Materials Science and Engineering C 52 (2015) 194–203

Contents lists available at ScienceDirect

Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec

Osteoblast response to porous titanium and biomimetic surface: In vitro analysis Renata Falchete do Prado a,⁎, Fernanda Saraiva de Oliveira a, Rodrigo Dias Nascimento b, Luana Marotta Reis de Vasconcellos a, Yasmin Rodarte Carvalho a, Carlos Alberto Alves Cairo c a Department of Bioscience and Oral Diagnosis, Institute of Science and Technology, UNESP — Univ Estadual Paulista, São José dos Campos (SP), School of Dentistry, Av. Engenheiro Francisco José Longo, 777, São José dos Campos 12245-000, SP, Brazil b Department of Diagnosis and Surgery Institute of Science and Technology, UNESP — Univ Estadual Paulista, São José dos Campos (SP), School of Dentistry, Av. Engenheiro Francisco José Longo, 777, São José dos Campos 12245-000, SP, Brazil c Division of Materials, Air and Space Institute, CTA, Praça Mal. do Ar Eduardo Gomes, 14, São José dos Campos 12904-000, SP, Brazil

a r t i c l e

i n f o

Article history: Received 13 November 2014 Received in revised form 21 January 2015 Accepted 22 March 2015 Available online 24 March 2015 Keywords: Titanium Hydroxyapatite Osteoblasts Gene expression Biocompatibility

a b s t r a c t Objective: This study analyzed the behavior of human osteoblasts cultured on porous titanium specimens, with and without biomimetic treatment, compared to dense titanium. Design: The experiment had seven groups: Group 1: cells cultured on polystyrene of culture plate wells; Group 2: cells cultured on dense titanium specimen; Group 3: specimen with 33.79% of pores; Group 4: 41.79% of pores; Groups 5, 6 and 7: specimens similar to groups 2, 3 and 4, yet with biomimetic treatment. Real time-polymerase chain reaction with reverse transcription of the following genes was performed: prostaglandin E2 synthase, integrin β1, osterix, Runx2, Interleukin 6, macrophage colony stimulating factor, apolipoprotein E and others. The study achieved data on cell adhesion, growth and viability, total protein content, alkaline phosphatase activity and quantity of mineralized nodule formations. Data were statistically evaluated. Results: Adherent cells and alkaline phosphatase activity were similar in titanium specimens, regardless of the groups. Biomimetic treatment reduced the total protein activity and the viability of tested cells. Most tested genes had statistically similar expression in all groups. Conclusion: The tested porosities did not cause alterations in osteoblast behavior and the biomimetic treatment impaired the biocompatibility of titanium causing cytotoxicity. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The exact mechanisms through which the surface topography of implants may influence the osseointegration are not yet fully elucidated. The ideal microarchitecture for a greater efficacy of cell events has been subject of several studies [1–3], also relating the success or failure of dental implants with chemical [2,4–6] and biological properties [2,7, 8] of their surfaces, as well as their micromorphology. Thus, surface characteristics of the biomaterial such as roughness, porosity, surface energy [2,7] and presence of hydroxyapatite crystals [9] are determinant for the initial interaction of cells. The surface topography of the biomaterial and its chemical characteristics will determine the adsorption of biomolecules, and their orientation on the surface has direct consequences on cell recruitment, adhesion, proliferation and differentiation.

⁎ Corresponding author at: Departamento de Biociências e Diagnóstico Bucal, Av. Engenheiro Francisco José Longo, 777, Jardim São Dimas, São José dos Campos, São Paulo CEP 12245000, Brazil. E-mail address: [email protected] (R.F. Prado).

http://dx.doi.org/10.1016/j.msec.2015.03.028 0928-4931/© 2015 Elsevier B.V. All rights reserved.

The morphology of pores, their size, and the porosity and chemical composition of porous implants are basic parameters affecting the biochemical properties, biocompatibility and bioactivity of titanium. It is well accepted that the ideal size of pores for bone growth is within 200 and 500 μm, and they should be interconnected to allow the necessary organization of the vascular system for bone development [10,11]. In 1996, the studies of Kim et al. [12] and Kokubo et al. [13] demonstrated a chemical method for titanium treatment that promotes apatite deposition on its surface, aiming to induce bioactivity for utilization in endosseous implants, which was named biomimetic treatment. According to Chen et al. [11], the apatite covering has received great attention because it combines the advantages of biomechanical properties of titanium with the biological affinity of the underlying bone to hydroxyapatite, making it a promising tool to change the surfaces of biomaterials and for tissue engineering. Since the genetic phenomena associated with titanium osseointegration are not fully elucidated [14–19] and considering that most studies evaluated different properties according to the type of dense implant surfaces, this study was designed to evaluate the porous titanium with surface change by biomimetic treatment. This in vitro

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

study evaluated and compared the osteoblast response to titanium specimens with different porosities, submitted or not to biomimetic treatment, as well as dense titanium specimens, analyzing the cell behavior based on the genic expression, cell adhesion, proliferation and viability, total protein content, alkaline phosphatase activity and quantification of mineralized nodule formations.

2. Material and methods The porous titanium specimens were fabricated using pure titanium grade II powder with 8 μm granules, obtained by the hydrogenation/dehydrogenation technique (HDH) and urea (J.T. Baker. 99.6%) — organic additive used as spacer. The dense titanium specimens were fabricated using only pure titanium grade II. Seven groups were delineated, as follows: a) Group 1 — control: cells in contact with the bottom of polystyrene culture plate wells; b) Group 2 — cells in contact with dense titanium specimens; c) Group 3 — cells in contact with specimens with 33.79% of pores with 300 μm diameter; d) Group 4 — cells in contact with specimens with 41.79% of pores with 300 μm diameter; e) Group 5 — cells in contact with specimens of group 2 submitted to biomimetic treatment; f) Group 6 — cells in contact with specimens of group 3 submitted to biomimetic treatment; and g) Group 7 — cells in contact with specimens of group 4 submitted to biomimetic treatment. The specimens were disks measuring 12 mm diameter × 2.5 mm height, fabricated using a mixture of titanium powder and urea, compacted in an uniaxial press (Carver Laboratory Press Wabash, UK) using 0.7 tons and cold isostatic pressing (Paul Weber Maschinen — u Apparaebau Fuhrbachstrabe Remshalden Grunbach) at 200 MPa. The urea was removed in a vacuum oven (Marconi, Piracicaba, São Paulo, Brazil) at 200 °C for 2 h. The titanium was sinterized in a vacuum furnace (Thermal Technology, California, USA) at 10− 7 Torr, with a heating rate of 10 °C/min and maintaining a temperature of 1200 °C for 1 h. The titanium density was calculated by the geometric method, considering formulas of cylinder volume (Vol. = Π·r2·h) and density (Den = Mass / Volume) for all dense specimens, yielding a density of 4.399504 g/cm2 and standard deviation of 0.070574 g/cm2, compatible with the titanium density described in the literature [20]. The porous specimens were submitted to the same measurements for calculation of porosity by total volume. Specimens fabricated with titanium and urea at a mass ratio of 8:2 presented mean 33.79 ± 1.69% and those at a ratio of 8:3 had mean 41.79 ± 1.17% of porosity. Half of the specimens of each type were submitted to biomimetic treatment according to the following steps: a) alkaline treatment of specimens with NaOH solution (1 mol/L) in a vertical autoclave — Fanem (São Paulo, Brazil) at 130 °C for 60 min; b) thermal treatment in a tubular oven EDG 3P-S-1800 (São Carlos, Brazil) at 200 °C for 60 min; and c) immersion of specimens in modified simulated body fluid (FCS), changed at every 2 days and removed after a period of 14 days. The FCS solution was prepared using the reagents NaCl (7.94 g); NaHCO3 (0.353 g); NaHPO4·7H2O (0.245 g); MgCl2·6H2O (0.305 g); KCl (0.372 g); CaSO4·2H2O (0.086 g); and CaCl2 (0.200 g), for a final volume of 1000 mL, a modification proposed by Andrade et al. [21] at pH 7.4. All specimens were cleaned and sterilized with 20KGY of gamma radiation by Embrarad-Empresa Brasileira de Radiações LTDA (Cotia, São Paulo, Brazil). Five specimens in each group were analyzed by metallographic analysis as to the surface proportion, morphology and interconnection of pores. Specimens submitted to biomimetic treatment were evaluated by X-ray diffraction to identify the crystalline structures deposited on the surface of specimens. A scanning electron microscope (Carl Zeiss do Brasil and Oxford Microanalysis Group, UK) was used for cellular and microtopography characterization of: morphology and interconnection of pores at 100× magnification in five photographed fields, randomly distributed on the surface of porous specimens. The software

