Journal of Orofacial Orthopedics Fortschritte der Kieferorthopädie
Original article
Orthodontic forces add to nicotine-induced loss of periodontal bone. An in vivo and in vitro study Kieferorthopädische Kräfte verstärken nikotininduzierten parodontalen Knochenverlust. In-vivo- und In-vitro-Studie Christian Kirschneck · Peter Proff · Michael Maurer · Claudia Reicheneder · Piero Römer
Abstract
Zusammenfassung
Objectives. Nicotine is considered an etiologic factor for chronic inflammatory phenomena within the periodontal ligament that may result in loss of periodontal attachment. Considering that smokers account for 26% of adult and 12% of adolescent patients in orthodontic practice, we performed in vivo and in vitro studies as to whether orthodontic forces may add to the nicotine-induced loss of periodontal bone. Methods. Fourteen male rats (Fischer 344 inbred) were used. Seven of these served as controls, while the other seven received daily subcutaneous injections of 1.89 mg L-nicotine per kg body weight. Both groups were exposed to orthodontic mesialization of the first two upper left molars using a NiTi closed-coil spring, the contralateral side serving as control. Periodontal bone loss was assessed by cone-beam computed tomography (CBCT). Human periodontal fibroblasts were stressed by compression (2 g/ cm2) and/or nicotine (3/5/7.5 µmol), and the expression of cyclooxygenase-2 (COX-2), prostaglandin E2 (PGE2), interleukin-6 (IL-6), osteoprotegerin (OPG), and receptor activator of nuclear factor κB ligand (RANKL) was determined at the transcriptional level by quantitative real-time polymerase chain reaction (qRTPCR) and at the translational level by enzyme-linked immunosorbent assay (ELISA). In addition, differentiation of co-cultured murine RAW264.7 cells to osteoclast-like cells was quantified by tartrate-resistant acid phosphatase (TRAP) staining. Results. Orthodontic force application in vivo led to a significant increase in nicotine-induced periodontal bone loss, and cell compression in vitro to increased COX-2, PGE2, IL-6, and RANKL expression, reduced OPG expression, and enhanced differentiation of RAW264.7 cells to osteoclast-like cells compared to nicotine alone.
Zielsetzung. Nikotin gilt als ein ätiologischer Faktor chronisch entzündlicher Prozesse im Zahnhalteapparat, die zum Verlust des parodontalen Attachments führen können. Raucher stellen mit 26% der Erwachsenen und 12% der Jugendlichen einen hohen Anteil von Patienten in kieferorthopädischer Behandlung. Wir prüften daher in vivo und in vitro die Hypothese, ob die Applikation kieferorthopädischer Kräfte zu einer Steigerung des nikotininduzierten parodontalen Knochenabbaus führt. Material und Methoden. Sieben männliche Fischer-344-Ratten erhielten tägliche Injektionen von 1,89 mg L-Nikotin pro kg Körpergewicht s.c., 7 weitere Tiere dienten als Kontrolle. In beiden Gruppen erfolgte eine kieferorthopädische Mesialisation der ersten beiden linken oberen Molaren mittels einer NiTi-Zugfeder, während die kontralaterale Oberkieferseite als Kontrolle diente. Der parodontale Knochenverlust wurde mittels digitaler Volumentomografie (DVT) bestimmt. Humane parodontale Fibroblasten wurden einem Druck von 2 g/cm2 und/oder 3/5/7,5 µM Nikotin ausgesetzt. Bestimmt wurde die Expression von COX-2, PGE2, IL-6, OPG und RANKL auf mRNA- (qRT-PCR) und Proteinebene (ELISA) und quantifiziert wurde die Differenzierung von kokultivierten RAW264.7-Zellen zu osteoklastenähnlichen Zellen mittels TRAP-Färbung. Ergebnisse. Die kieferorthopädische Kraftapplikation führte in vivo zu einer signifikanten Zunahme des nikotininduzierten parodontalen Knochenverlustes sowie in vitro zu einer Steigerung der Expression von COX-2, PGE2, IL-6 und RANKL, einer Hemmung der OPG-Expression sowie einer vermehrten Differenzierung von osteoklastenähnlichen Zellen aus RAW264.7-Zellen gegenüber der alleinigen Wirkung von Nikotin. Schlussfolgerungen. Bei der kieferorthopädischen Behandlung von Rauchern ist mit einem vermehrten parodontalen Knochen-
Department of Orthodontics, University Medical Center of Regensburg, Regensburg
This work was awarded the 2014 Arnold Biber Prize. Diese Arbeit ist 2014 mit Arnold-Biber-Preis ausgezeichnet worden.
Received: 18 September 2014 ; accepted: 25 September 2014; published online: 2 May 2015
J Orofac Orthop 2015; 76:195-212 DOI 10.1007/s00056-015-0283-7
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
195
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
Conclusion. Additional loss of periodontal bone must be expected during orthodontic treatment of smokers. Clinicians should inform their patients of this increased risk and refrain from performing tooth movements before cessation of smoking.
verlust zu rechnen. Der praktizierende Kieferorthopäde sollte die Patienten über die erhöhten Risiken aufklären, und Zahnbewegungen sollten nur nach Einstellen des Nikotinabusus erfolgen.
Keywords
Kieferorthopädie · Zahnbewegung · Nikotin · Parodontaler Knochenverlust · Parodontitis
Orthodontics · Tooth movement · Nicotine · Periodontal bone loss · Periodontitis
Schlüsselwörter
Introduction
Einleitung
Nicotine is a psychoactive, cytotoxic, and vasoactive alkaloid with insecticidal activity contained in the herbaceous plant Nicotiana tabacum, whose leaves are processed to tobacco. Smokers are known to be at a high risk of developing cardiovascular disease, chronic obstructive pulmonary disease, and tumors of the lung, oral cavity, pharynx, and esophagus [2]. Tobacco smoke also favors the development of chronic periodontal inflammation [3]. Of roughly 4000 chemical substances contained in cigarette smoke (e.g., arsenic, carbon monoxide, hydrogen cyanide, and formaldehyde), nicotine has been identified in recent studies as the single most important substance to mediate pathobiological tobacco-induced effects on periodontium [39, 54]. Despite a multitude of investigations into the effects of nicotine on bone loss related to periodontal inflammatory phenomena [9, 27, 30, 38], few studies are currently available about effects on orthodontic tooth movement. In fact, due to numerous similarities in molecular reaction mechanisms, such movement has been described as a process of sterile inflammation [35, 45]. While Sodagar et al. [48] investigated how nicotine affects the pace of orthodontic tooth movements and observed a dose-dependent accelerating effect, we are not aware of any previous studies on how orthodontic forces might affect the periodontally destructive effect of nicotine. There is a trend in clinical practice for orthodontic treatment to be sought increasingly by adults, who meanwhile account for over 15% of orthodontic patients [6]. Around 22% of these patients are regular and 4% occasional smokers [26]. Moreover, the prevalence of smokers continues to be high among adolescent patients, who make up the majority of orthodontically treated patients, given long-term results published by the Robert Koch Institute (KiGGs study) that the proportion of smokers among 11–17 year olds was 12% in Germany for the period 2009–2012, with 0.65% smoking daily [25]. In chronic smokers, any orthodontic force application will essentially take place in an environment of low-level periodontal inflammation [18]. Unless the tobacco use is effectively abandoned, such treatment, even though accompanied by oral-hygiene measures, will usually cause the periodontal bone situation to deteriorate (Fig. 1). Hence, the question arises whether orthodontic tooth movement may compound the periodontally destructive effect of nicotine and require special precautions during the planning of orthodontic treatment in smokers. The hypothesis underlying
Nikotin, ein psychoaktives, zytotoxisches und vasoaktives Alkaloid, ist ein insektizider Bestandteil der Virginischen Tabakpflanze Nicotiana tabacum, deren getrocknete pflanzliche Bestandteile zum Rauchen verwendet werden. Der Genuss von Tabakrauch stellt ein hohes Risiko für die Entstehung von kardiovaskulären Krankheiten, chronisch-obstruktiven Lungenerkrankungen und die Ausbildung von Tumorerkrankungen der Lunge, der Mund- und Rachenhöhle sowie der Speiseröhre dar [2]. Weiterhin wird die Entstehung von chronischinflammatorischen Erkrankungen des Zahnhalteapparates durch Tabakrauchen begünstigt [3]. Von den etwa 4000 im Zigarettenrauch enthaltenen unterschiedlichen Chemikalien (z. B. Arsen, Kohlenmonoxid, Blausäure, Formaldehyd) wird dem Nikotin nach neuesten Erkenntnissen die Hauptrolle bei der Vermittlung der tabakinduzierten pathobiologischen Effekte auf den Zahnhalteapparat zugeschrieben [39, 54]. Obgleich eine Vielzahl von Studien über die Effekte von Nikotin auf den parodontalen Knochenabbau im Zusammenhang mit parodontalen Entzündungsprozessen existiert [9, 27, 30, 38], gibt es bisher nur wenige Studien, die sich mit der Wirkung von Nikotin auf die kieferorthopädische Zahnbewegung beschäftigen. Diese wird in der Literatur auch als steriler Entzündungsprozess beschrieben [35, 45], da zahlreiche Parallelen in den molekularen Reaktionsmechanismen existieren. Sodagar et al. [48] untersuchten den Einfluss von Nikotin auf die Geschwindigkeit kieferorthopädischer Zahnbewegungen und fanden eine dosisabhängige Beschleunigung der Zahnbewegung unter Einwirkung von Nikotin. Unseres Wissens gibt es jedoch bisher keine Untersuchungen, welchen Einfluss kieferorthopädische Kräfte auf die parodontal-destuktive Wirkung von Nikotin haben. In der klinischen Praxis ist ein bestehender Trend erkennbar, dass vermehrt erwachsene Personen eine kieferorthopädische Behandlung wünschen. So machen erwachsene Patienten inzwischen mehr als 15% des Klientels einer kieferorthopädischen Praxis aus [6]. Etwa 22% dieser Patienten sind regelmäßige, 4% Gelegenheitsraucher [26]. Zudem ist auch die Prävalenz von Rauchern unter jugendlichen Patienten, welche die Mehrheit der kieferorthopädisch behandelten Patienten darstellen, weiterhin hoch. So ermittelte die KiGGS-Langzeitstudie des Robert-Koch-Institutes, dass im Zeitraum 2009–2012 der Anteil der Raucher unter den 11- bis 17-Jährigen in Deutschland 12% betrug, wobei etwa 0,65% sogar täglich Tabak konsumierten
196
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Fig. 1 8 a Intraoral view and b orthopantomogram of a 50-year-old woman who requested orthodontic treatment and smoked >10 cigarettes/day. Almost all teeth show horizontal and vertical periodontal bone loss. Abb. 1 8 a Intraorale Ansicht und b Orthopantomogramm einer 50-jährigen Frau, die eine kieferorthopädische Behandlung wünschte und >10 Zigaretten pro Tag rauchte. Bei nahezu allen Zähnen zeigt sich ein horizontaler wie vertikaler periodontaler Knochenverlust
our study was that orthodontic forces combined with nicotine would involve greater loss of periodontal bone than nicotine alone. We tested this hypothesis both in vivo and in vitro— based on alveolar bone resorption in rats exposed to orthodontic forces and/or nicotine and based on periodontal ligament (PDL) fibroblasts exposed to nicotine with or without co-application of mechanical compression—in an effort to better understand the role of nicotine-induced bone loss in conjunction with orthodontic tooth movement.
