Biochemical and Biophysical Research Communications 470 (2016) 492e497
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Ovate family protein1 interaction with BLH3 regulates transition timing from vegetative to reproductive phase in Arabidopsis Liguo Zhang a, b, Xiaofei Zhang c, Hanxun Ju a, Jingui Chen d, Shucai Wang e, Hemeng Wang a, Yuanling Zhao b, Ying Chang a, * a
College of Life Science, Northeast Agricultural University, Harbin, 150030, China Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China College of Mathematics and Information Sciences of Guangxi University, Nanning, 530004, China d Oak Ridge National Laboratory, Oak Ridge, TN, 37831, USA e College of Life Science, Northeast Normal University, Changcun, 130024, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 January 2016 Accepted 21 January 2016 Available online 23 January 2016
Three-Amino-acid-Loop-Extension(TALE) homeodomain transcription factor BLH3 regulates timing of transition from vegetative to reproductive phase. Previous preliminary results obtained using large-scale yeast two-hybrids indicate that BLH3 protein possibly interact with Ovate Family Proteins(OFPs) transcription co-regulators. Nevertheless, it is uncertain whether OFP1eBLH3 complex is involved in regulation of timing of transition from vegetative to reproductive phase in Arabidopsis. The interaction between BLH3 and OFP1 was re-tested and verified by a yeast two-hybrid system. We found that the BLH3eOFP1 interaction was mainly mediated through the BLH3 homeodomain. Meanwhile, this interaction was further confirmed by bimolecular fluorescence complementation (BiFC) in vivo. Further, by establishing protoplast transient expression, we discovered that BLH3 acts as a transcriptional activator, whereas OFP1 functioned as a repressor. The interactions between OFP1 and BLH3 can reduce BLH3 transcriptional activity. The ofp1 mutant lines and blh3 mutant lines, OFP1 overexpress lines and BLH3 overexpress lines can both influence timing of transition from vegetative to reproductive phase. Furthermore, 35s:OFP1/blh3 plants exhibited flowering and leaf quantity similar to that of the wild-type controls. 35s:BLH3/ofp1 plants flowered earlier and had less leaves than wild-type controls, indicating that OFP1 protein might depend partially on BLH3 in its function to regulate the timing of transition from vegetative to reproductive phase. These results support our assumption that, by interacting with OFP1, BLH3 forms a functional protein complex that controls timing of progression from vegetative to reproductive phase, and OFP1 might negatively regulate BLH3 or the BLH-KNOX complex, an important interaction for sustaining the normal transition from vegetative to reproductive phase. © 2016 Elsevier Inc. All rights reserved.
Keywords: OFP1 BLH3 Vegetative to reproductive phase Proteineprotein interaction Arabidopsis
1. Introduction Regulation of the timing of transition from vegetative to reproductive phase is an important biological process, which controls the point in time during development when a vegetative meristem changes and becomes an inflorescence or floral meristem and the rate at which the change occurs. BLH3 is one of 13 BEL1-like (BLH or BELL) members in Arabidopsis. Several BELL members have been shown to govern the
* Corresponding author. E-mail address: [email protected] (Y. Chang). http://dx.doi.org/10.1016/j.bbrc.2016.01.135 0006-291X/© 2016 Elsevier Inc. All rights reserved.
transition from the vegetative to the reproductive phase in plants. For example, plants overexpressing BLH6 flower later, whereas BLH3 overexpression induces early flowering [1]. OVATE genes encode a protein with an approximately 70-aa Cterminal domain which is conserved in tomato, rice, and Arabidopsis [2]. In Arabidopsis, 18 genes are predicted to encode the OVATE domain proteins. Heretofore, only a few AtOFPs have been shown to regulate plant growth and development. The representatives of the OFP family are plant-specific proteins, indicating a close functional connection with TALE homeodomain proteins [3]. In a previous study, the BLH1-KNAT3 protein complex was negatively regulated by AtOFP5 protein during early embryo sac development [4]. More recently, a report revealed that AtOFP4
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
participated in the regulation of secondary cell wall formation by interacting with KNAT7 [5]. The protein interactions of Arabidopsis TALE homeodomain proteins were systematically analysed by using the yeast twohybrid assay, which evidenced a complicated regulatory interaction network among OFP, KNOX, and BLH in Arabidopsis; the interactions of several OFPs with BLH3 were also reported [3]. However, the findings on some interactions in the network have been invalidated by using other methods to establish protein interactions. Furthermore, at present, the information concerning the biological development roles of OFPs or complex of TALE-OFPs is still scarce. Here, the interaction of OFP1 and BLH3 was verified in Arabidopsis thaliana; BLH3 acted as an activator, whereas OFP1 functioned as a repressor. Moreover, The research results suggested that OFP1 plays an important role in regulating time of transition from vegetative to reproductive phase by interacting with BLH3, supporting the extensive information regarding OFP regulatory functions in plants. 