195

Image J (NIH) was used to binarize the image of surface pores and calculate their percentage per area. This study was approved by the Institutional Review Board of São José dos Campos School of Dentistry-UNESP under protocol n. 029/ 2010-PH/CEP and was performed after explanation and signature of a consent form by the donors. The entire study was conducted on material obtained from three randomly selected donors (biological triplicate — three independent experiments), regardless of gender and age, who were submitted to tooth extraction with regularization of mandibular anterior alveolar ridge and extraction of maxillary molars with regularization of the interradicular septum. The bone explants were kept in a supplemented total medium (MTS–α-MEM), supplemented with 10% of fetal bovine serum (Gibco–Invitrogen Corporation, New York, USA), 50 μg/mL of gentamicin, 0.3 μg/mL of fungizone, 10−7 M of dexamethasone (Sigma-Aldrich St Louis MO, USA), 5 μg/mL of ascorbic acid (Mallinckrodt Chemicals, Phillipsburg, UK) and 7 mM of beta-glycerophosphate (Sigma-Aldrich St Louis MO, USA), in a CO2 chamber (Ultrasafe HF 212UV Instrulab, São Paulo, Brazil). The osteogenic cells were isolated by sequential enzyme digestion of bone fragments with type II collagenase (Gibco-Invitrogen Corporation, New York, USA), as previously described [22,23]. Isolated cells and explants were maintained in a humid chamber at 5% of CO2 and 37 °C, with a medium change at every 72 h for nearly 15 days, when cell confluence occurred. The cells were enzymatically removed using 0.25% of trypsin (GibcoInvitrogen Corporation, New York, USA), EDTA 1 mM (Invitrogen, California, USA) and collagenase II, centrifuged, resuspended, and counted in a Neubauer chamber. Cells at passage 3–7 were plated on sterile titanium specimens in 24-well polystyrene plates (Corning Incorporated, New York, USA), at a density of 20,000 cells/well. Trypan Blue solution, (Sigma Aldrich St. Louis MO USA), was used to assess cell viability. Only viable cells were counted in Neubauer chamber and plated or used in data collection.

2.1. Molecular analysis The genic expression of alkaline phosphatase, osteocalcin, osteopontin, osteonectin, bone sialoprotein II, collagen-1, Runx2, osterix, prostaglandin E2 synthase, transforming growth factor-β (TFG-β), integrin β-1, Interleukin 6, macrophage colony stimulating factor (MCS-F), apolipoprotein and a housekeeping was evaluated at 7 and 14 days. RNA extraction was performed with Trizol Reagent (Ambion®, Life Technologies Corporation, Van Allen Way, Carlsbad, California, USA), according to the manufacturer's instructions. The concentrations and purity of RNA specimens were determined by optical density in a spectrophotometer Nano Drop 2000 (Thermo Fisher Scientific Inc. — Wilmington, DE 19810, USA). Values of A260/A280 between 1.7 and 2.0 were accepted. Following, the quality and integrity of RNA were evaluated in agarose by electrophoresis and all specimens presented intact 18S and 28S bands in the electrophoresis gel. To eliminate possible contaminations by genomic DNA, the RNA was purified using the commercial kit Deoxyribonuclease I, Amplification Grade (Invitrogen® Life Technologies Corporation, Van Allen Way, Carlsbad, California, USA), following the manufacturer's instructions. The cDNA synthesis was performed by reverse transcription reactions following the manufacturer's instructions of the commercial kit SuperScript III, First-Strand Synthesis Supermix (Invitrogen Life Technologies Corporation-Van Allen Way, Carlsbad, California, USA). The RT-PCR conditions for each gene were standardized with efficiency and melting curves, always following instructions provided by the manufacturer of the system Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen Life Technologies Corporation-Van Allen Way, Carlsbad, California, USA) and on melting temperatures of primers

196

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

with a calibration specimen. Efficiencies between 85% and 105% and correlation coefficients of 0.995 or more were accepted. The cDNA was used for real time PCR with the detection system Line Gene K Real Time PCR Detection System (Bioer Technology Hi-tech Binjiang District, Hangzhou, P.R. China), using specific SYBER Green and Primers (Table 1). The RT-PCR reactions were performed in duplicate at the experiment day and repeated in biological triplicate. After the RT-PCR reactions, the Ct values of specimens were used for relative quantification by the comparative method of ΔΔCt [24], in which the genic expression occurs in relation to the constitutive gene and is then normalized by its expression in a control specimen (bottom of polystyrene plate). 2.2. Cell adhesion test After cell culture for 24 h, the specimens were trypsinized, counted in a Neubauer chamber and the values were expressed as mean percentages in relation to the initial number of cells per group. 2.3. Cell growth test Cell growth was analyzed after 24 h, 3, 7 and 10 days of contact with specimens from each group by trypsinization and counting in a Neubauer chamber, and values were expressed as the mean absolute number of cells per group. 2.4. Cell viability test After being cultured for 3, 7, and 10 days, MTT colorimetric assay was performed with incubation in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M5655 Sigma-Aldrich St Louis MO, USA), then the cells were lysed with a propanol acid solution (2-Propanol