Materials and methods Experimental animals and orthodontic loading
Animal experiments were in line with German animal welfare legislation and approved by the authority in charge (reference no. 54-2532.1-46/13). Fourteen male Fischer 344 inbred rats were used (Rattus norvegicus Berkenhout; Charles River Laboratories, Sulzfeld, Germany). The animals were 6 weeks old and weighed 173–202 g. They were kept in a conventional animal laboratory under constant environmental conditions at room temperature (21±1°C) with 55±10% relative humidity, using day/night cycles of 12 h each. They were acclimatized for 7 days prior to study entry and had ad lib access to tap water and standard dry-food pellets soaked to mush (V1535; Ssniff, Soest, Germany) throughout orthodontic force application [21]. The rats were randomly assigned to a nicotine and control group of 7 animals each. Those in the nicotine group received daily subcutaneous injections of L-nicotine (SigmaAldrich®, St. Louis, MO, USA) 1.89 mg/kg body weight from 10 days prior to orthodontic loading to the end of the study. Those in the control group were treated with phosphate-buffered 0.9% saline (pH=7.4). The first 5 days of medication were
[25]. Die Applikation kieferorthopädischer Kräfte bedeutet bei chronischen Rauchern eine Behandlung bei latenten parodontalen Entzündungsprozessen [18]. Trotz behandlungsbegleitender Mundhygienemaßnahmen kommt es bei Behandlungsende meist zu einer Verschlechterung der parodontalen Knochensituation, wenn es nicht gelingt, den Nikotinabusus des Patienten zu unterbinden (Abb. 1). Es stellt sich daher die Frage, ob die kieferorthopädische Zahnbewegung die parodontal destruktive Wirkung von Nikotin zusätzlich verstärkt und ob bei Rauchern besondere Vorsicht bei der Planung kieferorthopädischer Behandlungsmaßnahmen angezeigt ist. Unsere Hypothese lautet, dass eine kieferorthopädische Kraftapplikation unter gleichzeitiger Nikotinwirkung zu einer Steigerung des parodontalen Knochenabbaus und der parodontalen Entzündungsprozesse gegenüber der alleinigen Wirkung von Nikotin führt. Dazu untersuchten wir in vivo am Tiermodell Ratte den Einfluss von Nikotin und kieferorthopädischen Kräften auf Resorptionsprozesse am Alveolarfortsatz. In-vitro-Untersuchungen sollten die Rolle von Fibroblasten des Parodontalligamentes beim Nikotininduzierten parodontalen Knochenverlust mit und ohne simultane Kraftapplikation näher beleuchten.
Material und Methoden Tierhaltung und kieferorthopädische Behandlung
Der Tierversuch wurde mit behördlicher Genehmigung (Aktenzeichen: 54-2532.1-46/13) in Übereinstimmung mit dem deutschen Tierschutzgesetz durchgeführt. Die Versuchstiere wurden in einem konventionellen Tierlaboratorium unter konstanten Umweltbedingungen (21±1°C Raumtemperatur, 55±10% Luftfeuchtigkeit) in einem Tag-Nacht-Rhythmus von
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
197
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
designed as a run-in phase approaching the final dose in onefifth increments. After 10 days of premedication, using a technique modified from Kirschneck et al. [21], an orthodontic NiTi closed-coil spring (Sentalloy, item 10-000-26, GAC International, Gräfelfing, Germany) exerting 0.25 N was inserted by wire ligatures from the cervices of the upper first two molars (M1, M2) on the left side of the upper jaw to the base of the upper incisors for mesialization of either molar at a constant force of 0.125 N (Fig. 2a). Using a split-mouth design, a wire ligature was also placed around the M1 and M2 cervices on the contralateral right side. Following 28 days of tooth movement, the spring was removed, while the wire ligatures were left in place. Another 14 days later, the rats were sacrificed in line with legal regulations by intraperitoneal injection of pentobarbital sodium (200 mg/kg body weight, Narcoren®; Merial, Hallbergmoos, Germany). Following perfusion fixation by 250 ml of 4% phosphate-buffered formalin solution (pH 7.4) through the ascending aorta [23], the maxilla was prepared with a diamond-coated rotating disc.
Radiographic determination of bone loss
This method has been reported previously by Kirschneck et al. [21] and is illustrated in Fig. 2b. After obtaining cone-beam computed tomography (CBCT) scans of the prepared maxillae, the resultant datasets were blinded and the distance of the M1 and M2 cementoenamel junctions from the bony margin of the alveolar ridge measured on all four (buccal, oral, mesial, distal) aspects. The arithmetic mean of these eight measurements was used for statistical analysis. For good reproducibility of the measurements, two-dimensional planes were defined perpendicular to the palate, passing either through the center of the adjacent teeth (sagittal) or symmetrically through the center of either crown (transverse). The measurements were performed by two different examiners. Intra- and interrater reliability was assessed by repeating them after 2 weeks, applying Dahlberg’s formula (where d is the difference between two measurements and n the number of repeated measurements) to determine the measurement error [11].
Collection of periodontal ligament fibroblasts
The in vitro part of the study was based on PDL fibroblast lines derived from non-carious teeth that had been extracted for orthodontic reasons from four patients. PDL samples were scraped off the middle root thirds and reduced in size, followed by incubation in six-well culture plates in a water-saturated atmosphere (5% CO2) at 37°C for around 7–14 days until adherently growing PDL fibroblasts proliferated from the tissue (Fig. 2e, [40, 44]). The culture medium was high-glucose Dulbecco’s Minimal Essential Medium (PAA Laboratories, Pasching, Austria) supplemented with 10% fetal calf serum (PAA Laboratories), 1% L-glutamine (PAA Laboratories),
198
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
12:12 h gehalten und vor Versuchsbeginn 7 Tage akklimatisiert. Die Ernährung erfolgte über Leitungswasser und Standard-Trockenfutterpellets ad libitum (V1535, ssniff, Soest, Deutschland), die ab Beginn der kieferorthopädischen Behandlung zu einem Futterbrei eingeweicht wurden [21]. Für die tierexperimentelle Untersuchung verwendeten wir 14 männliche Fischer-344-Inzucht-Ratten (Alter: 6 Wochen, Körpergewicht: 173–202 g, Rattus norvegicus Berkenhout) aus den Charles River Laboratories (Sulzfeld, Deutschland), die randomisiert in 2 Gruppen eingeteilt wurden. Die Tiere der Nikotingruppe (n=7) erhielten 10 Tage vor Beginn der kieferorthopädischen Behandlung bis zum Versuchsende tägliche subkutane L-Nikotin-Injektionen (Sigma Aldrich®, St. Louis/MO, USA) in einer Dosis von 1,89 mg/kg Körpergewicht, während die Kontrolltiere (n=7) mit phosphatgepufferter 0,9%iger Kochsalzlösung (pH=7,4) behandelt wurden. Die ersten 5 Tage der Medikation wurde das Nikotin sukzessive in Schritten von 1/5 der Enddosis verabreicht. Nach 10 Tagen Vormedikation erfolgte modifiziert nach Kirschneck et al. [21] mittels Drahtligaturen die Insertion einer kieferorthopädischen NiTi-Zugfeder (0,25 N, Sentalloy®, GAC International, Gräfelfing, Deutschland, 10-000-26) zwischen dem Zahnhals des ersten (M1) und zweiten (M2) oberen linken Molaren und der Basis der oberen Schneidezähne der Ratte, was zu einer Mesialisation der beiden Molaren mit einer konstanten Kraft von 0,125 N pro Zahn führte (Abb. 2a). In einem Splitmouth-Modell wurde jeweils auf der rechten Oberkieferseite ebenfalls eine gemeinsame Drahtligatur um den Zahnhals des ersten und zweiten Molaren inseriert. Nach 28 Tagen Zahnbewegung wurde die Feder unter Beibehaltung der Drahtligaturen entfernt. Weitere 14 Tage später erfolgte die Tötung der Tiere mittels intraperitonealer Injektion von Pentobarbital-Natrium (200 mg/kg Körpergewicht, Narcoren®, Merial, Hallbergmoos, Deutschland) gemäß den gesetzlichen Richtlinien. Nach Perfusionsfixierung der Tiere über die Aorta ascendens mittels 250 ml einer 4%igen phosphatgepufferten Formalinlösung (pH=7,4) [23] wurde jeweils der Oberkiefer mittels einer rotierenden, diamantierten Trennscheibe präparativ gewonnen.
