon 4/exon 5 clones derive from the llp tyrosinase-related sequence, we PCR-amplified tyrosinase exon 4 and exon 5 fragments (Table 1, primers Pl-P4) from DNA of human/rodent hybrid cell lines containing only portions of human chromosome 11. The hybrid cell lines used were (i) VIIBHAT, which contains only llp human DNA sequences proximal to 11~15, including 11~11.2, specifically 17pter+ 17q2l::llp15+cen; (ii) XXI-54B-lj, which contains only llp human DNA sequences distal to 11~11.2, specifically der(l5)(llpter - llpll.2::15p12 + 15qt,er); and (iii) XXI-22A-c-2c, which contains both llp and llq human DNA sequences, specifically der(ll)(15pter+15p12::llpll.2+qter). As shown in

HIJMAN

TYROSINASE

AND

12

* -622 - -527 m-404 s-309

b1242 238 1-217 m-201 m-190 -180

-124-w

-122

-76

-67 FIG. 3. Primer extension analysis of RNA from pigmented human melanoma cells. An end-radiolabeled 20.mer oligonucleotide complementary to exon 1 of the human tyrosinase gene (see Materials and Methods) was used to prime reverse transcription of’ the RNA. Lanes: 1, primer extension products; 2, molecular size standard (radiolabeled pRR322 DNA digested with Hue111 plus HstNI).

Figs. 4A and 4B, both exons 4 and 5 were amplified from DNAs of VIIBHAT and XXI-22A-c-2c, but neither exon was amplified from DNA of XXI-54B-lj. These results confirm that neither the tyrosinase gene nor the tyrosinase-related sequence maps to human chromosome 11 distal to 11~11.2. To determine whether the XhTyrl3 and XhTyrl6 exon 4/exon 5 genomic clones derived from the tyrosinase gene on llq or the tyrosinase-related sequence on llp, we made use of the fact that the exon 4 and exon 5 sequences of XhTyrl3 and 16 predict cleavage sites for MspI (exon 4) and NcoI (exon 5) that are not

TYROSINASE-RELATED

LOCI

441

present in the tyrosinase gene (Fig. 2, positions 2654 and 3127). We therefore digested the exon 4 and exon 5 fragments amplified by PCR of XXI-22A-c-2c and VIIBHAT with MspI or Nc01. An MspI digest of the 269-bp exon 4 amplification product of the llq tyrosinase gene would yield 120- and 149-bp fragments, whereas an MspI digest of the amplification product of XhTyrl3 or 16 would yield 29-, 91-, and 149-bp fragments. The 717-bp exon 5 amplification product of the llq tyrosinase gene would not be cleaved by NcoI, whereas the 720-bp exon 5 amplification product of XhTyr13 or 16 would be cleaved by NcoI into 553- and 167-bp fragments. As shown in Figs. 4A and 4B, the exon 4 fragment MspI and the exon 5 fragment NcoI digests of hybrid XXI-22A-c-2c yield 149-, 120-, 91-, and 29-bp fragments and 717-, 553-, and 167-bp fragments, respectively. In contrast, the exon 4 fragment MspI and exon 5 NcoI digests of hybrid VII2HAT yield 149., 91-, and 29-bp fragments and 553- and 167-bp fragments, respectively. These experiments demonstrate that the exon 4/exon 5 PCR amplification products of hybrid XXI-22A-c-2c are a mixture derived from both the llq tyrosinase gene and the divergent segment, whereas those amplified from hybrid VIIBHAT correspond only to the divergent sequence. Furthermore, DNA sequence analysis of three independent clones of the VI12HAT exon 5 PCR product yielded only the divergent sequence (data not shown). These results demonstrate that the human tyrosinase gene is located on the long arm of chromosome 11 and that the divergent genomic segments cloned in hhTyr13 and XhTyrl6 derived from the tyrosinase-related sequence on the short arm of chromosome 11, within llpll.2+cen. Mapping of XhTyrl6 demonstrated that the intervening sequence between “exon 4” and “exon 5” of the llp tyrosinase-related segment is approximately 10 kb (data not shown), essentially the same size as IVS4 in the llq tyrosinase gene. To determine whether the llp tyrosinase-related segments includes additional tyrosinase exons besides 4 and 5, we performed Southern blot hybridization analysis of VII2HAT DNA using radiolabeled exon l-, 2-, and 3-specific DNA fragments as probes. As shown in Fig. 4C, the exon 1,2, and 3 probes respectively detect 2%, 3.5, and 1%kb fragments in HindIII-cleaved total human genomic DNA (lane 1). These fragment sizes are identical to those obtained on Hind111 digestion of tyrosinase genomic clones containing these exons (data not shown). However, none of these fragments are detected on Southern blot hybridization of HindIII-digested VII2HAT (lane 2) or mouse (lane 3) DNA. These results demonstrate that the llp tyrosinase-related sequence does not contain exon 1,2, or 3. This conclusion is supported by t,he failure of exon 1, 2, and 3 segments to be PCR-amplified from DNA