Sigma-Aldrich St Louis MO, USA) for colorimetric measurement in a spectrophotometer (570 nm with correction at 650 nm) (EL 808 BioTek Instruments, Winooski, USA). The values were expressed in percentage of viable cells compared to the control group. 2.5. Total protein content The total protein content was calculated after 7, 10 and 14 days of culture, according to the modified Lowry method [25]. Proteins were extracted with 0.1% sodium dodecyl sulfate (Sigma-Aldrich St Louis MO, USA), followed by addition of Lowry solution (Sigma-Aldrich St Louis MO, USA). The extract was diluted in Folin–Ciocalteu reagent (Sigma-Aldrich St Louis MO, USA) and the absorbance was assessed in a spectrophotometer (8582 Micronal, São Paulo, Brazil) at 680 nm. The total protein content was calculated from a bovine serum albumin standard and expressed in μg/mL. 2.6. Alkaline phosphatase activity (ALP) The alkaline phosphatase activity was determined on the same aforementioned lysates, by the release of thymolphthalein by hydrolysis of the thymolphthalein monophosphate substrate, using a commercially available kit (Labtest Diagnóstica SA — Ref. 40, Lagoa Santa, Minas Gerais, Brazil) following the manufacturer's instructions. Absorbance was measured in a spectrophotometer at 590 nm and the alkaline phosphatase activity was calculated based on a standard curve for expression as μmol thymolphthalein/min/mL. 2.7. Quantification of mineralized nodule formations After 14 and 21 days, the cultures received Hank's solution (H6136 Sigma-Aldrich St Louis MO, USA) and 4.2% alizarin S red dye (Sigma-

Table 1 Sequence of sense and antisense primers and their melting temperatures, size of amplification in base pairs, and reference. Gene

Primers sense; antisense

Primer melting temperature (°C)

Product size

FASTA PUBMED

Beta-actin

AAACTGGAACGGTGAAGGTG GTGGACTTGGGAGAGGACTG GAGTCAACGGATTTGGTCGT TGGGATTTCCATTGATGAAC TGCTCGAGATGTTGATGA TCCCCTGTTGACTGGTCATT CCACGTCTTCACATTTGGTG AGACTGCGCCTGGTAGTTGT AGCAGAGCGACACCCTAGAC GGCAGCGAGGTAGTGAAGAG AGACACATATGATGGCCGAGG GGCCTTGTATGCACCATTCAA GCAGTAGTGACTCATCCGAAGAA GCCTCAGAGTCTTCATCTTCATTC ACTGGCTCAAGAACGTCCTGGT TCATGGATCTTCTTCACCCGC ACAGCCGCTTCACCTACAGC GTTTTGTATTCAATCACTGTCTTGCC GAACTGGGCCCTTTTTCAGA CACTCTGGCTTTGGGAAGAG GCCATTCTGGGCTTGGGTATC GAAGCCGGAGTGCAGGTATCA GAAGAAGGCCTTTGCCAA GGAAGACCAGGAAGTGCA TTTGATGTCACCGGAGTTGTG GCGAAAGCCCTCAATTTCC TTCTTCCTGGACTATTGAAAT AGAAACTCTCATCATGCTCATT CAATAACCACCCCTGAC TTGTCATGTCCTGCAGCCACT GAGCTGCTTCACCAAGGATTATG TCTTGACCTTCTCCAGCAACTG CACTGTCTGAGCAGGTGCAG TCCAGTTCCGATTTGTAGGC

55.4 57.1 52.5 48.7 46.5 52.5 54.2 58.8 57.5 58.8 56.7 55.9 56.4 55.2 60.7 57.1 60.1 55.0 55.3 55.6 58.3 59.2 53.2 54.6 55.4 54.6 48.9 51.9 49.8 59.3 55.9 56.9 58.2 54.8

206

NM_001101.3

201

NM_002046.6

192

NM_000192.2

196

NM_000478.4

194

NM_001199662.1

154

NM_001251830.1

121

NM_004967.3

97

NM_003118.3

85

NM_000088.3

GAPDH HPRT Alkaline phosphatase Osteocalcin Osteopontin Bone sialoprotein Osteonectin Collagen 1 Runx2 Osterix Prostaglandin E2 synthase TFG-β1 Integrin Β-1 Interleukin 6 M-CSF Apolipoprotein E

208

NM_001015051

129

NM_001173467.1

200

NM_004878.4

63

NM_000660.4

100

NM_002211.3

84

NM_000600.3

92

NM_172211.3

112

NM_000041.2

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

197

Aldrich St Louis MO, USA). Quantification was performed as previously described [26], with addition of 10% acetic acid, centrifugation at 12,000 rpm, neutralization with 10% ammonium oxide and reading in a spectrophotometer at 405 nm. The values were expressed as the colorimetric absorbance obtained. 2.8. Statistical analysis The metallographic data were submitted to the Student t test. Data of culture experiments were tested by two-way analysis of variance (ANOVA) followed by the Tukey test for multiple comparisons in case of statistical significance. All tests were applied at a significance level of 5%. 3. Results The morphology and interconnection of pores were demonstrated by scanning electron microscopy (SEM) (Fig. 1). Pores of varied sizes were observed, including micropores, mesopores and macropores. Both dense and porous specimens submitted to biomimetic treatment demonstrated flaky whitish deposits on the SEM analysis (Figs. 2 and 3). Biomimetic treatment did not alter the interconnection of pores. The mean surface porosity (SEM metallographic analysis) presented significant difference compared to the mean obtained by geometric analysis per volume and mass of specimens. The surface porosity percentage was 32.5% (± 7.74%) for the 33.79% group and significantly lower, namely 37.4% (±7.95%), for the 41.79% group. With the data obtained from the XRD pattern, by comparisons with reference files, existing: International Centre for Diffraction Data Sample of the components of hydroxyapatite; the XRD data of the biomimetic covered samples showed the presence of reflections typical of the HA coating (Fig. 4). Particularly observing peaks in positions near 40 and 50 [o2 theta] (copper (Cu)). Cells cultured in biomimetic surfaces were sparsely distributed on pores whereas cell cultures in porous and dense titanium without any surface treatment spread cells were more abundant and had bigger volume (Figs. 5 and 6).

Fig. 2. SEM of porous specimen with biomimetic treatment presenting flaky granule deposits on the surface of treated specimens.

The specimens were submitted to real-time polymerase chain reaction (RT-PCR) for three endogenous genes, beta-actin, HPRT1 and GAPDH, for selection. Beta-actin was the less variable and thus was used as housekeeping in each run of reactions, to calculate the relative quantification.

The relative quantification corresponds to the number of times the gene is expressed in relation to the control group (bottom of culture plate wells) in the study groups. The results of relative quantification of RT-PCRs after descriptive and inferential statistical analyses by ANOVA are presented in Table 2. All groups presented statistically similar expression of collagen I. Analysis of values in Table 2 evidences greater expression of collagen in groups without biomimetic treatment in the seven-day period, while in groups with biomimetic treatment this expression was greater at 14 days. The ANOVA revealed statistical significance according to the study period for the expression of osteonectin and TGF-β. Analysis of Table 2 and results of the Tukey test evidence greater expression of both in all groups at 7 days. All groups presented statistically similar expression of integrin. Evaluation of Table 2 reveals lower expression in porous groups with biomimetic treatment, in the two periods. There was statistical significance between groups in the expression of alkaline phosphatase. The biomimetic treatment reduced the expression of alkaline phosphatase. There was a tendency of greater expression of phosphatase at 14 days. Despite the lack of statistical significance according to the ANOVA, concerning the study period, the analysis of osteopontin reveals greater expression at 7 days. For the RUNX-2, the Tukey test demonstrated that the biomimetic treatment presented lower means compared to groups without this

Fig. 1. SEM photomicrograph of porous specimen in the 33.79% group. Note the interconnection of surface pores and deep pores in the walls.