Messung des parodontalen Knochenabbaus durch DVT im Rattenmodell
Um die parodontale Knochensituation beurteilen zu können, führten wir analog zu Kirschneck et al. [21] 3dimensionale radiologische DVT-Aufnahmen der gewonnenen Oberkiefer durch und bestimmten nach Verblindung der Daten die Entfernung der Schmelz-Zement-Grenze des ersten und zweiten Molaren (M1/M2) vom knöchernen Limbus alveolaris jeweils an 4 Messstellen (bukkal, oral, mesial und distal; Abb. 2b). Der arithmetische Mittelwert der 8 Messungen wurde für die weitere statistische Auswertung herangezogen. Zur Reproduzierbarkeit der Messungen wurden 2-dimensionale Messebenen festgelegt, die senkrecht zur Ebene des Gaumens sagittal durch die Mitte der Zahnreihe bzw. transversal symmetrisch durch die Mitte der Zahnkrone des ersten bzw. zweiten Molaren ver-
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Fig. 2 8 a Experimental setup for orthodontic mesialization of the first two molars (M1, M2) on the left side of a rat’s maxilla, using a constant force of 0.25 N from a NiTi closed-coil spring. The contralateral right side was fitted with a non-loading wire ligature around M1/M2 for control. b A CBCT scan was used to measure the existing loss of periodontal bone based on the mean (from 8 sites per case) distance of the M1/M2 cementoenamel junction from the alveolar bone level. c, d Setup to simulate a constant force of 2 g/cm2 for orthodontic compression used on human periodontal ligament (PDL) fibroblasts. e Proliferation of adherently growing PDL fibroblasts from periodontal tissue samples of extracted human teeth (400×). The periodontal fibroblasts thus obtained were trypsinized on reaching confluence and were used for the cell experiments at a concentration of approximately 70,000 cells/well. f Osteoclast-like cells in histochemical TRAP staining (red) surrounded by undifferentiated RAW264.7 cells and PDL fibroblasts (400×). Abb. 2 8 a Experimentelles Setting für die Mesialisierung der ersten 2 Molaren (M1, M2) auf der linken Seite des Oberkiefers der Ratte. Eingesetzt wurde eine konstante Kraft (0.25 N) vermittelt durch eine NiTi-Zugfeder. An der kontralateralen rechte Seite eine Drahtligatur um M1/M2 als Kontrolle. b CBCT-Aufnahme, um den existierenden parodontalen Knochenverlust zu messen, auf der Basis der durchschnittlichen Distanz (von 8 Stellen pro Fall) der Zement-Schmelz-Grenze vom Niveau des Alveolarknochens. c, d Setting, um eine konstante Kraft von 2 g/cm2 für die kieferorthopädische Kompression auf humane PDL(“periodontal ligament”)-Fibroblasten zu simulieren. e Proliferation von adhärent wachsenden PDL-Fibroblasten aus parodontalen Gewebeproben extrahierter humaner Zähne (Vergr. 400:1). Die so gewonnenen parodontalen Fibroblasten wurden mit Erreichen der Konfluenz trypsinisiert und für die Zellexperimente in einer Konzentration von etwa 70.000 Zellen/Well verwendet. f Histochemisch TRAP-gefärbte osteoklastenähnliche Zellen (rot) umgeben von undifferenzierten RAW264.7-Zellen und PDL-Fibroblasten (Vergr. 400:1)
100 µmol ascorbic acid (Sigma-Aldrich®, St. Louis, MO, USA), and 1% antibiotics/antimycotics (PAA Laboratories). The cells were trypsinized as confluence was reached. The samples were collected after obtaining approval from the University of Regensburg institutional review board (reference no. 12-1700150) and informed consent from the donor patients in accordance with the Declaration of Helsinki.
Cell stimulation by compression and/or nicotine
These human PDL fibroblasts were seeded on six-well culture dishes at a cell density of 70,000 cells per well and assigned to one of eight groups: z one control group incubated without stimulation for 48 h, z three experimental groups stimulated with 3, 5, or 7.5 µmol of L-nicotine (Sigma-Aldrich®) for 48 h with no mechanical forces involved, z one group preincubated for 24 h and subjected to compressive forces (2 g/cm2) using an established model [37] for another 24 h (Fig. 2c, d), and
liefen. Die Messungen wurden zur Beurteilung der Intra- und Interrater-Reliabilität im Abstand von 2 Wochen wiederholt und von 2 verschiedenen Untersuchern durchgeführt. Der Messfehler wurde mittels der Dahlberg-Formel ermittelt
(; d = Unterschied zwischen 2 Messungen; n = Zahl der wiederholten Messungen) [11].
Gewinnung von parodontalen Fibroblasten
Für die zellbiologischen Versuche wurden PDL-FibroblastenZelllinien von 4 verschiedenen Patienten verwendet. Von kieferorthopädisch extrahierten kariesfreien Zähnen wurden Anteile des Desmodonts vom mittleren Drittel der Zahnwurzel abgeschabt, zerkleinert und in 6-Well-Zellkulturplatten für etwa 7–14 Tage in 5% CO2/Luft und wassergesättigter Atmosphäre bei 37°C inkubiert, bis adhärent wachsende PDL-Fibroblasten aus dem Gewebe proliferierten (Abb. 2e, [40, 44]). Als Zellkulturmedium verwendeten wir Dulbecco’s Minimal Es-
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
199
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
z three experimental groups that were prestimulated with 3, 5, or 7.5 µmol of L-nicotine for 24 h and incubated further in the presence of compression (2 g/cm2) co-applied with these respective nicotine doses. All experiments were performed in several repeated runs under cell-culture conditions inside an incubator in a watersaturated atmosphere with 5% CO2 at 37°C.
RANKL/OPG/COX-2/IL-6 detection at the transcriptional (mRNA) level by qRT-PCR
Total RNA was isolated by lysing the PDL fibroblasts with 1 ml of Tri-Reagent® (Sigma-Aldrich®), purified according to the manufacturer’s protocol, and dissolved in 20 µl of nucleasefree water for photometric assessment at 260 nm using a fiberoptic cuvette (TrayCell®; Hellma, Müllheim, Germany) in an ultraviolet-visible (UV-Vis) spectrophotometer (Genesys™ 10S; Thermo Scientific). cDNA was obtained in a 20-µl assay using 1 µg of total RNA, 20 pmol of an oligo-dT25 and random hexamer primer (Eurofins, Ebersberg, Germany), 0.2 mmol of dNTP-Mix (Thermo Scientific), and 200 U of reverse transcriptase (M-MLV; Promega, Fitchburg, WI, USA). This assay was incubated in a thermocycler at 42°C for 1 h, followed by heat inactivation of the reverse transcriptase at 95°C for 5 min at the end of the reaction. Fluorescence thresholds (CT values) were amplified/detected using a Mastercycler® ep realplex-S thermocycler (Eppendorf, Hamburg, Germany) and target genes amplified by 10 µl 2× SYBR® Green JumpStart™ Taq ReadyMix (Sigma-Aldrich®), a primer pair used at 25 pmol per primer (Eurofins MWG Operon; see Tab. 1), 1 µl of cDNA, ad 20 µl of H2O. The PCR program started out by denaturation at 95°C for 10 min, followed by 45 cycles of quantitative real-time polymerase chain reaction (qRT-PCR) at 95°C for 15 s, 60°C for 8 s, and 72°C for 8 s. Agarose gel electrophoresis was used to verify the specific amplification products of the target genes (PCR specificity). Then the gene expression of receptor activator of nuclear factor κB ligand (RANKL), osteoprotegerin (OPG), cyclooxygenase-2 (COX-2), and interleukin-6 (IL-6) was determined using the 2-ΔΔCT method as described by Livak and Schmittgen [31], also taking into consideration amplification efficiency. Normalization of gene expression was based on the large RNA polymerase-2/polypeptide-A major (Pol2RA, housekeeping gene) subunit.
IL-6 and PGE2 quantitation at the translational (protein) level by ELISA
To determine the concentrations of IL-6 and prostaglandin E2 (PGE2), the culture supernatant was removed following stimulation of the human PDL fibroblasts, shock-frozen in liquid nitrogen (−196°C), and stored at −80°C. For PGE2 quantitation, a PGE2 enzyme-linked immunosorbent assay (ELISA) kit (Novus Biologicals®, Littleton, CO, USA) was used and the concentrations measured as per the manufacturer’s instructions using an ELISA spectrophotometer (Multiskan™ Go; Thermo Scientific). IL-6 levels were quantified by immunoassay (Immulite® 2000; Siemens Healthcare, Erlangen, Ger-
200
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
sential Medium (High Glucose, PAA Laboratories, Pasching, Österreich), welches mit 10% fötalem Kälberserum (PAA), 1% L-Glutamin (PAA), 100 µM Vitamin C (Sigma-Aldrich®) und 1% Antibiotika/Antimykotika (PAA) supplementiert war. Mit Erreichen der Konfluenz erfolgte die Trypsinierung der Zellen. Die Gewinnung des Probenmaterials erfolgte mit Genehmigung der zuständigen Ethikkommission (Aktenzeichen: 12170-0150) der Universität Regensburg und informierter Zustimmung der Spenderpatienten unter Einhaltung der Deklaration von Helsinki.
Stimulation der PDL-Zellen mit mechanischen Kräften und Nikotin
Für den In-vitro-Versuch wurden die humanen PDL-Fibroblasten jeweils in 6-Well-Zellkulturplatten mit einer Zelldichte von 70.000 Zellen pro Well ausgesät und folgende Versuchsgruppen (n=6) gebildet: z Eine unbehandelte, für 48 h unter Zellkulturbedingungen inkubierte Untersuchungsgruppe diente als Kontrollgruppe. z Drei Untersuchungsgruppen wurden mit jeweils 3, 5 und 7,5 µM L-Nikotin (Sigma-Aldrich®) für 48 h stimuliert. z Eine Untersuchungsgruppe wurde für 24 h unter Zellkulturbedingungen vorinkubiert erhielt für 24 h eine mechanische Stimulation durch Kompressionskräfte (2 g/cm2) mittels eines etablierten Modells ([37], Abb. 2c, d). z Drei Versuchsgruppen wurden zunächst für 24 h mit jeweils 3, 5 und 7,5 µM L-Nikotin vorstimuliert und anschließend unter Kompression (2 g/cm2) und Nikotin für 24 h weiter inkubiert. Die Durchführung aller Experimente, die mehrmals reproduziert wurden, erfolgte unter Zellkulturbedingungen in einem Inkubator (37°C, 5% CO2, wassergesättigte Luft).