442

GIEBEL,

STRUNK,

AND

SPRITZ

B M

1

2

3

M

1

2

3

-717 -553 -149 -120

-28

-91 " I "1, * I I"

-1.8 z+b&b

-167

-29 bp

bp

kb

FIG. 4. PCR and Southern blot analyses of the lip tyrosinase-related segment. Note that in A and B negative images are shown for optimal photographic clarity. (A) Exon 4 PCR products digested with MspI and fractionated on a 6% polyacrylamide gel. Lanes: 1, fragments amplified from XXI-22A-c-2c DNA: 2, VIIBHAT DNA; 3, XXI-54B-lj DNA; M, molecular size standard. (B) Exon 5 PCR products digested with NcoI and fractionated on a 4% polyacrylamide gel. Lanes: 1, fragments amplified from XXI-22A-c-2c DNA; 2, VII2HAT DNA: 3, XXI-54B-lj DNA; M, molecular size standard. (C) Southern blot analysis of tyrosinase exons 1,2, and 3. Radiolabeled tyrosinase exon 1, 2, and 3 PCR products (see Table 1, primers P7-P12) were used as probes. The sizes of the hybridizing tyrosinase gene fragments are indicated. Lanes: 1, human genomic DNA; 2, VIIPHAT DNA; 3, mouse genomic DNA.

of hybrid VIIBHAT (data not shown). The llp tyrosinase-related sequence thus appears to be a truncated tyrosinase gene segment that contains at least part of IVSS, exon 4, IVS4, exon 5, and some downstream sequences, but includes no tyrosinase sequences 5’ to IVS3. The DNA sequence of the llp tyrosinase-related segment is more than 98% identical to that of the homologous segment of the llq tyrosinase gene (see Fig. 2). It contains no splice site mutations or frameshifts or nonsense substitutions within the coding regions that would render it untranslatable. Furthermore, its sequence differs from that of the llq tyrosinase gene by 2.6% in noncoding regions, but only by 0.7% in coding regions, and two of the three coding region differences are silent. These data suggest that the llp tyrosinase-related segment might represent “shuffled” tyrosinase-derived exons that encode part of an unknown cellular protein. We therefore specifically assayed RNA of pigmented human melanoma cells for transcripts of this sequence. Complementary DNA was prepared from total cellular RNA of FME pigmented melanoma cells, and exon 4-plus-exon 5 fragments were amplified by PCR using the oligonucleotides P5 and P6 described in Table 1. The amplification products were digested with NcoI, which cleaves the exon 5 sequence of the lip segment but not of the llq tyrosinase gene (see above), and were then analyzed by Southern blot hybridization using full-length tyrosinase cDNA as probe. Only the full-

length PCR product was detected even after prolonged autoradiography; there was no detectable cutting by NcoI (data not shown). This indicates that the truncated 1 lp tyrosinase-related segment is not transcribed at a detectable level, at least in FME melanoma cells. However, we cannot exclude the possibility that this segment is expressed in a different cell type. The limited sequence divergence between the llq tyrosinase gene and the llp tyrosinase-related segment suggested that the duplication of this segment was a relatively recent event. To determine whether the duplication is ubiquitous, llq and llp exon 4 fragments were coamplified by PCR (Table 1, primers P13-P14) using DNA from 27 unrelated normal Caucasian individuals. The amplification products were digested with MspI, which cleaves the exon 4 segments derived from llp and llq differently (Fig. 2; see above), and the digests were analyzed on a 2% agarose gel. All 27 individuals had both the llp- and the llq-specific products (data not shown). Similar results (not shown) were obtained by coamplifying llqand llp-specific exon 5 fragments (Table 1, primers P3-P4) and digesting with NcoI, which cleaves exon 5 in the llp but not the llq segment (Fig. 2). The llq/llp duplication appears to beubiquitous among Caucasians. We next investigated the presence of the llp tyrosinase-related segment in a number of different human ethnic groups. Exon 5 fragments from llq and llp were coamplified by PCR