2. Materials and methods 2.1. Plant materials All mutants, the wild-type and transgenic lines, were in the background of ecotype Columbia Arabidopsis (Col-0). Seeds were germinated and grown on 1/2 Murashige and Skoog basal medium containing vitamins, and was cold-treated in the dark for 48 h, and incubated at 22 C under the conditions of a 14 h light/10 h dark photoperiod. The mutant allele of BLH3, GK-961A08, which is a T-DNA insertion, designated as Atblh3-1, was evaluated by consulting the SIGnal database, and seeds were ordered from the NASC(European Arabidopsis Stock Centre). An BLH3 gene-specific primer (50 ATGGCTGTGTATTACCCTAAT AGTGTC-30 ,50 -TTAGACAACAAAGTCGTGTAATTGATG-30 ) and the T-DNA-specific primer (50 ATAATAACGCTGCGGACATCTACATTTT -30 ) were used in PCR analysis. The insertion site of T-DNA was identified by checking nucleic acid sequences. The floral dip method was utilized for transgenesis in wild-type Arabidopsis plants background, as described earlier by Clough and Bent (1998) [6]. At least five transgene lines were identified and confirmed in minimum T3 generations. 2.2. Plasmid construction for proteineprotein interactions in yeasts The Open Reading Frame(ORF) of OFP1 and BLH3 was cloned in wild-type Arabidopsis cDNA. The homeodomain and SKY-BELL domain were divided according to Cole method [1] and using tools at http://smart.embl-heidelberg.de/.The homeodomain and SKY-BELL fragments were obtained by amplification of BLH3 plasmids(50 -TCGTTACGTTGGCCTTGGAA-30 , 50 -CTCCCCCAAT0 0 CAACTGGCAT-3 ,and5 -ACGGAAACGTAACGGTGTCA-30 , 50 ACCCTGATGTCTCGTAACGG-30 ). Fusion plasmids of pGBKT7-AtOFP1 were transformed into the yeast strain Y2HGold, and BLH3 cDNA was inserted into pGADT7. Their interaction was tested on SD medium(-Trp, -His,-Trp, -Ade) after selection on SD (-Trp, -Leu) medium. The known interaction between pGBKT7-p53 and pGADT7-SV40 plasmids was used as a positive control. The yeast cells harbouring the pGBKT7-Lam and pGADT7-SV40 plasmids were used as the negative control. 2.3. Bimolecular fluorescence complementation (BiFC) assays The fusion proteins of AtBLH3-YFPN and AtOFP-YFPC under 35S
493
promoter regulation were obtained by using N-terminal of EYFP vectors and the C-terminal of EYFP vectors [7]. After amplifying cDNA, the full sequences of AtOFP1 and AtBLH3 were sub-cloned into the pSAT6-nEYFP-N1 vector and pSAT6cEYFPN1 vector, respectively. The resulting constructs were used for transient assays by polyethylene glycol transfection of Arabidopsis protoplasts, as described by Yoo et al. [8]. Transfected cells were imaged by using a Leica TCS SP2 confocal spectral microscope imaging system. 2.4. Plasmid constructions and protoplast transfection analysis in Arabidopsis The constructs of OFP1 prom: GUS,35S:GD-OFP1 and 35S:HAOFP1 have been outlined in an earlier study [5,9]. pUC19 with two 35S enhancer promoters was connected with a PCR fragment, which was cloned in a frame with a GD tag or a Nterminal HA tag [10,11]. The pUC19 vector was digested with the EcoRI restriction enzyme and was inserted into the binary vector pZP211 via plant transformation for corresponding constructs with the HA tag [12]. 35S:GD-OFP1 constructs in the pUC19 vector, which were used for protoplast transfection and plasmid DNA extraction. The effector of AtOFP1 genes, LD-VP16 transactivator, and the reporter genes LexA(2X)-Gal4(2X):GUS and Gal4(2X):GUS were utilized, as described in previous reports [5,9]. The abovementioned methods were employed for the extraction of protoplasts and execution of transfection experiments [11,13]. Student's t-test was applied for statistical analyses. At least three replicates were performed in all transfection analyses, which were repeated at least twice. 2.5. Reverse transcription PCR and GUS expression assay RNA samples from fresh Arabidopsis tissue were extracted by using RNA extraction kit (Takara) according to the manufacturer's instructions, and reverse transcriptase by the RT kit (Takara). AtBLH3-specific primers (50 -ATGGCTGT GTATTACCCTAATAGTGTC30 , 50 - TTAGACAACAAAGTCGTGTAATTGATG-30 ). ACTIN gene (At2g37620) was regarded as a positive control(primers 50 -C CAGAAGGATGCATATGTTGGTGA-30 , 50 -GAGGAGCCTCGGTAAGAAGA-30 ). The prom BLH3:GUS for plant transformation was generate by BLH3 promoter, a 742-bp genomic fragment upstream of the BLH3 coding region was fused to the GUS reporter gene. The GUS expression activity of 7- and 10-day-old Arabidopsis tissues was detected in a buffer solution (pH 7.0), which contained 1 mM 5bromo-4-chloro-3-indolyl-b-D-glucuronide (X-GLUC), 0.1% Triton X-100, and 0.5 mM potassium ferricyanide, and the tissues were incubated for 1e12 h at 37 C. The tissue under investigation was observed via a Leica DM6000 microscope. 3. Results 3.1. BLH3 interaction with OFP1 The complicated interaction network among the proteins, i.e., OFPeKNOXeBELL, indicated potential interactions of BLH3 with some OFPs, including those with OFP2, OFP3, OFP4, and OFP5, beside that with OFP1 [3]. At present, only the insertion mutants of OFP1 and OFP4 among OFP members are used. AtOFP1 is localized in the nucleus and regulates AtGA20ox1, which is a gene encoding the key enzyme in gibberellin(GA) biosynthesis [9]. Further, GA can regulate growth and development in Arabidopsis, including the control over the timing of transition from vegetative to reproductive phase [14e16].