Genexpressionsanalyse von RANKL/OPG/COX-2 und IL-6 mittels qRT-PCR
Für die Isolation der Gesamt-RNA wurden die PDL-Fibroblasten mit 1 ml Tri-Reagent® (Sigma-Aldrich®) lysiert. Die Aufreinigung der Gesamt-RNA erfolgte nach dem Standardprotokoll des Herstellers. Die aufgereinigte RNA wurde in 20 µl nukleasefreiem Wasser gelöst und zur Quantifizierung photometrisch bei 260 nm mittels einer TrayCell® Küvette und einem Genesis™ 10S UV-Vis Spektrophotometer (Thermo Fisher Scientific, Waltham/MA, USA) vermessen. Für die Herstellung der cDNA wurden in einem 20 µl Ansatz eine GesamtRNA-Menge von 1 µg, je 20 pmol von einem Oligo-dT25- und Zufallshexamerprimer (Eurofins, Ebersberg, Deutschland), 0,2 mM dNTP-Mix (Thermo Scientific, Waltham/MA, USA) und 200 U reverse Transkriptase (M-MLV, Promega, Fitchburg/WI, USA) verwendet. Dieser Ansatz wurde bei 42°C für 1 h in einem Thermocycler inkubiert. Die Inaktivierung der reversen Transkriptase am Reaktionsende erfolgte durch Hitzeinaktivierung (95°C, 5 min). Die Amplifikation und Detektion der Fluoreszenzschwellenwerte (CTValues) erfolgte in Tripletts für jede cDNA mit dem Mastercycler® ep realplex-S Thermocycler (Eppendorf, Hamburg,
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Tab. 1 Overview of the intron-spanning primers used in the qRT-PCR experiments. Tab. 1 Überblick über die in den qRT-PCR Experimenen verwendeten “intron-spanning” Primer Gene
Accession number
5’-forward primer-3’
5’-reverse primer-3’
COX-2 (PTGS2) IL-6 OPG (Tnfrsf11b) RANKL (Tnfsf11) Pol2RA
NM_000963 NM_000600.3 AF134187.1 AF019047 NM_000937.3
cttcacgcatcagttttt caggagcccagctatgaact tgattcatgtaggagaattaaacagg gatgtgctgtgatccaacga ttgtgcaggacacactcaca
tcaccgtaaatatgatttaagtccac agcaggcaacaccaggag gatgtgctgtgatccaacga gcaaactgtatttcgctctgg caggaggttcatcacttcacc
All PCR primers were used at an annealing temperature of 60°C qRT-PCR quantitative real-time polymerase chain reaction, COX-2 cyclooxygenase-2, IL-6 interleukin-6, OPG osteoprotegerin, RANKL receptor activator of nuclear factor kappa-B ligand, Pol2RA polymerase-2/polypeptide-A.
many) performed at the University of Regensburg Institute of Clinical Chemistry and Laboratory Medicine.
Analysis of osteoclastogenesis by co-culture of PDL fibroblasts with RAW264.7 cells
To assess how nicotine and mechanical stressing would affect monocyte/macrophage differentiation to osteoclast-like cells, human PDL fibroblasts were subjected to 24 h of static compression (2 g/cm2) either alone or together with nicotine 7.5 µmol. After this incubation period and washing the cells with PBS, they were additionally co-cultured with 60,000 murine immortal macrophages (RAW264.7; CLS Cell Lines Service, Eppelheim, Germany) per well for 72 h. Differentiation to osteoclast-like cells was demonstrated histochemically by tartrate-resistant acid phosphatase (TRAP) staining— which causes intense red staining of osteoclast-like cells—as described by Barka and Anderson ([1], Fig. 2f) and based on morphological criteria like multiple nuclei or cell size at 400x magnification (BX45TF; Olympus® Germany, Hamburg, Germany). A blinded examiner quantified the cells identified in this manner on a per-well basis.
Statistical analysis
Using the software application SPSS® Statistics 21 (IBM®, Armonk, NY, USA), all data were tested for normal distribution (Shapiro-Wilk test) and homogeneity of variance (Levene’s test). Descriptive statistics are given as mean±standard deviation. The experimental groups were independently compared by one-way ANOVAs, which, except for the CBCT data, were validated by applying Welch’s test since homogeneity of variance was absent. Post hoc tests using either the Games–Howell approach for heterogeneous variances (gene expression/ ELISA) or Gabriel’s for dissimilar group sizes (CBCT data) were used for pairwise comparisons. Two-sided independent t-tests were used to analyze weight developments and the results of PDL/RAW264.7 co-culture, in the latter case after logarithmic transformation of the data (ln) for homogenization of variances. All differences were considered statistically significant at p≤0.05. Clinical relevance was evaluated via effect sizes by calculating Pearson’s correlation coefficients (r), >0.5 indicating large, >0.3 medium, and >0.1 small differences of mean values or effects. Dahlberg’s measurement error for the CBCT
Deutschland). Für die Amplifikation der Zielgene wurden 10 µl 2× SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich®), jeweils 25 pmol eines Primerpaars (Eurofins, Tab. 1), 1 µl cDNA, ad 20 µl H2O verwendet. Das PCR-Programm wurde mit einer initialen Denaturierung (10 min bei 95°C) mit anschließend 45 PCR-Zyklen mit 95°C für 15 s, 60°C für 8 s und 72°C für 8 s durchgeführt. Die spezifische Amplifikation der Zielgene wurde mittels Agarose-Gelelektrophorese überprüft. Die Bestimmung der Genexpression erfolgte mittels der 2−∆∆CT-Methode nach Livak u. Schmittgen [31] und unter Berücksichtigung der Amplifikationseffizienz. Zur Normalisierung der Genexpression verwendeten wir das Transkript der großen Untereinheit der RNA-Polymerase 2/Polypeptid A (Pol2RA, housekeeping gene).
Quantitative Bestimmung von IL-6 und PGE2 im Zellkulturüberstand mittels ELISA
Zur Bestimmung der IL-6- und PGE2-Konzentration wurde der Zellkulturüberstand der humanen PDL-Fibroblasten nach der Stimulation der Zellen abgenommen, in flüssigem Stickstoff (−196°C) schockgefroren und bei −80°C gelagert. Für die Bestimmung der PGE2-Konzentration verwendeten wir ein PGE2-ELISA-Kit (Novus Biologicals®, Littleton/CO, USA). Die Messung der PGE2-Konzentration erfolgte nach Herstellerangaben an einem ELISA-Plattenlesegerät (Multiskan™ Go, Thermo Scientific). Die Bestimmung der IL-6-Konzentration erfolgte am Institut für Klinische Chemie und Laboratoriumsmedizin der Universität Regensburg mit dem Immulite® 2000 Immunoassay System (Siemens, Healthcare Sector, Erlangen, Deutschland).
Bestimmung der Osteoklastogenese durch eine PDL-Fibroblasten/RAW264.7-Kultur
Um die Wirkung von mechanischer Kraftapplikation und Nikotin auf den Differenzierungsvorgang von Monozyten/Makrophagenzellen in osteoklastenähnliche Zellen zu analysieren, bildeten wir 2 Versuchsgruppen mit humanen PDL-Fibroblasten. Diese wurden entweder mit statischer Kraftapplikation von 2 g/cm2 bzw. zusätzlich mit 7,5 µM Nikotin für 24 h stimuliert. Nach dieser Inkubationsdauer wurden die Zellen mit PBS gewaschen und zusätzlich mit murinen immortalen RAW264.7-Zellen (Makrophagen-Zelllinie, CLS Cell Lines Service, Eppelheim, Deutschland) in einer Konzentration von
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
201
Mean distance of M1/M2 cementoenamel junction from alveolar bone level (mm)
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
0.55
PBS (buffered 0.9% NaCI solution) nicotine (1.89 mg/kg BW/day s.c.)
orthodontic force * p = 0.025
25g (M1&M2)
0.50 * p = 0.05
0.45
periodontal breakdown
nicotine
0.40
0.35
increased periodontal breakdown 25g
0.30
(M1&M2) p < 0.001 ***
0.25
control
(wire ligature)
orthod. force (+ wire ligature)
nicotine
(+ wire ligature)
nicotine + orthodontic force
nicotine + force (+ wire ligature)
a
b
Fig. 3 8 a Periodontal bone loss in the rat model under the action of nicotine and orthodontic force. b Three-dimensional surface models created from the CBCT data of the rat’s upper molar area: the orthodontic force with co-administration of nicotine caused a distinct increase in periodontal bone loss compared to the nicotine group without force application. (*p≤0.05; ***p≤0.001). Abb. 3 8 a Parodontaler Knochenverlust im Rattenmodell unter der Einwirkung von Nikotin und kieferorthopädischer Kraft. b 3-D-Oberflächenmodelle, geformt nach den CBCT-Daten des oberen Molarenbereichst: Die kieferorthopädische Kraft in Koadministration mit Nikotin verursachte eine im Vergleich zur Gruppe mit Nikotin ohne Kraftapplikation deutliche Erhöhung des parodontalen Knochenverlusts (*p≤0,05; ***p≤0,001).
data was within the accepted 5% limits of the intra- or interrater mean value.
Results Weight development and dropouts
The 7 control rats were found to considerably gain weight from a mean of 265±6 g at the time of spring insertion (day 0) to 298±8 g when they were sacrificed 6 weeks later. One of the 7 nicotine rats died on day 35, which left 6 animals for statistical analysis, which also considerably gained weight from day 0 (mean: 246±10 g) to day 42 (mean: 260±9 g). At both points in time, however, their weight was significantly lower than in the control group (t=4.508 or 7.692; df =12 or 11; p=0.001; r=0.79 or 0.92).
