1990

6136 Nucleic Acids Research, Vol. 18, No. 20

Oxford Universiiy Press

Nucleotide sequence of the major outer membrane protein gene of Chlamydia trachomatis strain A/SA1/OT L.J.Hayes and l.N.Clarke Department of Microbiology, University of Southampton Medical School, Southampton General Hospital, Tremona Road, Southampton S09 4XY, UK Submitted September 13, 1990

GenBank accession no. M33535

The intracellular bacterium Chlamydia trachomatis is responsible for human ocular and genital infections worldwide. Serovars A, B and C are the major aetiological agents of the blinding disease trachoma. The major outer membrane protein (MOMP) gene of C. trachontatis A/SAI/OT (serovar A) was cloned in bacteriophages Ml3mpl8 and M13mpl9 and the complete nucleotide sequence determined by the dideoxy chain-termination method using modified T7 polymerase. The nucleotide sequence and inferred amino acid sequence are shown in Fig. 1. The gene contains six nucleotide differences compared to that of another serovar A isolate, A/Harl3 (1; sequence kindly provided by W. Baehr, Rocky Mountain Laboratories, Hamilton, MT, USA). These

nucleotide substitutions result in five changes in the inferred amino acid sequence of A/SAl/OT compared with A/Harl3 (2).

ACKNOWLEDGEMENT This work was supported by a grant from the Edna McConnell Clark Foundation, New York.

REFERENCES 1. Baehr,W., Zhang,Y.-X., Joseph,T., Su,H., Nano,F.E., Everett,K.D.E. and Caldwell,H.D. (1988) Proc. Natl. Acad. Sci. USA 85, 4000-4004. 2. Hayes,L.J., Pickett,M.A., Conlan,J.W., Ferris,S., Everson,J.S., Ward,M.E. and Clarke,I.N. (1990) J. Gen. Microbiology 136, 1559-1566.

ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGCTTCCTCCTTGCAAGCTCTGCCTGTGGGGAAT M K K L L K S V L V F A A L S S A S S L Q A L P V G N CCTGCTGAACCAAGCCTTATGATCGACGGAATTCTGTGGGAAGGTTTCGGCGGAGATCCTTGCGATCCTTGCACCACTTGG P A E P S L M I D G I L W E G F G G D P C D P C T T W TGTGACGCTATCAGCATGCGTATGGGTTACTATGGTGACTTTGTTTTCGACCGTGTTTTGAAAACAGATGTGAATAAAGAA C D A I S M R M G Y Y G D F V F D R V L K T D V N K E

81 162

243

TTTCAGATGGGAGCGGCGCCTACTACCAGAGATGTAGCAGGCTTAGAAAAGGATCCAGTAGTAAATGTTGCTCGCCCAAAT F Q M G A A P T T R D V A G L E K D P V V N V A R P N CCCGCTTATGGCAAACACATGCAAGATGCTGAAATGTTTACGAACGCTGCTTACATGGCATTAAATATCTGGGATCGTTTT P A Y G K H M Q D A E M F T N A A Y M A L N I W D R F GATGTATTTTGTACATTGGGAGCAACTACCGGTTATTTAAAAGGAAACTCCGCTTCCTTCAACTTAGTTGGATTATTCGGA D V F C T L G A T T G Y L K G N S A S F N L V G L F G ACAAAAACACAATCTTCTGGCTTTGATACAGCGAATATTGTTCCTAACACTGCTTTGAATCAAGCTGTGGTTGAGCTTTAT T K T Q S S G F D T A N I V P N T A L N Q A V V E L Y ACAGACACTACCTTTGCTTGGAGCGTAGGTGCTCGTGCAGCTCTCTGGGAATGTGGGTGTGCAACGTTAGGAGCTTCTTTC T D T T F A W S V G A R A A L W E C G C A T L G A S F CAATATGCTCAATCTAAACCTAAAGTAGMGAGTTGAATGTTCTTTGTAATGCATCCGAATTTACTATTAATAAGCCGAAA Q Y A Q S K P K V E E L N V L C N A S E F T I N K P K GGATATGTTGGGGCGGAATTTCCACTTGATATTACCGCAGGAACAGAAGCTGCGACAGGGACTAAGGATGCCTCTATTGAC G Y V G A E F P L D I T A G T E A A T G T K D A S I D TACCATGAGTGGCAAGCAAGTTTAGCCCTTTCTTACAGATTAAATATGTTCACTCCTTACATTGGAGTTAAATGGTCTAGA

324

GTAAGTTTTGATGCCGACACGATCCGTATCGCTCAGCCTAAATTGGCTAAACCAGTCTTGGATACCACTACTCTAAACCCG

972

Y H E W Q A S L A L S Y R L N M F T P Y I G V K W S R

V S F D A D T I R I A Q P K L A K P V L D T T T L N P

405 486 567 648

729 810 891

ACCATCGCTGGTAAAGGAACTGTGGTCTCTTCCGCAGAAAACGAACTGGCTGATACAATGCAATCGTTTCCTTGCAGTTG 1053 T I A G K G T V V S S A E N E L A D T M Q I V S L Q L

AACAAGATGAAATCTAGAAAATCTTGCGGTATTGCAGTAGGAACAACTATTGTAGATGCAGATAAATACGCAGTTACAGTT 1134 N K M K S R K S C G I A V G T T I V D A D K Y A V T V

GAGACTCGCTTGATCGATGAGAGAGCAGCTCACGTAATGCACMTTCCGCTTCTM E T R L I D E R A A H V N A Q F R F Z

Figure 1. Nucleotide

sequence

and inferred amino acid

sequence

1191

of the major outer membrane protein (MOMP) gene of C. trachomatis A/SA1/OT.

OT.

1990 6136 Nucleic Acids Research, Vol. 18, No. 20 Oxford Universiiy Press Nucleotide sequence of the major outer membrane protein gene of Chlamydia...
140KB Sizes 0 Downloads 0 Views