Fig. 3. SEM of dense specimen with biomimetic treatment presenting flaky granule deposits on the surface of treated specimens.

3.1. Molecular analysis

198

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

Fig. 4. Result of X-ray diffraction analysis in 33.79% specimen submitted to biomimetic treatment, demonstrating the hydroxyapatite peaks on the surface, colored in “pool” blue. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

treatment. In groups without biomimetic treatment, the expression of RUNX-2 was greater at seven days, while in groups with biomimetic treatment the expression was greater at 14 days. The expression of FCECM, osteocalcin and interleukin presented statistical similarity in all groups and study periods. The expression of Prostaglandin synthase presented a tendency to increase with time in groups without biomimetic treatment. Conversely, the expression of bone sialoprotein was reduced in all surfaces. The expression of osterix was greater at 14 days (Table 2). The study periods and study groups were significant, according to the ANOVA test, in the expression of apolipoprotein. Its greater expression occurs at 14 days and the group with greater porosity, with biomimetic treatment, presented great quantity of this maker in both study periods. The results of tests performed on cultures are presented in Table 3. Concerning cell adhesion, the ANOVA revealed p = 0.001 for the groups. According to the Tukey test, the control group was greater than the porous groups and the group with biomimetic treatment and similar to the dense titanium group.

Fig. 5. SEM of cells spread in 33.79% porous specimen presenting many clusters of cells with extended cellular prolongations to achieve cell adhesion to the titanium surface.

In relation to cell growth, the ANOVA revealed the time (p = 0.018) and group (p = 0.001) as significant variables. The number of cells was significantly increased with time. The dense titanium group presented similar growth rate as the control group and porous groups, being statistically greater than the dense group with biomimetic treatment (Fig. 7). After analysis of variance by the ANOVA, time and group were significant variables for the cell viability. This was decreased with time, and groups without biomimetic treatment presented better cell viability rates (Table 3). Time and group were significant variables for the total protein content (p b 0.05). This was increased with time, and the groups with biomimetic treatment presented lower contents (Table 3). The alkaline phosphatase activity revealed time and group as significant variables. After 14 days of contact of osteoblasts with the titanium specimens, the alkaline phosphatase activity was greater. The 41.79% porous group submitted to biomimetic treatment presented the lowest activity of this enzyme compared to the other groups (Table 3).

Fig. 6. SEM of 33.79% biomimetic treated porous specimen with granule deposits on the surface and presenting spread isolated cells with many extended cellular prolongations to achieve cell adhesion to the surface. Note smaller cells than Fig. 4.

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

199

Table 2 Data of molecular analysis. Relative quantification of each gene performing with comparative method of ΔΔCt. Two-way ANOVA results. ⁎Statistical significance (p b 0.05). Genes/groups Collagen I

Osteonectin

TGF-β1

Integrin

Alkaline phosphatase

Osteopontin

Runx-2

M-CSF

Osteocalcin

Prostaglandin E2 synthase

Bone sialoprotein II

Osterix

Interleukin

Apolipoprotein

7 days 14 days ANOVA 7 daysa 14 daysb ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 days 14 days ANOVA 7 daysa 14 daysb ANOVA

Control

Dense titanium

33.79% porous titanium

41.79% porous titanium

Biomimetic dense titanium

Biomimetic 33.79% porous titanium

Biomimetic 41.79% porous titanium

1 1 Time 1 1 Time 1 1 Time 1 1 Time 1a 1a Time 1 1 Time 1a 1a Time 1 1 Time 1 1 Time 1 1 Time 1 1 Time 1 1 Time 1 1 Time 1b 1b Time

0.77 ± 0.48 0.31 ± 0 p = 0.84 28.71 ± 48.27 0.41 ± 0.09 p = 0.02⁎

0.48 ± 0.26 0.32 ± 0.4

0.64 ± 0.81 0.39 ± 0.1 21.42 ± 35.88 0.53 ± 0.32

1.15 ± 0.92 0.19 ± 0.17

0.58 ± 0.45 0.26 ± 0.05

1.18 ± 0.83 0.82 ± 0.95

0.23 ± 0.23 1.45 ± 1,28

0.31ab ± 0.24 0.25ab ± 0.22

0.28ab ± 0.15 0.71ab ± 0.90

0.11 ± 0.06 0.17 ± 0.1 p = 0.19 22.36 ± 38.21 0.36 ± 0.35 p = 0.51 0.59 ± 0.12 0.18 ± 0.05 p = 0.14 0.42 ± 0.14 0.37 ± 0.18 p = 0.34 0.04b ± 0.02 0.22b ± 0.33 p = 0.028⁎

0.08 ± 0.07 0.46 ± 0.3

34.36 ± 57.77 0.69 ± 0.60

0.13 2.47

1.60 0.55

0.37b ± 0.20 0.20b ± 0.32

0.35b ± 0.24 0.23b ± 0.16

1.21 ± 0.91 0.3 ± 0.18

0.47 ± 0.12 0.88 ± 1.02

0.32 ± 0.23 7.67 ± 8.21

0.3 ± 0.44 2.41 ± 1.95

1.59 ± 1.70 2.43 ± 2.23

1.12 ± 1.46 3.41 ± 2.24

0.18 ± 0.17 0.39 ± 0.37

0.73 ± 1.17 0.11 ± 0.12

0.01 ± 0.02 5.15 ± 8.52

0.13 ± 0.23 0.12 ± 0.21

0.45 ± 0.62 3.52 ± 3.65

1.84 ± 3.14 1.90 ± 1.77

0.05 b 1.80 b

5.43a 4.98a

0.03 ± 0.02 0.68 ± 0.4 Group 8.93 ± 15.16 0.58 ± 0.31 Group 0.36 ± 0.15 0.31 ± 0.19 Group 1.1 ± 1.19 0.68 ± 0.40 Group 0.01ab ± 0.01 0.55ab ± 0.68 Group 0.97 0.28 Group 0.15b ± 0.11 0.31b ± 0.27 Group 0.35 ± 0.09 0.34 ± 0.29 Group 0.17 ± 0.07 0.93 ± 1.19 Group 1.15 ± 1.08 0.85 ± 1.27 Group 0.07 ± 0.12 0.03 ± 0.05 Group 0.05 ± 0.08 58.64 ± 101.57 Group 0.72 ± 0.67 0.39 ± 0.42 Group 0.01 b 1.49 b Group

0.70 ± 0.19 0.31 ± 0.28 p = 0.04⁎ 0.86 ± 0.44 0.99 ± 1.04 p = 0.67 0.51ab ± 0.24 0.43ab ± 0.35 p = 0.09 1.76 0.65 p = 0.65 0.53ab ± 0.37 0.30ab ± 0.29 p = 0.831 0.52 ± 0.10 0.57 ± 0.51 p = 0.912 1.18 ± 1.29 3.70 ± 1.72 p = 0.07 0.84 ± 0.23 1.70 ± 0.88 p = 0.85 4.18 ± 6.71 0.25 ± 0.23 p = 0.310 0.01 ± 0.01 3.42 ± 4.85 p = 0.25 3.04 ± 5.08 0.74 ± 0.68 p = 0.31 0.01b 2.55 b p = 0.02⁎