Periodontal bone loss in the rat model
The difference in terms of nicotine effects on the bone surrounding the first two upper molars (M1/M2) was significant between both groups of animals (F3,22 =14.115; p
Original article
Orthodontic forces add to nicotine-induced loss of periodontal bone. An in vivo and in vitro study Kieferorthopädische Kräfte verstärken nikotininduzierten parodontalen Knochenverlust. In-vivo- und In-vitro-Studie Christian Kirschneck · Peter Proff · Michael Maurer · Claudia Reicheneder · Piero Römer
Abstract
Zusammenfassung
Objectives. Nicotine is considered an etiologic factor for chronic inflammatory phenomena within the periodontal ligament that may result in loss of periodontal attachment. Considering that smokers account for 26% of adult and 12% of adolescent patients in orthodontic practice, we performed in vivo and in vitro studies as to whether orthodontic forces may add to the nicotine-induced loss of periodontal bone. Methods. Fourteen male rats (Fischer 344 inbred) were used. Seven of these served as controls, while the other seven received daily subcutaneous injections of 1.89 mg L-nicotine per kg body weight. Both groups were exposed to orthodontic mesialization of the first two upper left molars using a NiTi closed-coil spring, the contralateral side serving as control. Periodontal bone loss was assessed by cone-beam computed tomography (CBCT). Human periodontal fibroblasts were stressed by compression (2 g/ cm2) and/or nicotine (3/5/7.5 µmol), and the expression of cyclooxygenase-2 (COX-2), prostaglandin E2 (PGE2), interleukin-6 (IL-6), osteoprotegerin (OPG), and receptor activator of nuclear factor κB ligand (RANKL) was determined at the transcriptional level by quantitative real-time polymerase chain reaction (qRTPCR) and at the translational level by enzyme-linked immunosorbent assay (ELISA). In addition, differentiation of co-cultured murine RAW264.7 cells to osteoclast-like cells was quantified by tartrate-resistant acid phosphatase (TRAP) staining. Results. Orthodontic force application in vivo led to a significant increase in nicotine-induced periodontal bone loss, and cell compression in vitro to increased COX-2, PGE2, IL-6, and RANKL expression, reduced OPG expression, and enhanced differentiation of RAW264.7 cells to osteoclast-like cells compared to nicotine alone.
Zielsetzung. Nikotin gilt als ein ätiologischer Faktor chronisch entzündlicher Prozesse im Zahnhalteapparat, die zum Verlust des parodontalen Attachments führen können. Raucher stellen mit 26% der Erwachsenen und 12% der Jugendlichen einen hohen Anteil von Patienten in kieferorthopädischer Behandlung. Wir prüften daher in vivo und in vitro die Hypothese, ob die Applikation kieferorthopädischer Kräfte zu einer Steigerung des nikotininduzierten parodontalen Knochenabbaus führt. Material und Methoden. Sieben männliche Fischer-344-Ratten erhielten tägliche Injektionen von 1,89 mg L-Nikotin pro kg Körpergewicht s.c., 7 weitere Tiere dienten als Kontrolle. In beiden Gruppen erfolgte eine kieferorthopädische Mesialisation der ersten beiden linken oberen Molaren mittels einer NiTi-Zugfeder, während die kontralaterale Oberkieferseite als Kontrolle diente. Der parodontale Knochenverlust wurde mittels digitaler Volumentomografie (DVT) bestimmt. Humane parodontale Fibroblasten wurden einem Druck von 2 g/cm2 und/oder 3/5/7,5 µM Nikotin ausgesetzt. Bestimmt wurde die Expression von COX-2, PGE2, IL-6, OPG und RANKL auf mRNA- (qRT-PCR) und Proteinebene (ELISA) und quantifiziert wurde die Differenzierung von kokultivierten RAW264.7-Zellen zu osteoklastenähnlichen Zellen mittels TRAP-Färbung. Ergebnisse. Die kieferorthopädische Kraftapplikation führte in vivo zu einer signifikanten Zunahme des nikotininduzierten parodontalen Knochenverlustes sowie in vitro zu einer Steigerung der Expression von COX-2, PGE2, IL-6 und RANKL, einer Hemmung der OPG-Expression sowie einer vermehrten Differenzierung von osteoklastenähnlichen Zellen aus RAW264.7-Zellen gegenüber der alleinigen Wirkung von Nikotin. Schlussfolgerungen. Bei der kieferorthopädischen Behandlung von Rauchern ist mit einem vermehrten parodontalen Knochen-
Department of Orthodontics, University Medical Center of Regensburg, Regensburg
This work was awarded the 2014 Arnold Biber Prize. Diese Arbeit ist 2014 mit Arnold-Biber-Preis ausgezeichnet worden.
Received: 18 September 2014 ; accepted: 25 September 2014; published online: 2 May 2015
J Orofac Orthop 2015; 76:195-212 DOI 10.1007/s00056-015-0283-7
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
195
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
Conclusion. Additional loss of periodontal bone must be expected during orthodontic treatment of smokers. Clinicians should inform their patients of this increased risk and refrain from performing tooth movements before cessation of smoking.
verlust zu rechnen. Der praktizierende Kieferorthopäde sollte die Patienten über die erhöhten Risiken aufklären, und Zahnbewegungen sollten nur nach Einstellen des Nikotinabusus erfolgen.
Keywords
Kieferorthopädie · Zahnbewegung · Nikotin · Parodontaler Knochenverlust · Parodontitis
Orthodontics · Tooth movement · Nicotine · Periodontal bone loss · Periodontitis
Schlüsselwörter
Introduction
Einleitung
Nicotine is a psychoactive, cytotoxic, and vasoactive alkaloid with insecticidal activity contained in the herbaceous plant Nicotiana tabacum, whose leaves are processed to tobacco. Smokers are known to be at a high risk of developing cardiovascular disease, chronic obstructive pulmonary disease, and tumors of the lung, oral cavity, pharynx, and esophagus [2]. Tobacco smoke also favors the development of chronic periodontal inflammation [3]. Of roughly 4000 chemical substances contained in cigarette smoke (e.g., arsenic, carbon monoxide, hydrogen cyanide, and formaldehyde), nicotine has been identified in recent studies as the single most important substance to mediate pathobiological tobacco-induced effects on periodontium [39, 54]. Despite a multitude of investigations into the effects of nicotine on bone loss related to periodontal inflammatory phenomena [9, 27, 30, 38], few studies are currently available about effects on orthodontic tooth movement. In fact, due to numerous similarities in molecular reaction mechanisms, such movement has been described as a process of sterile inflammation [35, 45]. While Sodagar et al. [48] investigated how nicotine affects the pace of orthodontic tooth movements and observed a dose-dependent accelerating effect, we are not aware of any previous studies on how orthodontic forces might affect the periodontally destructive effect of nicotine. There is a trend in clinical practice for orthodontic treatment to be sought increasingly by adults, who meanwhile account for over 15% of orthodontic patients [6]. Around 22% of these patients are regular and 4% occasional smokers [26]. Moreover, the prevalence of smokers continues to be high among adolescent patients, who make up the majority of orthodontically treated patients, given long-term results published by the Robert Koch Institute (KiGGs study) that the proportion of smokers among 11–17 year olds was 12% in Germany for the period 2009–2012, with 0.65% smoking daily [25]. In chronic smokers, any orthodontic force application will essentially take place in an environment of low-level periodontal inflammation [18]. Unless the tobacco use is effectively abandoned, such treatment, even though accompanied by oral-hygiene measures, will usually cause the periodontal bone situation to deteriorate (Fig. 1). Hence, the question arises whether orthodontic tooth movement may compound the periodontally destructive effect of nicotine and require special precautions during the planning of orthodontic treatment in smokers. The hypothesis underlying
Nikotin, ein psychoaktives, zytotoxisches und vasoaktives Alkaloid, ist ein insektizider Bestandteil der Virginischen Tabakpflanze Nicotiana tabacum, deren getrocknete pflanzliche Bestandteile zum Rauchen verwendet werden. Der Genuss von Tabakrauch stellt ein hohes Risiko für die Entstehung von kardiovaskulären Krankheiten, chronisch-obstruktiven Lungenerkrankungen und die Ausbildung von Tumorerkrankungen der Lunge, der Mund- und Rachenhöhle sowie der Speiseröhre dar [2]. Weiterhin wird die Entstehung von chronischinflammatorischen Erkrankungen des Zahnhalteapparates durch Tabakrauchen begünstigt [3]. Von den etwa 4000 im Zigarettenrauch enthaltenen unterschiedlichen Chemikalien (z. B. Arsen, Kohlenmonoxid, Blausäure, Formaldehyd) wird dem Nikotin nach neuesten Erkenntnissen die Hauptrolle bei der Vermittlung der tabakinduzierten pathobiologischen Effekte auf den Zahnhalteapparat zugeschrieben [39, 54]. Obgleich eine Vielzahl von Studien über die Effekte von Nikotin auf den parodontalen Knochenabbau im Zusammenhang mit parodontalen Entzündungsprozessen existiert [9, 27, 30, 38], gibt es bisher nur wenige Studien, die sich mit der Wirkung von Nikotin auf die kieferorthopädische Zahnbewegung beschäftigen. Diese wird in der Literatur auch als steriler Entzündungsprozess beschrieben [35, 45], da zahlreiche Parallelen in den molekularen Reaktionsmechanismen existieren. Sodagar et al. [48] untersuchten den Einfluss von Nikotin auf die Geschwindigkeit kieferorthopädischer Zahnbewegungen und fanden eine dosisabhängige Beschleunigung der Zahnbewegung unter Einwirkung von Nikotin. Unseres Wissens gibt es jedoch bisher keine Untersuchungen, welchen Einfluss kieferorthopädische Kräfte auf die parodontal-destuktive Wirkung von Nikotin haben. In der klinischen Praxis ist ein bestehender Trend erkennbar, dass vermehrt erwachsene Personen eine kieferorthopädische Behandlung wünschen. So machen erwachsene Patienten inzwischen mehr als 15% des Klientels einer kieferorthopädischen Praxis aus [6]. Etwa 22% dieser Patienten sind regelmäßige, 4% Gelegenheitsraucher [26]. Zudem ist auch die Prävalenz von Rauchern unter jugendlichen Patienten, welche die Mehrheit der kieferorthopädisch behandelten Patienten darstellen, weiterhin hoch. So ermittelte die KiGGS-Langzeitstudie des Robert-Koch-Institutes, dass im Zeitraum 2009–2012 der Anteil der Raucher unter den 11- bis 17-Jährigen in Deutschland 12% betrug, wobei etwa 0,65% sogar täglich Tabak konsumierten
196
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Fig. 1 8 a Intraoral view and b orthopantomogram of a 50-year-old woman who requested orthodontic treatment and smoked >10 cigarettes/day. Almost all teeth show horizontal and vertical periodontal bone loss. Abb. 1 8 a Intraorale Ansicht und b Orthopantomogramm einer 50-jährigen Frau, die eine kieferorthopädische Behandlung wünschte und >10 Zigaretten pro Tag rauchte. Bei nahezu allen Zähnen zeigt sich ein horizontaler wie vertikaler periodontaler Knochenverlust
our study was that orthodontic forces combined with nicotine would involve greater loss of periodontal bone than nicotine alone. We tested this hypothesis both in vivo and in vitro— based on alveolar bone resorption in rats exposed to orthodontic forces and/or nicotine and based on periodontal ligament (PDL) fibroblasts exposed to nicotine with or without co-application of mechanical compression—in an effort to better understand the role of nicotine-induced bone loss in conjunction with orthodontic tooth movement.