494
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
In addition, microarray analysis results concerning inflorescence stem development implied that OFP1 is upregulated during the course [17], and evidence was provided that OFP1 is an essential pleiotropic developmental regulator [3]. Therefore, OFP1 was selected as a protein that could be a potential interaction partner with BLH3, which regulate the timing of transition from vegetative to reproductive phase in Arabidopsis. The ability of OFP1 to interact with BLH3 was re-tested by using the yeast two-hybrid trial, in a targeted fashion rather than as a part of a largeescale interaction matrix [3]. Fig. 1A reflects that after the expression of a BLH3eDNA binding domain (BD) fusion protein and an OFP1eactivation domain (AD) fusion protein, they could interact adequately in yeast cells. Hackbusch (2005) suggested that the homeodomain (HD) of BLH protein might interact with the ovate domain of the Ovate Family Proteins [3]. To examine the domain of BLH3 interactions with OFP1, we generated two fusions of BLH3 domains, including SKY-BELL domain and HD domain. The two domains were separately fused to GD, and their interaction abilities with ADeOFP1 fusion protein were determined (Fig. 1B). The results indicate that the BLH3 homeodomain interacted with OFP1 protein, suggesting that the HD domain of BLH3 protein is necessary for interaction with OFP1 protein. To further confirm the occurrence of these interactions in vivo, a BiFC assay was performed by using an Arabidopsis protoplast transient expression system Co-expression. of both N-terminal
yellow fluorescent protein (YFPN)-tagged AtBLH3 and C-terminal YFP (YFPC)-tagged AtOFP1, there is not fluorescence of alone YFPN or YFPC. The Arabidopsis leaf mesophyll protoplast transient expression system [13]. YFPN-AtBLH3 and YFPC- AtOFP1 were transformed into protoplasts, which generated fluorescence in vivo (Fig. 1C). RACK1,a non-interacting protein [18] was used as a negative control. These results suggested that the AtBLH3 protein interacts with the AtOFP1 in planta. 3.2. BLH3 is a transcriptional activator BLH3 can integrate with OFP1, and the findings of a previous study implied that OFP1 acted as a transcriptional repressor [9], and BLH3 was localized to the nucleus [1], but the transcriptional activity of BLH3 is still not certain. To determine whether BLH3 could function similarly to OFP1, we applied the protoplast transfection system [5,9], illustrated in Fig. 2. This trial system was employed for testing of transcriptional activity, using a potent LexA DNA-binding domain and Gal4 DNA-binding domain, and the corresponding VP16 transcriptional activator and GD-AtBLH3(AtOFP1) transcription factor. The testing ability of the system has been well exemplified in a number of studies, including those on OFP1 [9], KNAT7 protein [5], and AUX/IAA proteins [19]. The transactivator LDeVP16 and the effector GD were transfected into protoplasts, which resulted in increased activation of the GUS reporter gene (Fig. 2A). However, co-transfection LDeVP16
Fig. 1. Interaction of OFP1 with BLH3 in yeast cells and in planta. (A) BLH3 interacts with OFP1 in yeast cells. Gal4 activation domain (AD) fusion constructs and Gal4 DNA-binding domain (BD) fusion construction were harboured in Yeast Y2HGold cells. The yeast cells were selected on SD medium lacking Leu and Trp (DDO) and interaction was assessed according to their ability to grow on selective SD medium lacking Leu, Trp, His, and Ade (QDO) for 5 d. (B) The fragments of BDeBLH3 interact with ADeOFP1 in yeast cells, Gal4 activation domain (AD). (C) Bimolecular fluorescence complementation analyses of BLH3 interactions with OFP1. The co-transfection of BLH3eYFPN þ OFP1eYFPC in Arabidopsis protoplasts. The different images were analysed by a confocal microscope after transfection. yellow fluorescence implies proteins interaction of BLH3 with OFP1.