4.02 ± 6.25 0.43 ± 0.36 0.31 ± 0.22 0.16 ± 0.07 0.14 ± 0.07 0.24 ± 0.16 0.04b ± 0.03 0.35b ± 0.44

0.75 0.25 p = 0.58 0.11b ± 0.07 0.24b ± 0.16 p = 0.014⁎

0.57 0.08

0.56 ± 0.16 0.36 ± 0.31 p = 0.576 1.00 ± 1.07 1.01 ± 0.96 p = 0.55 5.06 ± 5.42 1.48 ± 1.97 p = 0.541 0.10 ± 0.08 0.06 ± 0.06 p = 0.434 1.35 ± 2.34 4.26 ± 7.38 p = 0.51 0.93 ± 1.21 3.04 ± 3.67 p = 0.60 0.01 b 1.81 b p = 0.01⁎

0.28 ± 0.10 0.8 ± 1.06

0.04b ± 0.05 0.39b ± 0.41

0±0 2.13 ± 2.14 0.49 ± 0.65 1.36 ± 1.42 0.00 ± 0.01 0.08 ± 0.08 0±0 2.44 ± 4.22 0.34 ± 0.20 23.33 ± 39.09 0.01 b 1.15 b

Values that do not share the same superscript letters are significantly different from each other (Tukey Test).

According to the values obtained for quantification of mineralized nodule formations, time was not significant (0.0545), yet the ANOVA revealed the group as a significant variable (p = 0.001). The porous groups with biomimetic treatment presented the highest means of absorbance of alizarin red dye (Table 3). 4. Discussion The evaluation of pores on the surface of implants and their quantification for determination of dimensions and proportion are important

to analyze the relationships with cell responses. Considering that the percentage of bone growing on the surface of porous titanium is inversely proportional to the square root of pore sizes and shear properties, the percentage of porosity is proportional to the extent of bone growth [27]. In this study, the group with lower porosity presented 33.79% ± 1.69% of pores on the geometric analysis and 32.5% ± 7.7% on metallography. The group with greater porosity presented 41.79 ± 1.93% of porosity in the geometric analysis and 37.4% ± 7.9% on the metallographic analysis. These discrepant outcomes, especially in the group

Table 3 Data of cell culture experiments according to each type of titanium surface. Tukey test results. ⁎Values that do not share the same superscript letters are significantly different from each other (p b 0.05). Group/analysis with Tukey test results

Cell adhesion (% of adherent cells from 2 × 104 cell/well)

Cell viability (% of viable cells comparing to control group)

Total protein content (μg/mL)

Phosphatase alkaline activity (μmol of thymolphthalein/min/mL)

Mineralized matrix (absorbance 405 nm)

Control group Dense titanium 33.79% porous titanium 41.79% porous titanium Biomimetic dense titanium Biomimetic 33.79% porous titanium Biomimetic 41.79% porous titanium

146.67a⁎ ± 74.3 101.67ab ± 48.6 75b ± 43.3 76.67b ± 33.36 75b ± 39.0 78.33b ± 73.1

100a ± 0 101.53a ± 23.22 108.53a ± 23.98 105.54a ± 26.13 53.58bc ± 21.81 56.66b ± 24.15

129.64a ± 56.27 130.04a ± 57,05 136.26a ± 36.82 140.2a ± 41.66 94.74b ± 57.72 81.52b ± 52.34

104.4a ± 164.5 62.7b ± 106.0 39.5bc ± 95.0 39.22bc ± 90.7 28.99bc ± 89.5 25.35bc ± 72.0

0.0932d ± 0.169 0.1475cd ± 0.219 0.3044c ± 0.427 0.0828d ± 0.057 0.1087d ± 0.093 1.531a ± 0.314

46.82c ± 22.81

84.49b ± 48.49

16.98c ± 68.8

1.0061b ± 0.351

68.33b ± 69.7

200

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

Fig. 7. Graph: effect of porosity and biomimetic treatment in cell growth. Tukey test results.

with greater porosity, were also observed by Kujala et al. [28] comparing the outcomes of analysis of empty volume and sessions of the same group. The metallographic analysis by scanning electron microscopy is one of the main microscopic techniques employed for analysis of pores on the surface of biomaterials. Other techniques to quantify the pores and porosity described in the literature include the determination of dimensions (volume) and mass for calculation of porosity by the geometric or gravimetric method [10,29,30]. Some authors also used the principle of Archimedes [28]. In this study, the discrepancy of porosity observed between geometric and scanning electron microscopy analyses is explained by the smaller sample size for the latter, while all fabricated specimens (n = 600) were submitted to geometric analysis. Thus, the standard deviation of geometric analysis was lower compared to the metallographic analysis. The osteoblasts respond differently according to the pore size. Xue et al. [29] demonstrated that, in porous titanium with pores smaller than 100 μm, the cells presented spreading directly on the pores by filopodia. In pores greater than 200 μm, the osteoblasts did not present direct spreading, yet their growth was observed inside the pores. In an extensive review, Karageorgiou and Kaplan [30] considered that the minimum pore size is 100 μm due to the cell size, migration characteristics and cell transport. However, 300 μm pores are considered ideal because they enhance the formation of capillaries. These data may also be correlated with the size of Havers' canals, with approximately 100–200 μm diameter. Small pores may favor hypoxia and possibly lead to the formation of bone cartilaginous tissue, while richly vascularized large pores would allow direct osteogenesis. In the present study, despite the statistical differences, the different porosities did not interfere in this early stage of cell response. A longterm study may be appropriate to evaluate cell behavior in contact with porous Ti sample. According to Kujala et al. (2003) [28] porosity appears to have some influence on the osseointegration, which seems to increase after 12 weeks. Also, the metallurgy of the powder did not allow uniform control of the disposition of urea grains on the surface and consequently of the specimen as a whole, constituting a technical limitation. Even though the size of pores in this study was determined with the mixture of urea grains with predetermined granulometry [31] for the achievement of 300 μm pores, the metallographic analysis revealed micropores, mesopores and macropores.

Due to its poor mechanical properties, the hydroxyapatite has limited practical application as an implant submitted to load. Conversely, titanium implants covered with apatite or hydroxyapatite have attracted great attention because they yield a biomaterial that combines the advantageous biomechanical properties of titanium with the biological affinity of bone to hydroxyapatite, allowing chemical bonding and enhancing the contact osteogenesis [11]. However, the in vitro results demonstrated that the genic expression of osteocalcin, osteonectin, osteopontin and collagen-α1, evaluated in this study, was not modified in groups with biomimetic treatment. These results do not corroborate those obtained in other study in which the biomimetic treatment of the dense titanium surface favored the osteoblast differentiation based on the expression of the same markers [32]. This interference with the biocompatibility may be explained by the chemical modifications and changes in surface micro and nanotopography [33]. At seven days, in groups with biomimetic treatment, there was markedly reduced expression of collagen I, osteonectin, TGF-β, alkaline phosphatase, osteopontin, Runx2 and BSP, and reduced expression of osteocalcin at 14 days compared to groups without biomimetic treatment, causing changes in osteoblast differentiation due to the presence of calcium phosphate surface. Two markers, osterix and interleukin, had peak expressions in groups with biomimetic treatment at 14 days. The expression of Runx 2 reflects the differentiation of osteoblasts on each specimen. It evidences that, compared to cells growing on the plate bottom in the control group, all others had lower expression of this transcription factor, which is a key factor in osteoblast differentiation [11]. It also evidences how the biomimetic treatment delayed the osteoblast differentiation. Its presence coincided with the expression and activity of alkaline phosphatase, once again demonstrating its role in cell differentiation. It is known that the osterix expression is reduced when there is a reduction in Runx2. Different than that reported by Nishio et al. [32], at 14 days, the collagen I presented recovery of expression in two groups with biomimetic treatment, while its presence was reduced in the titanium without surface treatment. Collagen I is fundamental in the initial stages of osseointegration [19]. The same was observed for alkaline phosphatase, osteocalcin, apolipoprotein and Runx2, related to osteoblast proliferation and differentiation, in groups with biomimetic surface, which increased the expression of RNAm at 14 days compared to 7 days. The