Materials and methods Experimental animals and orthodontic loading
Animal experiments were in line with German animal welfare legislation and approved by the authority in charge (reference no. 54-2532.1-46/13). Fourteen male Fischer 344 inbred rats were used (Rattus norvegicus Berkenhout; Charles River Laboratories, Sulzfeld, Germany). The animals were 6 weeks old and weighed 173–202 g. They were kept in a conventional animal laboratory under constant environmental conditions at room temperature (21±1°C) with 55±10% relative humidity, using day/night cycles of 12 h each. They were acclimatized for 7 days prior to study entry and had ad lib access to tap water and standard dry-food pellets soaked to mush (V1535; Ssniff, Soest, Germany) throughout orthodontic force application [21]. The rats were randomly assigned to a nicotine and control group of 7 animals each. Those in the nicotine group received daily subcutaneous injections of L-nicotine (SigmaAldrich®, St. Louis, MO, USA) 1.89 mg/kg body weight from 10 days prior to orthodontic loading to the end of the study. Those in the control group were treated with phosphate-buffered 0.9% saline (pH=7.4). The first 5 days of medication were
[25]. Die Applikation kieferorthopädischer Kräfte bedeutet bei chronischen Rauchern eine Behandlung bei latenten parodontalen Entzündungsprozessen [18]. Trotz behandlungsbegleitender Mundhygienemaßnahmen kommt es bei Behandlungsende meist zu einer Verschlechterung der parodontalen Knochensituation, wenn es nicht gelingt, den Nikotinabusus des Patienten zu unterbinden (Abb. 1). Es stellt sich daher die Frage, ob die kieferorthopädische Zahnbewegung die parodontal destruktive Wirkung von Nikotin zusätzlich verstärkt und ob bei Rauchern besondere Vorsicht bei der Planung kieferorthopädischer Behandlungsmaßnahmen angezeigt ist. Unsere Hypothese lautet, dass eine kieferorthopädische Kraftapplikation unter gleichzeitiger Nikotinwirkung zu einer Steigerung des parodontalen Knochenabbaus und der parodontalen Entzündungsprozesse gegenüber der alleinigen Wirkung von Nikotin führt. Dazu untersuchten wir in vivo am Tiermodell Ratte den Einfluss von Nikotin und kieferorthopädischen Kräften auf Resorptionsprozesse am Alveolarfortsatz. In-vitro-Untersuchungen sollten die Rolle von Fibroblasten des Parodontalligamentes beim Nikotininduzierten parodontalen Knochenverlust mit und ohne simultane Kraftapplikation näher beleuchten.
Material und Methoden Tierhaltung und kieferorthopädische Behandlung
Der Tierversuch wurde mit behördlicher Genehmigung (Aktenzeichen: 54-2532.1-46/13) in Übereinstimmung mit dem deutschen Tierschutzgesetz durchgeführt. Die Versuchstiere wurden in einem konventionellen Tierlaboratorium unter konstanten Umweltbedingungen (21±1°C Raumtemperatur, 55±10% Luftfeuchtigkeit) in einem Tag-Nacht-Rhythmus von
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
197
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
designed as a run-in phase approaching the final dose in onefifth increments. After 10 days of premedication, using a technique modified from Kirschneck et al. [21], an orthodontic NiTi closed-coil spring (Sentalloy, item 10-000-26, GAC International, Gräfelfing, Germany) exerting 0.25 N was inserted by wire ligatures from the cervices of the upper first two molars (M1, M2) on the left side of the upper jaw to the base of the upper incisors for mesialization of either molar at a constant force of 0.125 N (Fig. 2a). Using a split-mouth design, a wire ligature was also placed around the M1 and M2 cervices on the contralateral right side. Following 28 days of tooth movement, the spring was removed, while the wire ligatures were left in place. Another 14 days later, the rats were sacrificed in line with legal regulations by intraperitoneal injection of pentobarbital sodium (200 mg/kg body weight, Narcoren®; Merial, Hallbergmoos, Germany). Following perfusion fixation by 250 ml of 4% phosphate-buffered formalin solution (pH 7.4) through the ascending aorta [23], the maxilla was prepared with a diamond-coated rotating disc.
Radiographic determination of bone loss
This method has been reported previously by Kirschneck et al. [21] and is illustrated in Fig. 2b. After obtaining cone-beam computed tomography (CBCT) scans of the prepared maxillae, the resultant datasets were blinded and the distance of the M1 and M2 cementoenamel junctions from the bony margin of the alveolar ridge measured on all four (buccal, oral, mesial, distal) aspects. The arithmetic mean of these eight measurements was used for statistical analysis. For good reproducibility of the measurements, two-dimensional planes were defined perpendicular to the palate, passing either through the center of the adjacent teeth (sagittal) or symmetrically through the center of either crown (transverse). The measurements were performed by two different examiners. Intra- and interrater reliability was assessed by repeating them after 2 weeks, applying Dahlberg’s formula (where d is the difference between two measurements and n the number of repeated measurements) to determine the measurement error [11].
Collection of periodontal ligament fibroblasts
The in vitro part of the study was based on PDL fibroblast lines derived from non-carious teeth that had been extracted for orthodontic reasons from four patients. PDL samples were scraped off the middle root thirds and reduced in size, followed by incubation in six-well culture plates in a water-saturated atmosphere (5% CO2) at 37°C for around 7–14 days until adherently growing PDL fibroblasts proliferated from the tissue (Fig. 2e, [40, 44]). The culture medium was high-glucose Dulbecco’s Minimal Essential Medium (PAA Laboratories, Pasching, Austria) supplemented with 10% fetal calf serum (PAA Laboratories), 1% L-glutamine (PAA Laboratories),
198
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
12:12 h gehalten und vor Versuchsbeginn 7 Tage akklimatisiert. Die Ernährung erfolgte über Leitungswasser und Standard-Trockenfutterpellets ad libitum (V1535, ssniff, Soest, Deutschland), die ab Beginn der kieferorthopädischen Behandlung zu einem Futterbrei eingeweicht wurden [21]. Für die tierexperimentelle Untersuchung verwendeten wir 14 männliche Fischer-344-Inzucht-Ratten (Alter: 6 Wochen, Körpergewicht: 173–202 g, Rattus norvegicus Berkenhout) aus den Charles River Laboratories (Sulzfeld, Deutschland), die randomisiert in 2 Gruppen eingeteilt wurden. Die Tiere der Nikotingruppe (n=7) erhielten 10 Tage vor Beginn der kieferorthopädischen Behandlung bis zum Versuchsende tägliche subkutane L-Nikotin-Injektionen (Sigma Aldrich®, St. Louis/MO, USA) in einer Dosis von 1,89 mg/kg Körpergewicht, während die Kontrolltiere (n=7) mit phosphatgepufferter 0,9%iger Kochsalzlösung (pH=7,4) behandelt wurden. Die ersten 5 Tage der Medikation wurde das Nikotin sukzessive in Schritten von 1/5 der Enddosis verabreicht. Nach 10 Tagen Vormedikation erfolgte modifiziert nach Kirschneck et al. [21] mittels Drahtligaturen die Insertion einer kieferorthopädischen NiTi-Zugfeder (0,25 N, Sentalloy®, GAC International, Gräfelfing, Deutschland, 10-000-26) zwischen dem Zahnhals des ersten (M1) und zweiten (M2) oberen linken Molaren und der Basis der oberen Schneidezähne der Ratte, was zu einer Mesialisation der beiden Molaren mit einer konstanten Kraft von 0,125 N pro Zahn führte (Abb. 2a). In einem Splitmouth-Modell wurde jeweils auf der rechten Oberkieferseite ebenfalls eine gemeinsame Drahtligatur um den Zahnhals des ersten und zweiten Molaren inseriert. Nach 28 Tagen Zahnbewegung wurde die Feder unter Beibehaltung der Drahtligaturen entfernt. Weitere 14 Tage später erfolgte die Tötung der Tiere mittels intraperitonealer Injektion von Pentobarbital-Natrium (200 mg/kg Körpergewicht, Narcoren®, Merial, Hallbergmoos, Deutschland) gemäß den gesetzlichen Richtlinien. Nach Perfusionsfixierung der Tiere über die Aorta ascendens mittels 250 ml einer 4%igen phosphatgepufferten Formalinlösung (pH=7,4) [23] wurde jeweils der Oberkiefer mittels einer rotierenden, diamantierten Trennscheibe präparativ gewonnen.