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
495
Fig. 2. BLH3 is a transcriptional activator that interacts with OFP1 as a repressor in vivo. The ability of BLH3 and OFP1 to repress or activate GUS reporter gene were tested by using protoplast transfection system. (A) Relative GUS activity indicates BLH3(OFP1) transcriptional activation by co-transfecting with an LD-VP16 transactivator plasmid and a effector plasmid GD or GD-OFP1. The expression of 35S:luciferase (Luc) was used to normalized the expression of the GUS reporter gene. The standard deviation of three replicate transfections were represented by error bars. (B) Relative GUS activity indicates that interaction of OFP1 with BLH3 affect BLH3 transcriptional activity. (C) The location of the BLH3 transcriptional activation domains by using a protoplast transfection system.
and GDeOFP1 effectors caused a decrease in GUS expression level (Fig. 2B). Co-transfection of the effector Gal4[2$]:GUS and the effector GD resulted in an exceedingly lower expression level of the GUS reporter gene (Fig. 2B). However, the co-transfection of Gal4[2$]:GUS and GDeBLH3 effectors led to a higher GUS expression level compared to that of the GD control (Fig. 2B). BLH3 functioned as a transcriptional activator. HAeOFP1 is a protein obtained by the fusion of OFP1 and HA tag under the control of CaMV 35S promoter. GUS reporter plasmid (Gal4[2$]:GUS) and the effector of the GDeBLH3 fusion protein were transfected into protoplasts in order to test the integration of BLH3 and OFP1 affecting BLH3 transcriptional activity. Fig. 2B illustrates the difference between the suppressed expression of GUS gene by OFP1 and the activity of BLH3 alone. This result indicated that BLH3 can interact with OFP1 in vivo, and the transcriptional activity of BLH3 could be inhibited by OFP1. The N-terminal region containing SKY and BELL domains was fused to GD (GDeSKY-BELL), which remarkably increased GUS expression level, which was near to the integral BLH3 rate (Fig. 2C), implying that the SKY and BELL domains are involved in this activation. At the same time, the fusion of BLH3 HD region to GD (GDeBLH3-homoedomain) did not activate the expression of the reporter gene (Fig. 2C). These results indicate that a domain exerting major transcriptional activity is present within SKY and BELL domains. 3.3. Expression of BLH3 To investigate the patterns of tissue and organ expression of BLH3, we generated transgenic plants by transforming wild-type plants with an AtBLH3 promoter: GUS (b-glucuronidase) fusion construct. The GUS expression activity was inspected in three transgene lines which were similar in their expression patterns revealed by histochemical analysis. BLH3 representative expression is shown in Fig. 3A. The expression of AtOFP1prom:GUS was evidenced in a previous study [9]and is presented in Fig. 3B. 3.4. BLH3 and OFP1 in plant development To clarify the deep roles of BLH3 and OFP1 in the BELL-OFP protein complex in the regulation of timing of transition from
Fig. 3. Expression of AtBLH3. (A) Top: Expression of AtBLH3prom:GUS in 7-day-old seedlings. (from left to right):leaf, hypocotyl, close view of root, root tip. Bottom: Expression of AtBLH3prom:GUS in 11-day-old seedlings. (from left to right):leaf, hypocotyl, close view of root, root tip. (B) Expression of AtBLH3 in young seedlings and various parts of adult plants. ACTIN was used as a control in each PCR reaction.
vegetative to reproductive phase in Arabidopsis, the detailed phenotypic characterization of BLH3 and OFP1 loss-of-function mutants was analysed. The phenotype of ofp1-1 has been characterized earlier and has been established to be similar to that of the wild-type control [9]. We ordered the blh3 mutant (GK-961A08) from the European Arabidopsis Stock Centre (NASC) and obtained blh3 T-DNA insertion alleles. Further, we verified that blh3-1 contained a T-DNA insertion position in the exon region (Fig. 4). To elucidate the regulatory roles of BLH3/OFP1 in the BLHeOFP protein complex and the dependency relationship with OFP1/BLH3, 35S:BLH3/ofp lines were generated by crossing a ofp1-1 mutant line with 35S:BLH3 overexpression lines, and 35S:OFP1/blh lines by crossing a blh1-1 mutant line with 35S:OFP1 overexpression lines. The results are showed in Supplemental Fig. S1. In order to explore the involvement of the interactions of
496
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
(35s:BLH3/ofp1) in the Student's t-test, these differences in flowering time were highly significant (Table 1). In addition, the plastochron was estimated to be 1.44 for the wild type. However, no significant deviation in the plastochron was observed in ofp1, blh3, 35s:OFP1. 4. Discussion Previous results implied that some OFPs can interact with certain BLH and KNOX, which were reflected by a interaction network of OFPs with TALE transcription factors [3]. Ovate Family proteins themselves do not harbour putative a DNA-binding sequence, and OFP1 is not a transcriptional activator, but functions as a transcriptional repressor [9]. A possible speculation model is that OFPeBLHeKNOX protein complexes regulate transcription functions by the interaction of OFPs with BLH, or possibly by containing KNOX [4,5,9]. The results obtained in our study support the presumption that the interaction of OFP1 with BLH3 results in the formation of a transcription binding protein and indicate that a BLH3eOFP1 complex regulates the timing of transition from vegetative to reproductive phase in Arabidopsis.