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

only markers presenting greater expression at 7 days in the treated groups were osteopontin, osteonectin, integrin and TGF-β. During the initial stages of protein synthesis, the immature osteoblast precursors express collagen types I and III, as well as alkaline phosphatase, and should not express proteins that are highly characteristic of bone as osteonectin and osteocalcin. With the reduced expression of these markers, there is a marked expression of osteonectin followed by osteocalcin during the advanced differentiation, production and mineralization of bone, indicating change to a state with greater cell maturity [34]. In this study, this evolution in the expression of these markers was altered. While osteonectin was more expressed in the initial period and significantly reduced at 14 days, the osteocalcin, alkaline phosphatase and collagen I were statistically similar in the two periods. Analysis of the outcomes of cell adhesion revealed that it was greater in the control group, whose cells were cultured in polystyrene on the bottom of wells in culture plates. Plastic has a smoother surface and is chemically different from titanium, besides being the standard environment for cell culture. This behavior had been observed in previous studies on the biocompatibility of surfaces. More adhesion was observed in the regular dense titanium group compared to the porous titanium. It was expected that the greater surface provided by the pores would increase the adhesion in porous specimens, yet this was not observed. However, these outcomes may be related to a limitation of the technique. The trypsinization (procedure that enzymatically dissociates the adhered cells) may fail when applied to porous titanium. Many cells may remain adhered in the pores [35] and thus they would not be included on counting in the Neubauer chamber. The molecules of integrin and osteopontin have an important role in the phenomenon of cell adhesion. The ligation of cells to laminin occurs by integrins, which are transmembrane receptors that connect the cells to the extracellular matrix and anchor the cytoskeleton to the cell membrane. They regulate not only the adhesion, but also cell migration, proliferation and differentiation [36]. Analysis of gene expression in this study revealed the greater presence of osteopontin, though not statistically significant, at 7 days for the dense regular titanium and titanium with greater porosity, and at 14 days for the titanium with lower porosity. Conversely, integrin had a similar expression in the two periods, yet its peak expression was observed for specimens with greater porosity, at 14 days. Also, the interaction between integrin and collagen I is fundamental for the development and maintenance of the osteoblast phenotype and mineralization of the extracellular matrix [37]. In porous groups with biomimetic treatment, which presented worse outcomes as to the osteoblast differentiation and cell viability, there was low genic expression of integrin and collagen. Mamalis and Silvestros [38] observed that chemical changes reduce the cell adhesion and proliferation. In fact, if after 24 h, there are fewer cells adhered to porous titanium, it is possible to consider changes in the surface wettability of porous specimens fabricated by powder metallurgy. Also, it should be considered that, in vivo, cells do not adhere directly to the surfaces of materials, but to the extracellular glycoprotein matrix adsorbed on the surface. It was expected that cells cultured on porous surfaces would have greater expression of osteocalcin and alkaline phosphatase (revealing greater differentiation induced by the topography) and more prostaglandin E2 synthase, TGF-β and interleukin, since the osseointegration events on the surface of rough titanium are modulated by prostaglandins [39,40]. Though not statistically significant, the peak prostaglandin was observed for the 33.79% porous group with biomimetic treatment followed by the porous groups without biomimetic treatment. The peak expression of interleukin was observed for the 41.79% porous group with biomimetic treatment. The peak osteocalcin was observed for the 33.79% porous group, and the peak expression of alkaline phosphatase occurred in the 41.79% porous group without biomimetic treatment. The osteoblasts interact with the titanium surface through the integrin pathway, and when the integrin receptor is occupied the phospholipase A2 is activated, leading to the release of prostaglandin

201

and mediating the osseointegration [39,40]. However, the expression of integrin was similar between dense titanium and porous titanium groups. The action of Interleukin 6 should also be considered which is known to be one of the greatest mediators regulating the immune response to inflammation, and seems to participate in maintenance of the bone mass, being expressed in osteoblasts [41]. The macrophage colony stimulating factor also mediates the immune response and participates in bone resorption, since after release by the osteoblasts it binds to its receptors on the surface of osteoclasts, leading to their differentiation [34]. Its expression was more pronounced in the control group and reduced in osteoblasts cultured on titanium specimens, regardless of the porosity and biomimetic treatment, except for the group with lower porosity, without biomimetic treatment, at 7 days. This confirms the biocompatibility of titanium and its inert characteristic when in contact with tissues, producing little immune response. Observation of the growth curve after 24 h, 3, 7 and 10 days of culture evidences a tendency that only the control and dense titanium groups provided conditions for cell proliferation. The other groups presented low rates of cell growth. This growth curve should be carefully interpreted, because trypsinization was also performed for this analysis. The proliferation may be inversely proportional to differentiation [10, 39]. However, in groups with biomimetic treatment with low proliferation rates, there was reduced expression of RNAm of markers of osteoblast differentiation. One possible explanation is that the release of some growth factors seems to occur more slowly in vitro in specimens submitted to biomimetic treatment [42]. The biomimetic treatment displayed cytotoxic effect with marked reduction in cell viability. This disagrees with the outcomes of other studies using this surface change [32,43]. Not only the viability, but also the dosage of total protein content revealed the deleterious effect of biomimetic treatment both in dense and porous titanium. According to Fontana [44], as the cells differentiate into osteoblasts, the quantity of total proteins is increased proportionally to the number of cells, whose main characteristic when they are mature is the synthesis of great quantities of extracellular matrix. Great part of this matrix is proteic, composed of collagen type I (90%), followed by osteocalcin, bone sialoprotein, osteopontin and proteoglycans. Thus, cells in contact with the biomimetic surface, whose protein content was reduced as assessed by the modified Lowry method, are supposedly less differentiated, so that there was reduction in the activity and expression of alkaline phosphatase at 7 days, expression of collagen I at 7 days, and expression of osteopontin, Runx2 and bone sialoprotein. It is possible that the physical presence of hydroxyapatite granules may damage the culture cells. This does not occur in vivo, and better osseointegration has been reported for implants with biomimetic surface [45]. Yu and Wei [46] also showed that the calcium phosphate biomimetic coating caused inhibiting effect on osteoblast adhesion and further influenced the proliferation and differentiation of osteoblast compared to the alkaline-treated titanium surface in vitro. In vivo, the presence of the fibrin network, or protein adsorption and osteoblast induction or even interaction with the immune system and reduction of macrophage activation may contribute to better osseointegration. The protein adsorption occurs rapidly with deposition of a layer of 2 to 5 nm in the first minute after contact of the material surface with blood. All aforementioned phenomena may only occur in vivo, constituting a limitation to the interpretation of the data of the present study. Herein, the biomimetic coating impaired titanium compatibility. Some released substance might have cytotoxic effect to cell culture. Zhu et al. used titanium samples with a middle layer of titania and a surface coating layer of hydroxyapatite (formed by hydrothermal treatment). After 60 days of immersion in simulated body fluid, crystals had been dissolved and the titania layer was exposed. However, the opposite result was demonstrated since cell culture tests showed