HUMAN M

1

2

3

4

5

TYROSINASE 6

AND

7

tvw1

-167 bp

FIG. 5. PCR analysis of the tyrosinase gene and llp tyrosinase-related segments in different human ethnic groups. Tyrosinase exon 5 PCR products (Table 1, primers P3 and P4) amplified from DNA of individuals from different ethnic groups were digested with NcoI and fractionated on a 2PZ agarose gel. The 717/720-bp fragment is a mixture of the 717-bp exon 5 PCR product of the llq tyrosinase gene (no NcoI site) and the 7%bp exon 5 PCR product of the llp tyrosinase-related segment (contains the Ncol site, but was not cut by iVcoI because of incomplete digestion). The 553 and 167.bp fragments are specific to the llp tyrosinase-related segment. The approximately 195, 220., and 260.bp DNA fragments are nonspecific amplification products not homologous to the tyrosinase gene. Lanes: 1, Northern European Caucasian; 2, American Black; 3, African Pygmy: 4, Chinese; 5, Asian Indian: 6, Japanese; 7, Australian aborigine.

using DNA from individuals of northern European Caucasian, American Black, African Pygmy, Chinese, Indian, Japanese, and Australian aborigine ethnic origins and cleaved with NcoI. The 720-bp lip exon 5 amplification product is cut by NcoI into 553- and 167-bp fragments, whereas the 717-bp amplification product of the llq tyrosinase gene exon 5 remains uncut. As shown in Fig. 5, the genomes of individuals of all ethnic groups studied contained both the llq tyrosinase gene and the llp tyrosinase-related segment. DISCUSSION

We have cloned the human tyrosinase gene and deand nucleotide sequence. The termined its structure gene consists of five exons spanning more than 50 kb on the long arm of chromosome 11. The nucleotide sequence of the coding region is essentially identical to those of the previously reported tyrosinase cDNAs, although we have identified several DNA sequence polymorphisms within and adjacent to the gene. Amino acid sequence analysis of native human tyrosinase has shown that the N-terminal residue is a histidine corresponding to codon 19 (Wittbjer et al., 1989). The AUG at position 672 is a very poor match to the consensus sequence for translation initiation codons (ACCATGG; Kozak, 1986), but indeed appears to be the functional translation initiator. Al-

TYROSINASE-RELATED

443

LOCI

though none of the reported tyrosinase cDNAs extend through the 5’ untranslated sequence, primer extension and Sl nuclease mapping (see above; Kikuchi et al., 1989; Takeda et al., 1989) of the 5’ ends of human tyrosinase mRNA indicate that there are no occult upstream exons and that this is the first and only AUG upstream of the mature N-terminus in the correct reading frame within the transcribed region of the gene. Furthermore, a human tyrosinase cDNA that included only six bases upstream of the position 672 AUG induced pigmentation after transfection into mouse fibroblasts (Bouchard et al., 1989). Thus, translation apparently initiates at the AUG at position 672, and newly synthesized tyrosinase is then processed by post-translational cleavage of the first 18 amino acids, the sequence of which has characteristics of a leader peptide (Blobel and Dobberstein, 1975; von Heijne, 1983). Analysis of the sequences flanking the coding region of the gene revealed both CCAAT and TATA promoter motifs in the 5’ flanking sequences. We mapped a major transcription 5’ start site at approximately position 626 and two minor transcription start sites, at approximately positions 597 and 592 (Fig. 3). The latter appear to correspond to human tyrosinase mRNA 5’ termini mapped by Takeda et al. (1989) and Kikuchi et al. (1989) at approximately positions 590 and 593, respectively. However, neither of these investigators observed a major transcriptional start at position 626. This apparent discrepancy may reflect differences between the pigmented human melanoma cel1 lines studied in each case. Differences in tyrosinase gene transcriptional starts have also been observed in different cultured mouse pigment cell lines. Ruppert et al. (1988) and Yamamoto et al. (1989) mapped major tyrosinase transcriptional starts in mouse at sites corresponding to human positions 590 and 592, respectively, whereas only Ruppert et al. (1988) observed an additional minor transcriptional start site corresponding to human position 534. Downstream of the coding region, we observed only a single AAUAAA motif, at position 3646, which is apparently the functional polyadenylation signal. We also isolated a tyrosinase-related DNA segment and mapped it to the short arm of chromosome 11. This DNA segment only contains sequences corresponding to exons 4 and 5 and surrounding noncoding regions. The homologous nucleotide sequences of the llp and llq segments are very similar, having diverged by only 1.45%. Moreover, the overall pattern of sequence divergence is characteristic of expressed DNA. Although we were unable to detect transcripts corresponding to the llp tyrosinase-related segment in mRNA from FME pigmented human melanoma cells,