Messung des parodontalen Knochenabbaus durch DVT im Rattenmodell
Um die parodontale Knochensituation beurteilen zu können, führten wir analog zu Kirschneck et al. [21] 3dimensionale radiologische DVT-Aufnahmen der gewonnenen Oberkiefer durch und bestimmten nach Verblindung der Daten die Entfernung der Schmelz-Zement-Grenze des ersten und zweiten Molaren (M1/M2) vom knöchernen Limbus alveolaris jeweils an 4 Messstellen (bukkal, oral, mesial und distal; Abb. 2b). Der arithmetische Mittelwert der 8 Messungen wurde für die weitere statistische Auswertung herangezogen. Zur Reproduzierbarkeit der Messungen wurden 2-dimensionale Messebenen festgelegt, die senkrecht zur Ebene des Gaumens sagittal durch die Mitte der Zahnreihe bzw. transversal symmetrisch durch die Mitte der Zahnkrone des ersten bzw. zweiten Molaren ver-
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Fig. 2 8 a Experimental setup for orthodontic mesialization of the first two molars (M1, M2) on the left side of a rat’s maxilla, using a constant force of 0.25 N from a NiTi closed-coil spring. The contralateral right side was fitted with a non-loading wire ligature around M1/M2 for control. b A CBCT scan was used to measure the existing loss of periodontal bone based on the mean (from 8 sites per case) distance of the M1/M2 cementoenamel junction from the alveolar bone level. c, d Setup to simulate a constant force of 2 g/cm2 for orthodontic compression used on human periodontal ligament (PDL) fibroblasts. e Proliferation of adherently growing PDL fibroblasts from periodontal tissue samples of extracted human teeth (400×). The periodontal fibroblasts thus obtained were trypsinized on reaching confluence and were used for the cell experiments at a concentration of approximately 70,000 cells/well. f Osteoclast-like cells in histochemical TRAP staining (red) surrounded by undifferentiated RAW264.7 cells and PDL fibroblasts (400×). Abb. 2 8 a Experimentelles Setting für die Mesialisierung der ersten 2 Molaren (M1, M2) auf der linken Seite des Oberkiefers der Ratte. Eingesetzt wurde eine konstante Kraft (0.25 N) vermittelt durch eine NiTi-Zugfeder. An der kontralateralen rechte Seite eine Drahtligatur um M1/M2 als Kontrolle. b CBCT-Aufnahme, um den existierenden parodontalen Knochenverlust zu messen, auf der Basis der durchschnittlichen Distanz (von 8 Stellen pro Fall) der Zement-Schmelz-Grenze vom Niveau des Alveolarknochens. c, d Setting, um eine konstante Kraft von 2 g/cm2 für die kieferorthopädische Kompression auf humane PDL(“periodontal ligament”)-Fibroblasten zu simulieren. e Proliferation von adhärent wachsenden PDL-Fibroblasten aus parodontalen Gewebeproben extrahierter humaner Zähne (Vergr. 400:1). Die so gewonnenen parodontalen Fibroblasten wurden mit Erreichen der Konfluenz trypsinisiert und für die Zellexperimente in einer Konzentration von etwa 70.000 Zellen/Well verwendet. f Histochemisch TRAP-gefärbte osteoklastenähnliche Zellen (rot) umgeben von undifferenzierten RAW264.7-Zellen und PDL-Fibroblasten (Vergr. 400:1)
100 µmol ascorbic acid (Sigma-Aldrich®, St. Louis, MO, USA), and 1% antibiotics/antimycotics (PAA Laboratories). The cells were trypsinized as confluence was reached. The samples were collected after obtaining approval from the University of Regensburg institutional review board (reference no. 12-1700150) and informed consent from the donor patients in accordance with the Declaration of Helsinki.
Cell stimulation by compression and/or nicotine
These human PDL fibroblasts were seeded on six-well culture dishes at a cell density of 70,000 cells per well and assigned to one of eight groups: z one control group incubated without stimulation for 48 h, z three experimental groups stimulated with 3, 5, or 7.5 µmol of L-nicotine (Sigma-Aldrich®) for 48 h with no mechanical forces involved, z one group preincubated for 24 h and subjected to compressive forces (2 g/cm2) using an established model [37] for another 24 h (Fig. 2c, d), and
liefen. Die Messungen wurden zur Beurteilung der Intra- und Interrater-Reliabilität im Abstand von 2 Wochen wiederholt und von 2 verschiedenen Untersuchern durchgeführt. Der Messfehler wurde mittels der Dahlberg-Formel ermittelt
(; d = Unterschied zwischen 2 Messungen; n = Zahl der wiederholten Messungen) [11].
Gewinnung von parodontalen Fibroblasten
Für die zellbiologischen Versuche wurden PDL-FibroblastenZelllinien von 4 verschiedenen Patienten verwendet. Von kieferorthopädisch extrahierten kariesfreien Zähnen wurden Anteile des Desmodonts vom mittleren Drittel der Zahnwurzel abgeschabt, zerkleinert und in 6-Well-Zellkulturplatten für etwa 7–14 Tage in 5% CO2/Luft und wassergesättigter Atmosphäre bei 37°C inkubiert, bis adhärent wachsende PDL-Fibroblasten aus dem Gewebe proliferierten (Abb. 2e, [40, 44]). Als Zellkulturmedium verwendeten wir Dulbecco’s Minimal Es-
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
199
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
z three experimental groups that were prestimulated with 3, 5, or 7.5 µmol of L-nicotine for 24 h and incubated further in the presence of compression (2 g/cm2) co-applied with these respective nicotine doses. All experiments were performed in several repeated runs under cell-culture conditions inside an incubator in a watersaturated atmosphere with 5% CO2 at 37°C.
RANKL/OPG/COX-2/IL-6 detection at the transcriptional (mRNA) level by qRT-PCR
Total RNA was isolated by lysing the PDL fibroblasts with 1 ml of Tri-Reagent® (Sigma-Aldrich®), purified according to the manufacturer’s protocol, and dissolved in 20 µl of nucleasefree water for photometric assessment at 260 nm using a fiberoptic cuvette (TrayCell®; Hellma, Müllheim, Germany) in an ultraviolet-visible (UV-Vis) spectrophotometer (Genesys™ 10S; Thermo Scientific). cDNA was obtained in a 20-µl assay using 1 µg of total RNA, 20 pmol of an oligo-dT25 and random hexamer primer (Eurofins, Ebersberg, Germany), 0.2 mmol of dNTP-Mix (Thermo Scientific), and 200 U of reverse transcriptase (M-MLV; Promega, Fitchburg, WI, USA). This assay was incubated in a thermocycler at 42°C for 1 h, followed by heat inactivation of the reverse transcriptase at 95°C for 5 min at the end of the reaction. Fluorescence thresholds (CT values) were amplified/detected using a Mastercycler® ep realplex-S thermocycler (Eppendorf, Hamburg, Germany) and target genes amplified by 10 µl 2× SYBR® Green JumpStart™ Taq ReadyMix (Sigma-Aldrich®), a primer pair used at 25 pmol per primer (Eurofins MWG Operon; see Tab. 1), 1 µl of cDNA, ad 20 µl of H2O. The PCR program started out by denaturation at 95°C for 10 min, followed by 45 cycles of quantitative real-time polymerase chain reaction (qRT-PCR) at 95°C for 15 s, 60°C for 8 s, and 72°C for 8 s. Agarose gel electrophoresis was used to verify the specific amplification products of the target genes (PCR specificity). Then the gene expression of receptor activator of nuclear factor κB ligand (RANKL), osteoprotegerin (OPG), cyclooxygenase-2 (COX-2), and interleukin-6 (IL-6) was determined using the 2-ΔΔCT method as described by Livak and Schmittgen [31], also taking into consideration amplification efficiency. Normalization of gene expression was based on the large RNA polymerase-2/polypeptide-A major (Pol2RA, housekeeping gene) subunit.
IL-6 and PGE2 quantitation at the translational (protein) level by ELISA
To determine the concentrations of IL-6 and prostaglandin E2 (PGE2), the culture supernatant was removed following stimulation of the human PDL fibroblasts, shock-frozen in liquid nitrogen (−196°C), and stored at −80°C. For PGE2 quantitation, a PGE2 enzyme-linked immunosorbent assay (ELISA) kit (Novus Biologicals®, Littleton, CO, USA) was used and the concentrations measured as per the manufacturer’s instructions using an ELISA spectrophotometer (Multiskan™ Go; Thermo Scientific). IL-6 levels were quantified by immunoassay (Immulite® 2000; Siemens Healthcare, Erlangen, Ger-
200
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
sential Medium (High Glucose, PAA Laboratories, Pasching, Österreich), welches mit 10% fötalem Kälberserum (PAA), 1% L-Glutamin (PAA), 100 µM Vitamin C (Sigma-Aldrich®) und 1% Antibiotika/Antimykotika (PAA) supplementiert war. Mit Erreichen der Konfluenz erfolgte die Trypsinierung der Zellen. Die Gewinnung des Probenmaterials erfolgte mit Genehmigung der zuständigen Ethikkommission (Aktenzeichen: 12170-0150) der Universität Regensburg und informierter Zustimmung der Spenderpatienten unter Einhaltung der Deklaration von Helsinki.
Stimulation der PDL-Zellen mit mechanischen Kräften und Nikotin
Für den In-vitro-Versuch wurden die humanen PDL-Fibroblasten jeweils in 6-Well-Zellkulturplatten mit einer Zelldichte von 70.000 Zellen pro Well ausgesät und folgende Versuchsgruppen (n=6) gebildet: z Eine unbehandelte, für 48 h unter Zellkulturbedingungen inkubierte Untersuchungsgruppe diente als Kontrollgruppe. z Drei Untersuchungsgruppen wurden mit jeweils 3, 5 und 7,5 µM L-Nikotin (Sigma-Aldrich®) für 48 h stimuliert. z Eine Untersuchungsgruppe wurde für 24 h unter Zellkulturbedingungen vorinkubiert erhielt für 24 h eine mechanische Stimulation durch Kompressionskräfte (2 g/cm2) mittels eines etablierten Modells ([37], Abb. 2c, d). z Drei Versuchsgruppen wurden zunächst für 24 h mit jeweils 3, 5 und 7,5 µM L-Nikotin vorstimuliert und anschließend unter Kompression (2 g/cm2) und Nikotin für 24 h weiter inkubiert. Die Durchführung aller Experimente, die mehrmals reproduziert wurden, erfolgte unter Zellkulturbedingungen in einem Inkubator (37°C, 5% CO2, wassergesättigte Luft).