202

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203

greater biocompatibility for this surface comparing with simple titanium surface [47]. The porous titanium groups presented lower rates of alkaline phosphatase activity. This represents a marker of cell differentiation in the initial stages of osteopoiesis [48]. In osteoblasts, its role involves the generation of inorganic phosphate for mineralization from phosphate esters, such as β-glycerophosphate [49]. Rosa et al. [10] observed similar outcomes on cultures growing on porous titanium as to the activity and genic expression of alkaline phosphatase. According to the authors, there is a delay in osteoblast differentiation on the porous surface, yet greater quantity of mineral matrix is deposited in this topography. The test with mineralized nodule formations was not adequate for the purpose of this study, since the alizarin red was non-specifically bound to calcium of hydroxyapatite on the surface of specimens with biomimetic treatment, masking the real measurement of mineralized nodule formations, leading to a mistaken outcome that was statistically significantly greater in specimens with biomimetic treatment. 5. Conclusion It was concluded that, in vitro, small variations in titanium porosity are unable to cause changes in osteogenesis in human osteoblast cultures based on the present results concerning the genic expression of bone markers and functional biochemical tests. The biomimetic treatment impaired the biocompatibility of titanium, delaying the cell differentiation based on the genic expression of key markers of this process and causing cytotoxicity, which reduced the viability of cells cultured on treated surfaces. Conflict of interest No conflict of interest. Acknowledgments The authors thank FAPESP (São Paulo State Research Foundation) for the financial support (PROC 2011/19938-3) and scholarship (PROC 2010/02778-0). References [1] K.T. Bowers, J.C. Keller, B.A. Randolph, D.G. Wick, C.M. Michaels, Optimization surface micromorphology for enhanced osteoblast responses in vitro, Int. J. Oral Maxillofac. Implants 7 (1992) 302–310. [2] J.E. Ellingsen, Surface configurations of dental implants, Periodontology 2000 17 (1998) 36–46. [3] H. Kienapfel, C. Spray, A. Wilke, P. Griss, Implant fixation by bone ingrowth, J. Arthroplasty 14 (1999) 355–368. [4] T. Albrektsson, P.I. Branemark, H.A. Hansson, J. Lindstrom, Osseointegrated titanium implants: requirements for ensuring a long-lasting, direct bone-to-implant anchorage in man, Acta Orthop. Scand. 52 (1981) 155–170. [5] L. Le Guehennec, A. Soueidan, P. Layrolle, Y. Amouriq, Surface treatments of titanium dental implants for rapid osseointegration, Dent. Mater. 23 (2007) 844–854. [6] Cassinelli, M. Morra, G. Bruzzone, A. Carpi, G. Di Santi, R. Giardino, et al., Surface chemistry effects of topographic modification of titanium dental implant surfaces: 2. In vitro experiments, Int. J. Oral Maxillofac. Implants 18 (2003) 46–52. [7] J.D. de Bruijn, I. van den Brink, S. Mendes, R. Dekker, Y.P. Bovell, C.A. van Blitterswijk, Bone induction by implants coated with cultured osteogenic bone marrow cells, Adv. Dent. Res. 13 (1999) 74–81. [8] K.H. Frosch, Migration, matrix production and lamellar bone formation of human osteoblast-like cells in porous titanium implants, Cells Tissues Organs 170 (2002) 214–227. [9] B. Fang, Y.Z. Wan, T.T. Tang, C. Gao, K.R. Dai, Proliferation and osteoblastic differentiation of human bone marrow stromal cells on hydroxyapatite/bacterial cellulose nanocomposite scaffolds, Tissue Eng. A 15 (2009) 1–8. [10] A.L. Rosa, G.E. Crippa, P.T. Oliveira, M.J. Taba, L.P. Lefebvre, M.M. Beloti, Human alveolar bone cell proliferation, expression of osteoblastic phenotype, and matrix mineralization on porous titanium produced by powder metallurgy, Clin. Oral Implants Res. 20 (2009) 472–481. [11] X.B. Chen, Y.C. Li, J.Du. Plessis, P.D. Hodgson, C. Wen, Influence of calcium ion deposition on apatite-inducing ability of porous titanium for biomedical applications, Acta Biomater. 5 (2009) 1808–1820.