Fig. 4. Identification of Atblh31-1 T-DNA insertion mutant. (A) The T-DNA insertion site in At blh3-1. (B) RT-PCR analysis of AtBLH3 transcript in the Atblh3e1 mutant. (C) Left: Atblh3e1 mutant plant, Right:wild plant.
AtBLH3 and AtOFP1 proteins in the regulatory mechanisms of the timing of transition from vegetative to reproductive phase, we subjected the progeny of the abovementioned lines to a detailed phenotypic analysis (at least 150 plants each line) by using the method described by Cole (2006) [1] (Table 1). Early flowering in BLH3-overexpressing plants was manifested by a reduction in leaf number in comparison with the control plants (12 or 14 leaves on average). At the same time, OFP1 transgenic plants exhibited some pleiotropic phenotype and flowered approximately two days later than wild-type controls, producing an number increased of leaves, on average two more leaf than the wild type (Table 1). The blh3 plants flowered at the same time as OFP1 overexpressing plants, and developed a similar quantity of leaves. In contrast, ofp1 plants flowered about two days earlier than the wildtype controls and produced less leaves, nearly two less leaves than the wild type. 35s:OFP1/blh3 plants displayed flowering and leaf quantity patterns similar to those of the wild-type controls, though pleiotropic OFP1 overexpression phenotype was not effectively suppressed in the blh3 mutant background. Conversely, 35s:BLH3/ ofp1 plants flowered five more days earlier than the wild-type controls and produced less leaves average four more leaves than wild type (Fig. S1). With P-values ranging from 0.001 (ofp1), 0.0002 (blh3), 0.002 (OFP1), 0.00001 (BLH3), 0.002 (35s:OFP1/blh3) to 0.002
4.1. OFP1 interacts with BLH3 in vivo to form transcription complexes By using yeast two-hybrid assays, we evidenced that OFP1 interacts with BLH3, and the OFP1eBLH3 interaction was further confirmed via BiFC analysis after protoplast transfection (Fig. 1C). Furthermore, in our examination, OFP1 was able to decrease BLH3 activity in the protoplast system (Fig. 2B). Similarly, AtOFP5 was reported to negatively regulate the activity of the BLH1-KNAT3 complex [4]. The results of co-transfection of the different effectors imply that there is a region with a predominant transcriptional activity within SKY-BELL domains of BLH3 (Fig. 2C), because the SKY-BELL domain individually enhanced the expression levels, similarly to the integrated BLH3 protein, and the SKY-BELL domain of BLH protein is also known to be necessary for heterodimerization with KNAT proteins through their HD domain [20,21]. The results of the yeast two-hybrid analyses indicated that the BLH3 HD domain can regulate the interaction with OFP1, which was verified [3]. At the same time, this finding supports the hypothesis that the HD domain of BLH and KNOX proteins might regulate the interactions with OFP conserved domain. Since the obvious domain of transcriptional activation was known in BLH3, and the domain could interact with KNAT, we concluded that it is possible that the interaction of BLH3 with OFP1 was not direct in vivo, but other possible interacting proteins also existed in protoplasts. Transfection assays using protoplasts from lines with mutations in genes encoding such interacting proteins could be used to address this point [5].
Table 1 The number of leaves at flowering, plastochron, and inflorescence length in at least T3 progeny of the wild control, ofp1, blh3, 35s:OFP1, 35s:BLH3, 35s:OFP1/blh3, and 35s:BLH3/ ofp1. T-test P-values in the plastochron column are relative to the wild type.