we cannot

exclude

the possibility

that

this

seg-

ment may be part of an unknown gene expressed in

444

GIEHEL,

STRUNK,

other cells. Alternatively, the llp tyrosinase-related segment may be a truncated and translocated tyrosinase pseudogene. The very low nucleotide sequence divergence between the llq tyrosinase gene and the llp tyrosinaserelated segment indicates that the duplication and llq:: llp translocation that gave rise to the Ilp segment were relatively recent events in primate evolution. The average nucleotide substitution rate during hominoid evolution is estimated to be 1.1 X lo-’ substitutions/site/year in unconstrained sequences (Koop et al., 19891. The 2.6% sequence divergence between the llq and llp segments in the noncoding regions thus places the duplication event at about 24 million years ago. This is consistent wit,h our observation that both the llq tyrosinase gene and the llp tyrosinase-related segment exist in all of the human ethnic groups that we studied, and suggests that the presence versus absence of the llp tyrosinase-related segment may be a useful discriminatory marker for studies of prehuman primate evolution. Finally, in studies of tyrosinase gene mutations in patients with oculocutaneous albinism, especially t.hose involving amplification of genomic segments by PCR, it is important to ensure that apparent mutations in exons 4 and 5 (and the adjacent intervening sequences) occur within the tyrosinase gene and not within the lip tyrosinase-related segment. ACKNOWLEDGMENTS

D. E.. KWON,

H. S., AND

FRANCKE.

Hu-

LT. (1988).

man tyrosinase gene mapped to chromosome 1 l(q14+q%l), defines second region of homolog?i with mouse chromosome 7. Gummics 3: l7-‘24. 2.

3.

BENTON, W. D., AND DAVIS, R. W. (1977). Screening combinant clones by hybridization to single plaques Scicnw 196: 180- 182. BIRNSTIEL,

M.

I,..

BUSSLINGER,

Transcription termination site! (‘p/I 41: 349-359. 3.

BLOBEL,

teins ,5.

G., AND

mouse J. hp.

H.,

FULLER,

B.

tion in classic, alhinism. 1’rw. 9.

H. H. (1990). Dimerization Nrco Biol. 2: 587-594.

R. A.. HANIFIN, tyrosinase

gene

J. M., muta-

H.. YAMAMOYO, H.. TAKEUCHI, T.. DEI, M. (1989). Characteristic sequences in ot’the human tyrosinase gene. Rlochrm. 28:i--286.

IO.

KIKUCHI, H.. HARA, S.. ISHIGUKO, S., TAMAI, M.. ANI) WATANABE, M. (1990). Detection of point mutation in the tyrosinase gene of a ,Japanese alhino patient by direct sequencing of amplified DNA. Hum. C;ewt. 85: 1X-124.

II.

KING, R. A.. AND SUMMERS, frd. (‘/in. 6: 217~228.

1%.

KINGSTON, R. E. (1989). In “Short Protocols in Molecular Biolom” (F. M. Ausubel. R. Brent, R. E. Kingston. I). 1). Moore. S. (;. Seidman, .J. A. Smith, and Ii. Struhl, Eds.). Wiley, New York. KOOP. B. F.. TACLE, L). A., (GOODMAN, M.. AND QLCHTOM, .I. 1,. (1989). A molecular view of primate phylogeny and important systematic and evolutionary questions. Mol. Riol. i3’1~d. 6: .58(1-612.

13.

C’. G. (1988).

Albinism.

Ihrmn-

14.

KOZAK. M. (19%). Point mutations detine a sequence Hankinp the AlI(; initiator codon that modulates translation by eukaryot ic ribostrmes. (‘e/l 44: 2H:$-Z92.

15.

KWON, B. S.. HAQ, A. K., J’OMERANTZ, S. H., AND HAI.ARAN. R. (1987). Isolation and sequence of a cDNA for human tyrosinase that maps at the mouse c-albino locus. I’roc. Nat[. Amd sc,i r ISA 84: 74x3-7477. MITCHELL, I’. .J.. AND TJIAN, R. (1989). Transcriptional ragulation in mammalian cells hy sequence-specific L)NA binding proteins. S~,icnw 245: :171- :(78.

17. 1x.

19.

“1.

I’OI.YANOVSKY,

0. I,.. AND

STEPCHENKO,

A. (;. (1990).

Kukar-

yotic transcription factors. Hic~Essnys 12: 205-210. ~