[12] H.M. Kim, F. Miyaji, T. Kokubo, T. Nakamura, Preparation of bioactive Ti and its alloy via simple chemical surface treatment, J. Biomed. Mater. Res. 32 (1996) 409–417. [13] T. Kokubo, F. Miyaji, H.M. Kim, T. Nakamura, Spontaneous apatite formation on chemically surface treated Ti, J. Am. Ceram. Soc. 79 (1996) 1127–1129. [14] M.J. Dalby, D. McCloy, M. Robertson, C.D. Wilkinson, O.R. Oreffo, Osteoprogenitor response to defined topographies with nanoscale depths, Biomaterials 27 (2006) 1306–1315. [15] P.A. Kokkinos, I.K. Zarkadis, D. Kletsas, D. Deligiann, Effects of physiological mechanical strains on the release of growth factors and the expression of differentiation marker genes in human osteoblasts growing on Ti–6Al–4V, Biomed. Mater. Res. 90 (2009) 387–395. [16] C. Masaki, G.B. Schneider, R. Zaharias, D. Seabold, C. Stanford, Effects of implant surface microtopography on osteoblast gene expression, Clin. Oral Implants Res. 16 (2005) 650–656. [17] G. Mendonça, D.B. Mendonça, L.G. Simões, A.L. Araújo, E.R. Leite, W.R. Duarte, et al., The effects of implant surface nanoscale features on osteoblast specific gene expression, Biomaterials 30 (2009) 4053–4062. [18] T. Ogawa, I. Nishimura, Genes differentially expressed in titanium implant healing, J. Dent. Res. 85 (2006) 566–570. [19] T. Zhang, H. Xia, Y. Wang, C. Peng, Y. Li, X. Pan, Gene expression of four adhesive proteins in the early healing of bone defect and bone–implant interface, Conf. Proc. IEEE Eng. Med. Biol. Soc. 1 (2006) 2087–2090. [20] R.G. McQueen, J.C. Jamieson, S.P. Marsh, Shock-wave compression and x-ray studies of titanium dioxide, Science 155 (1967) 1401–1404. [21] M.C. Andrade, M.S. Sader, M.R.T. Filgueiras, T. Ogasawara, Microstructure of ceramic coating on titanium surface as a result of hydrothermal treatment, J. Mater. Sci. Mater. Med. 11 (2000) 751–755. [22] J.M. Mailhot, J.L. Borke, An isolation and in vitro culturing method for human intraoral bone cells derived from dental implant preparation sites, Clin. Oral Implants Res. 9 (1998) 43–50. [23] M.M. Beloti, W.J. Martins, S.P. Xavier, A.L. Rosa, In vitro osteogenesis induced by cells derived from sites submitted to sinus grafting with anorganic bovine bone, Clin. Oral Implants Res. 19 (2008) 48–54. [24] K.L. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method, Methods 25 (2001) 402–408. [25] O.H. Lowry, N.J. Rsebrough, A.L. Farr, R.J. Randall, Protein measurement with the Folin phenol reagent, J. Biol. Chem. 193 (1951) 265–275. [26] C.A. Gregory, W.G. Gunn, A. Peister, D.J. Prockop, An alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction, Anal. Biochem. 239 (2004) 77–84. [27] A.J. Clemow, A.M. Weinstein, J.J. Klawitter, J. Koeneman, J. Anderson, Interface mechanics of porous titanium implants, J. Biomed. Mater. Res. 15 (1981) 73–82. [28] S. Kujala, J. Ryhänen, A. Danilov, J. Tuukkanen, Effect of porosity on the osteointegration and bone ingrowth of a weight-bearing nickel–titanium bone graft substitute, Biomaterials 24 (2003) 4691–4697. [29] W. Xue, B.V. Krishna, A. Bandyopadhyay, S. Bose, Processing and biocompatibility evaluation of laser processed porous titanium, Acta Biomater. 3 (2007) 1007–1018. [30] V. Karageorgiou, D. Kaplan, Porosity of 3D biomaterial scaffolds and osteogenesis, Biomaterials 26 (2005) 5474–5491. [31] L.M.R. Vasconcellos, F.N. Oliveira, D.O. Leite, L.G. de Vasconcellos, R.F. Prado, C.J. Ramos, et al., Novel production method of porous surface Ti samples for biomedical application, J. Mater. Sci. Mater. Med. 23 (2012) 357–364. [32] K. Nishio, M. Neo, H. Akiyama, S. Nishiguchi, H.M. Kim, T. Kokubo, et al., The effect of alkali- and heat-treated titanium and apatite-formed titanium on osteoblastic differentiation of bone marrow cells, J. Biomed. Mater. Res. 52 (2000) 652–661. [33] T.P. Queiroz, F.A. Souza, A.C. Guastaldi, R. Margonar, I.R. Garcia-Júnior, E. HochuliVieira, Commercially pure titanium implants with surfaces modified by laser beam with and without chemical deposition of apatite. Biomechanical and topographical analysis in rabbits, Clin. Oral Implants Res. 24 (2013) 896–903. [34] J.B. Lian, G.S. Stein, M.J. Seibel, S.P. Robins, J.P. Bilezikian, The cells of bone, Dynamics of Bone and Cartilage Metabolism, 2th ed.Academic Press, New York, 2006. [35] J.Y. Martin, Z. Schwartz, T.W. Hummert, D.M. Schraub, J. Simpson, J.J. Lankford, et al., Effect of titanium surface roughness on proliferation, differentiation and protein synthesis of human osteoblast-like (MG-63), J. Biomed. Mater. Res. 29 (1995) 389–401. [36] M.A. Horton, M.A. Nesbit, M.H. Helfrich, Interaction of osteopontin with osteoclast integrins, Ann. N. Y. Acad. Sci. 760 (1995) 190–200. [37] C.D. Reyes, T.A. Petrie, K.L. Burns, Z. Schwartz, A.J. García, Biomolecular surface coating to enhance orthopaedic tissue healing and integration, Biomaterials 28 (2007) 3228–3235. [38] A.A. Mamalis, S.S. Silvestros, Analysis of osteoblastic gene expression in the early human mesenchymal cell response to a chemically modified implant surface: an in vitro study, Clin. Oral Implants Res. 22 (2011) 530–537. [39] Z. Schwartz, C.H. Lohmann, M. Sisk, D.L. Cochran, V.L. Sylvia, J. Simpson, et al., Local factor production by MG63 osteoblast-like cells in response to surface roughness and 1,25-(OH)2D3 is mediated via protein kinase C- and protein kinase Adependent pathways, Biomaterials 22 (2001) 731–741. [40] Z. Schwartz, C.H. Lohmann, A.K. Vocke, V.L. Sylvia, D.L. Cochran, D.D. Dean, et al., Osteoblast response to titanium surface roughness and 1a,25-(OH)2D3 is mediated through the mitogen-activated protein kinase pathway, J. Biomed. Mater. Res. 56 (2001) 417–426. [41] C.G. Eriksen, H. Olsen, L.B. Husted, L. Sorensen, M. Carstens, K. Soballe, et al., The expression of IL-6 by osteoblasts is increased in healthy elderly individuals: stimulated proliferation and differentiation are unaffected by age, Calcif. Tissue Int. 87 (2010) 414–423.

R.F. Prado et al. / Materials Science and Engineering C 52 (2015) 194–203 [42] P.W. Kämmerer, M. Gabriel, B. Al-Nawas, T. Scholz, C.M. Kirchmaier, M.O. Klein, Early implant healing: promotion of platelet activation and cytokine release by topographical, chemical and biomimetical titanium surface modifications in vitro, Clin. Oral Implants Res. 23 (2012) 504–510. [43] C.Y. Zhao, X.D. Zhu, T. Yuan, H.S. Fan, X.D. Zhang, Fabrication of biomimetic apatite coating on porous titanium and their osteointegration in femurs of dogs, Mater. Sci. Eng. C 30 (2010) 98–104. [44] V. Fontana, Analysis of Gene Expression in Mesenchymal Stem Cells From Human Bone Marrow During Commitment to the Osteogenic Lineage(Thesis) São Paulo University, Ribeirão Preto Medicine School, 2009. [45] L. Le Guehennec, E. Goyenvalle, M.A. Lopez-Heredia, P. Weiss, Y. Amouriq, P. Layrolle, Histomorphometric analysis of the osseointegration of four different implant surfaces in the femoral epiphyses of rabbits, Clin. Oral Implants Res. 19 (2008) 1103–1110.

203

[46] X. Yu, M. Wei, Cellular performance comparison of biomimetic calcium phosphate coating and alkaline-treated titanium surface, Biomed Res. Int. 2013 (2013) 832790. [47] L. Zhu, X. Ye, G. Tang, N. Zhao, Y. Gong, Y. Zhao, J. Zhao, X. Zhang, Biomimetic coating of compound titania and hydroxyapatite on titanium, J. Biomed. Mater. Res. A (4) (2007) 1165–1175. [48] M.M. Cohen, The new bone biology: pathologic, molecular and clinical correlates, Am. J. Med. Genet. A 140 (2006) 2646–2706. [49] W.N. Addison, F. Azari, E.S. Sorensen, M.T. Kaartinen, M.D. McKee, Pyrophosphate inhibits mineralization of osteoblasts cultures by binding to mineral upregulation osteopontin and inhibiting alkaline phosphatease activity, J. Biol. Chem. 282 (2007) 15872–15883.