Col ofp1 blh3 35s:OFP1 35s:BLH3 35s:OFP1/blh3 35s:BLH3/ofp1
Leaf number at flowering
Plastochron day/leaf
p:t test
13.8(þ/0.72) 11.9(þ/0.61) 15.5(þ/0.80) 15.3(þ/0.73) 11.2(þ/0.86) 14.1(þ/0.71) 9.6(þ/0.75)
1.44(þ/0.15) 1.49(þ/0.11) 1.41(þ/0.20) 1.43(þ/0.09) 1.51(þ/0.12) 1.41(þ/0.17) 1.46(þ/0.12)
0.008 0.045 0.013 0.019 0.025 0.006
Inflorescence height(cm)
7.8(þ/0.63) 8.7(þ/0.81) 7.1(þ/0.53) 6.7(þ/0.61) 9.0(þ/0.83) 7.9(þ/0.72) 8.9(þ/0.91)
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
4.2. A BELLeOVATE complex is involved in the control of timing of transition from vegetative to reproductive phase BLH3 exerts a regulatory function in the timing of transition from vegetative to reproductive phase [1]. The interaction between BLH3 and OFP1 in vivo indicates that OFP1 is possibly a part of a BLHeOVATE complex regulating the time of this transition. Our finding that BLH3 is a transcriptional activator, rather than a repressor similar to OFP1 (in vitro), suggests that, in fact, BLH3 may be able to promote the transition from vegetative to reproductive phase, rather than to repress it. At the same time, OFP1 is a transcription repressor [9](Fig. 2A), and the result that 35s:BLH3/ofp1 plants flowered earlier and produced less leaves than 35s:BLH3 plants, and 35s:OFP1 flowered later and produced more leaves than the wild type, indicated also that OFP1 is possibly involved in the negative regulation of BLH3 or the complexes BLH3-KNOX, thus sustaining normal transition from vegetative to reproductive phase in Arabidopsis. If BLH3 functions together with OFP1 as part of a function protein complex in vivo, the expression pattern of BLH3 and OFP1 would be expected to be similar. Moreover, the experimental plants ceased to produce leaf primordia, and, instead, initiated floral meristems (FMs) during the transition from vegetative to reproductive phase. The expression of AtBLH3 revealed that BLH3 expression was basically consistent with the expression pattern of the promOFP1 expression (Fig. 3), including leaf, hypocotyl, close view of root, root tip, inflorescence stem and flower, which indicated that BLH3 proteins and OFP1 proteins were probably present in the same tissue cells. AtOFP1 contains a possible nuclear localization sequence but lacks a putative DNA-binding domain [9]. Thus, OFP1 could depend on other proteins as a complex to exert its action. Our data show that 35s:OFP1/blh3 plants exhibited flowering and leaf quantity that were similar to those of the wild-type controls, and 35s:BLH3/ofp1 plants flowered earlier and less leaves were formed than in the wild-type controls. Nevertheless, the pleiotropic OFP1 phenotype was not effectively suppressed in the blh3 mutant, suggesting that OFP1 functions possibly depend partly on BLH3 function in regulating the timing of transition from vegetative to reproductive phase. Furthermore, ofp1 shows significant changes in flowering time and leaf quantity compared to the wild-type control plants, suggesting that OFP1 have a potentially important regulatory function in the transition from vegetative to reproductive phase. In summary, the results support a model in which, by its interactions, the protein complex OFP1eBLH3 is involved in regulating the timing of transition from vegetative to reproductive phase. The OFPeBLH regulatory complex might also contain unknown KNOX proteins. In addition, OFP1 could possibly negatively regulate BLH3 or BLH3-KNOX complex, and functions in a module similar to those of other TALE homeodomain proteins and OFPs, including the negative regulation of BLH1-KNAT3 by OFP5 [4]. Acknowledgements We are grateful to Hemeng Wang and Wei Zhang for assistance with observation and data analysis. Research was supported by the National Nature Science Foundation of China (grant 31370221).
497
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.135. References [1] M. Cole, C. Nolte, W. Werr, Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana, Nucleic Acids Res. 34 (2006) 1281e1292. [2] J. Liu, J. Van Eck, B. Cong, S.D. Tanksley, A new class of regulatory genes underlying the cause of pear-shaped tomato fruit, P. Natl. Acad. U. S. A. 99 (2002) 13302e13306. [3] J. Hackbusch, K. Richter, J. Müller, F. Salamini, J.F. Uhrig, A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins, P. Natl. Acad. U. S. A. 102 (2005) 4908e4912. [4] G.C. Pagnussat, H.J. Yu, V. Sundaresan, Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1, Plant Cell 19 (2007) 3578e3592. [5] E. Li, S. Wang, Y. Liu, J.G. Chen, C.J. Douglas, OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana, Plant J. 67 (2011) 328e341. [6] S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. [7] T. Tzfira, G.W. Tian, S. Vyas, J. Li, Y. Leitner-Dagan, A. Krichevsky, V. Citovsky, pSAT vectors: a modular series of plasmids for autofluorescent protein tagging and expression of multiple genes in plants, Plant Mol. Biol. 57 (2005) 503e516. [8] S.D. Yoo, Y.H. Cho, J. Sheen, Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis, Nat. Protoc. 