Genexpressionsanalyse von RANKL/OPG/COX-2 und IL-6 mittels qRT-PCR
Für die Isolation der Gesamt-RNA wurden die PDL-Fibroblasten mit 1 ml Tri-Reagent® (Sigma-Aldrich®) lysiert. Die Aufreinigung der Gesamt-RNA erfolgte nach dem Standardprotokoll des Herstellers. Die aufgereinigte RNA wurde in 20 µl nukleasefreiem Wasser gelöst und zur Quantifizierung photometrisch bei 260 nm mittels einer TrayCell® Küvette und einem Genesis™ 10S UV-Vis Spektrophotometer (Thermo Fisher Scientific, Waltham/MA, USA) vermessen. Für die Herstellung der cDNA wurden in einem 20 µl Ansatz eine GesamtRNA-Menge von 1 µg, je 20 pmol von einem Oligo-dT25- und Zufallshexamerprimer (Eurofins, Ebersberg, Deutschland), 0,2 mM dNTP-Mix (Thermo Scientific, Waltham/MA, USA) und 200 U reverse Transkriptase (M-MLV, Promega, Fitchburg/WI, USA) verwendet. Dieser Ansatz wurde bei 42°C für 1 h in einem Thermocycler inkubiert. Die Inaktivierung der reversen Transkriptase am Reaktionsende erfolgte durch Hitzeinaktivierung (95°C, 5 min). Die Amplifikation und Detektion der Fluoreszenzschwellenwerte (CTValues) erfolgte in Tripletts für jede cDNA mit dem Mastercycler® ep realplex-S Thermocycler (Eppendorf, Hamburg,
Kirschneck et al. Orthodontic loading and nicotine-induced bone loss
Tab. 1 Overview of the intron-spanning primers used in the qRT-PCR experiments. Tab. 1 Überblick über die in den qRT-PCR Experimenen verwendeten “intron-spanning” Primer Gene
Accession number
5’-forward primer-3’
5’-reverse primer-3’
COX-2 (PTGS2) IL-6 OPG (Tnfrsf11b) RANKL (Tnfsf11) Pol2RA
NM_000963 NM_000600.3 AF134187.1 AF019047 NM_000937.3
cttcacgcatcagttttt caggagcccagctatgaact tgattcatgtaggagaattaaacagg gatgtgctgtgatccaacga ttgtgcaggacacactcaca
tcaccgtaaatatgatttaagtccac agcaggcaacaccaggag gatgtgctgtgatccaacga gcaaactgtatttcgctctgg caggaggttcatcacttcacc
All PCR primers were used at an annealing temperature of 60°C qRT-PCR quantitative real-time polymerase chain reaction, COX-2 cyclooxygenase-2, IL-6 interleukin-6, OPG osteoprotegerin, RANKL receptor activator of nuclear factor kappa-B ligand, Pol2RA polymerase-2/polypeptide-A.
many) performed at the University of Regensburg Institute of Clinical Chemistry and Laboratory Medicine.
Analysis of osteoclastogenesis by co-culture of PDL fibroblasts with RAW264.7 cells
To assess how nicotine and mechanical stressing would affect monocyte/macrophage differentiation to osteoclast-like cells, human PDL fibroblasts were subjected to 24 h of static compression (2 g/cm2) either alone or together with nicotine 7.5 µmol. After this incubation period and washing the cells with PBS, they were additionally co-cultured with 60,000 murine immortal macrophages (RAW264.7; CLS Cell Lines Service, Eppelheim, Germany) per well for 72 h. Differentiation to osteoclast-like cells was demonstrated histochemically by tartrate-resistant acid phosphatase (TRAP) staining— which causes intense red staining of osteoclast-like cells—as described by Barka and Anderson ([1], Fig. 2f) and based on morphological criteria like multiple nuclei or cell size at 400x magnification (BX45TF; Olympus® Germany, Hamburg, Germany). A blinded examiner quantified the cells identified in this manner on a per-well basis.
Statistical analysis
Using the software application SPSS® Statistics 21 (IBM®, Armonk, NY, USA), all data were tested for normal distribution (Shapiro-Wilk test) and homogeneity of variance (Levene’s test). Descriptive statistics are given as mean±standard deviation. The experimental groups were independently compared by one-way ANOVAs, which, except for the CBCT data, were validated by applying Welch’s test since homogeneity of variance was absent. Post hoc tests using either the Games–Howell approach for heterogeneous variances (gene expression/ ELISA) or Gabriel’s for dissimilar group sizes (CBCT data) were used for pairwise comparisons. Two-sided independent t-tests were used to analyze weight developments and the results of PDL/RAW264.7 co-culture, in the latter case after logarithmic transformation of the data (ln) for homogenization of variances. All differences were considered statistically significant at p≤0.05. Clinical relevance was evaluated via effect sizes by calculating Pearson’s correlation coefficients (r), >0.5 indicating large, >0.3 medium, and >0.1 small differences of mean values or effects. Dahlberg’s measurement error for the CBCT
Deutschland). Für die Amplifikation der Zielgene wurden 10 µl 2× SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich®), jeweils 25 pmol eines Primerpaars (Eurofins, Tab. 1), 1 µl cDNA, ad 20 µl H2O verwendet. Das PCR-Programm wurde mit einer initialen Denaturierung (10 min bei 95°C) mit anschließend 45 PCR-Zyklen mit 95°C für 15 s, 60°C für 8 s und 72°C für 8 s durchgeführt. Die spezifische Amplifikation der Zielgene wurde mittels Agarose-Gelelektrophorese überprüft. Die Bestimmung der Genexpression erfolgte mittels der 2−∆∆CT-Methode nach Livak u. Schmittgen [31] und unter Berücksichtigung der Amplifikationseffizienz. Zur Normalisierung der Genexpression verwendeten wir das Transkript der großen Untereinheit der RNA-Polymerase 2/Polypeptid A (Pol2RA, housekeeping gene).
Quantitative Bestimmung von IL-6 und PGE2 im Zellkulturüberstand mittels ELISA
Zur Bestimmung der IL-6- und PGE2-Konzentration wurde der Zellkulturüberstand der humanen PDL-Fibroblasten nach der Stimulation der Zellen abgenommen, in flüssigem Stickstoff (−196°C) schockgefroren und bei −80°C gelagert. Für die Bestimmung der PGE2-Konzentration verwendeten wir ein PGE2-ELISA-Kit (Novus Biologicals®, Littleton/CO, USA). Die Messung der PGE2-Konzentration erfolgte nach Herstellerangaben an einem ELISA-Plattenlesegerät (Multiskan™ Go, Thermo Scientific). Die Bestimmung der IL-6-Konzentration erfolgte am Institut für Klinische Chemie und Laboratoriumsmedizin der Universität Regensburg mit dem Immulite® 2000 Immunoassay System (Siemens, Healthcare Sector, Erlangen, Deutschland).
Bestimmung der Osteoklastogenese durch eine PDL-Fibroblasten/RAW264.7-Kultur
Um die Wirkung von mechanischer Kraftapplikation und Nikotin auf den Differenzierungsvorgang von Monozyten/Makrophagenzellen in osteoklastenähnliche Zellen zu analysieren, bildeten wir 2 Versuchsgruppen mit humanen PDL-Fibroblasten. Diese wurden entweder mit statischer Kraftapplikation von 2 g/cm2 bzw. zusätzlich mit 7,5 µM Nikotin für 24 h stimuliert. Nach dieser Inkubationsdauer wurden die Zellen mit PBS gewaschen und zusätzlich mit murinen immortalen RAW264.7-Zellen (Makrophagen-Zelllinie, CLS Cell Lines Service, Eppelheim, Deutschland) in einer Konzentration von
J Orofac Orthop 2015 · No. 3 © Springer-Verlag Berlin Heidelberg
201
Mean distance of M1/M2 cementoenamel junction from alveolar bone level (mm)
Kirschneck et al. Kieferorthopädische Kräfte verstärken nikotin-induzierten parodontalen Knochenverlust
0.55
PBS (buffered 0.9% NaCI solution) nicotine (1.89 mg/kg BW/day s.c.)
orthodontic force * p = 0.025
25g (M1&M2)
0.50 * p = 0.05
0.45
periodontal breakdown
nicotine
0.40
0.35
increased periodontal breakdown 25g
0.30
(M1&M2) p < 0.001 ***
0.25
control
(wire ligature)
orthod. force (+ wire ligature)
nicotine
(+ wire ligature)
nicotine + orthodontic force
nicotine + force (+ wire ligature)
a
b
Fig. 3 8 a Periodontal bone loss in the rat model under the action of nicotine and orthodontic force. b Three-dimensional surface models created from the CBCT data of the rat’s upper molar area: the orthodontic force with co-administration of nicotine caused a distinct increase in periodontal bone loss compared to the nicotine group without force application. (*p≤0.05; ***p≤0.001). Abb. 3 8 a Parodontaler Knochenverlust im Rattenmodell unter der Einwirkung von Nikotin und kieferorthopädischer Kraft. b 3-D-Oberflächenmodelle, geformt nach den CBCT-Daten des oberen Molarenbereichst: Die kieferorthopädische Kraft in Koadministration mit Nikotin verursachte eine im Vergleich zur Gruppe mit Nikotin ohne Kraftapplikation deutliche Erhöhung des parodontalen Knochenverlusts (*p≤0,05; ***p≤0,001).
data was within the accepted 5% limits of the intra- or interrater mean value.
Results Weight development and dropouts
The 7 control rats were found to considerably gain weight from a mean of 265±6 g at the time of spring insertion (day 0) to 298±8 g when they were sacrificed 6 weeks later. One of the 7 nicotine rats died on day 35, which left 6 animals for statistical analysis, which also considerably gained weight from day 0 (mean: 246±10 g) to day 42 (mean: 260±9 g). At both points in time, however, their weight was significantly lower than in the control group (t=4.508 or 7.692; df =12 or 11; p=0.001; r=0.79 or 0.92).
Periodontal bone loss in the rat model
The difference in terms of nicotine effects on the bone surrounding the first two upper molars (M1/M2) was significant between both groups of animals (F3,22 =14.115; p