2 (2007) 1565e1572. [9] S. Wang, Y. Chang, J. Guo, J.G. Chen, Arabidopsis ovate family protein 1 is a transcriptional repressor that suppresses cell elongation, Plant J. 50 (2007) 858e872. [10] S.B. Tiwari, G. Hagen, T. Guilfoyle, The roles of auxin response factor domains in auxin-responsive transcription, Plant Cell 15 (2003) 533e543. [11] S. Wang, S.B. Tiwari, G. Hagen, T.J. Guilfoyle, AUXIN RESPONSE FACTOR7 restores the expression of auxin-responsive genes in mutant Arabidopsis leaf mesophyll protoplasts, Plant Cell 17 (2005) 1979e1993. [12] P. Hajdukiewicz, Z. Svab, P. Maliga, The small, versatilep PZP family of Agrobacterium binary vectors for plant transformation, Plant Mol. Biol. 25 (1994) 989e994. [13] S.B. Tiwari, S. Wang, G. Hagen, T.J. Guilfoyle, Transfection assays with Arabidopsis protoplasts containing integrated reporter genes, in: J. Salinas, J.J. Sanchez-Serrano (Eds.), Methods in Molecular Biology, Arabidopsis Protocols, The Humana Press, Totowa, NJ, 2006, pp. 241e249. [14] S. Huang, A.S. Raman, J.E. Ream, H. Fujiwara, R.E. Cerny, S.M. Brown, Overexpression of 20-oxidase confers a gibberellin-overproduction phenotype in Arabidopsis, Plant Physiol. 118 (1998) 773e781. [15] R.N. Wilson, C.R. Somerville, Phenotypic suppression of the gibberellininsensitive mutant (gai) of Arabidopsis, Plant Physiol. 108 (1995) 495e502. [16] J. Moon, S.S. Suh, H. Lee, K.R. Choi, C.B. Hong, N.C. Paek, I. Lee, The SOC1 MADSbox gene integrates vernalization and gibberellin signals for flowering in Arabidopsis, Plant J. (2003) 613e623. [17] J. Ehlting, N. Mattheus, D.S. Aeschliman, E. Li, B. Hamberger, I.F. Cullis, C.J. Douglas, Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation, Plant J. 42 (2005) 618e640. [18] J. Guo, J.G. Chen, RACK1 genes regulate plant development with unequal genetic redundancy in Arabidopsis, BMC Plant Biol. 8 (2008) 108. [19] S.B. Tiwari, G. Hagen, T.J. Guilfoyle, Aux/IAA proteins contain a potent transcriptional repression domain, Plant Cell 16 (2004) 533e543. [20] M. Bellaoui, M.S. Pidkowich, A. Samach, K. Kushalappa, S.E. Kohalmi, Z. Modrusan, G.W. Haughn, The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals, Plant Cell 13 (2001) 2455e2470. [21] J. Müller, Y. Wang, R. Franzen, L. Santi, F. Salamini, W. Rohde, In vitro interactions between barley TALE homeodomain proteins suggest a role for proteineprotein associations in the regulation of Knox gene function, Plant J. 27 (2001) 13e23.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Ovate family protein1 interaction with BLH3 regulates transition timing from vegetative to reproductive phase in Arabidopsis Liguo Zhang a, b, Xiaofei Zhang c, Hanxun Ju a, Jingui Chen d, Shucai Wang e, Hemeng Wang a, Yuanling Zhao b, Ying Chang a, * a
College of Life Science, Northeast Agricultural University, Harbin, 150030, China Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China College of Mathematics and Information Sciences of Guangxi University, Nanning, 530004, China d Oak Ridge National Laboratory, Oak Ridge, TN, 37831, USA e College of Life Science, Northeast Normal University, Changcun, 130024, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 January 2016 Accepted 21 January 2016 Available online 23 January 2016
Three-Amino-acid-Loop-Extension(TALE) homeodomain transcription factor BLH3 regulates timing of transition from vegetative to reproductive phase. Previous preliminary results obtained using large-scale yeast two-hybrids indicate that BLH3 protein possibly interact with Ovate Family Proteins(OFPs) transcription co-regulators. Nevertheless, it is uncertain whether OFP1eBLH3 complex is involved in regulation of timing of transition from vegetative to reproductive phase in Arabidopsis. The interaction between BLH3 and OFP1 was re-tested and verified by a yeast two-hybrid system. We found that the BLH3eOFP1 interaction was mainly mediated through the BLH3 homeodomain. Meanwhile, this interaction was further confirmed by bimolecular fluorescence complementation (BiFC) in vivo. Further, by establishing protoplast transient expression, we discovered that BLH3 acts as a transcriptional activator, whereas OFP1 functioned as a repressor. The interactions between OFP1 and BLH3 can reduce BLH3 transcriptional activity. The ofp1 mutant lines and blh3 mutant lines, OFP1 overexpress lines and BLH3 overexpress lines can both influence timing of transition from vegetative to reproductive phase. Furthermore, 35s:OFP1/blh3 plants exhibited flowering and leaf quantity similar to that of the wild-type controls. 35s:BLH3/ofp1 plants flowered earlier and had less leaves than wild-type controls, indicating that OFP1 protein might depend partially on BLH3 in its function to regulate the timing of transition from vegetative to reproductive phase. These results support our assumption that, by interacting with OFP1, BLH3 forms a functional protein complex that controls timing of progression from vegetative to reproductive phase, and OFP1 might negatively regulate BLH3 or the BLH-KNOX complex, an important interaction for sustaining the normal transition from vegetative to reproductive phase. © 2016 Elsevier Inc. All rights reserved.
Keywords: OFP1 BLH3 Vegetative to reproductive phase Proteineprotein interaction Arabidopsis
1. Introduction Regulation of the timing of transition from vegetative to reproductive phase is an important biological process, which controls the point in time during development when a vegetative meristem changes and becomes an inflorescence or floral meristem and the rate at which the change occurs. BLH3 is one of 13 BEL1-like (BLH or BELL) members in Arabidopsis. Several BELL members have been shown to govern the
* Corresponding author. E-mail address: [email protected] (Y. Chang). http://dx.doi.org/10.1016/j.bbrc.2016.01.135 0006-291X/© 2016 Elsevier Inc. All rights reserved.
transition from the vegetative to the reproductive phase in plants. For example, plants overexpressing BLH6 flower later, whereas BLH3 overexpression induces early flowering [1]. OVATE genes encode a protein with an approximately 70-aa Cterminal domain which is conserved in tomato, rice, and Arabidopsis [2]. In Arabidopsis, 18 genes are predicted to encode the OVATE domain proteins. Heretofore, only a few AtOFPs have been shown to regulate plant growth and development. The representatives of the OFP family are plant-specific proteins, indicating a close functional connection with TALE homeodomain proteins [3]. In a previous study, the BLH1-KNAT3 protein complex was negatively regulated by AtOFP5 protein during early embryo sac development [4]. More recently, a report revealed that AtOFP4
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
participated in the regulation of secondary cell wall formation by interacting with KNAT7 [5]. The protein interactions of Arabidopsis TALE homeodomain proteins were systematically analysed by using the yeast twohybrid assay, which evidenced a complicated regulatory interaction network among OFP, KNOX, and BLH in Arabidopsis; the interactions of several OFPs with BLH3 were also reported [3]. However, the findings on some interactions in the network have been invalidated by using other methods to establish protein interactions. Furthermore, at present, the information concerning the biological development roles of OFPs or complex of TALE-OFPs is still scarce. Here, the interaction of OFP1 and BLH3 was verified in Arabidopsis thaliana; BLH3 acted as an activator, whereas OFP1 functioned as a repressor. Moreover, The research results suggested that OFP1 plays an important role in regulating time of transition from vegetative to reproductive phase by interacting with BLH3, supporting the extensive information regarding OFP regulatory functions in plants. 2. Materials and methods 2.1. Plant materials All mutants, the wild-type and transgenic lines, were in the background of ecotype Columbia Arabidopsis (Col-0). Seeds were germinated and grown on 1/2 Murashige and Skoog basal medium containing vitamins, and was cold-treated in the dark for 48 h, and incubated at 22 C under the conditions of a 14 h light/10 h dark photoperiod. The mutant allele of BLH3, GK-961A08, which is a T-DNA insertion, designated as Atblh3-1, was evaluated by consulting the SIGnal database, and seeds were ordered from the NASC(European Arabidopsis Stock Centre). An BLH3 gene-specific primer (50 ATGGCTGTGTATTACCCTAAT AGTGTC-30 ,50 -TTAGACAACAAAGTCGTGTAATTGATG-30 ) and the T-DNA-specific primer (50 ATAATAACGCTGCGGACATCTACATTTT -30 ) were used in PCR analysis. The insertion site of T-DNA was identified by checking nucleic acid sequences. The floral dip method was utilized for transgenesis in wild-type Arabidopsis plants background, as described earlier by Clough and Bent (1998) [6]. At least five transgene lines were identified and confirmed in minimum T3 generations. 2.2. Plasmid construction for proteineprotein interactions in yeasts The Open Reading Frame(ORF) of OFP1 and BLH3 was cloned in wild-type Arabidopsis cDNA. The homeodomain and SKY-BELL domain were divided according to Cole method [1] and using tools at http://smart.embl-heidelberg.de/.The homeodomain and SKY-BELL fragments were obtained by amplification of BLH3 plasmids(50 -TCGTTACGTTGGCCTTGGAA-30 , 50 -CTCCCCCAAT0 0 CAACTGGCAT-3 ,and5 -ACGGAAACGTAACGGTGTCA-30 , 50 ACCCTGATGTCTCGTAACGG-30 ). Fusion plasmids of pGBKT7-AtOFP1 were transformed into the yeast strain Y2HGold, and BLH3 cDNA was inserted into pGADT7. Their interaction was tested on SD medium(-Trp, -His,-Trp, -Ade) after selection on SD (-Trp, -Leu) medium. The known interaction between pGBKT7-p53 and pGADT7-SV40 plasmids was used as a positive control. The yeast cells harbouring the pGBKT7-Lam and pGADT7-SV40 plasmids were used as the negative control. 2.3. Bimolecular fluorescence complementation (BiFC) assays The fusion proteins of AtBLH3-YFPN and AtOFP-YFPC under 35S
493
promoter regulation were obtained by using N-terminal of EYFP vectors and the C-terminal of EYFP vectors [7]. After amplifying cDNA, the full sequences of AtOFP1 and AtBLH3 were sub-cloned into the pSAT6-nEYFP-N1 vector and pSAT6cEYFPN1 vector, respectively. The resulting constructs were used for transient assays by polyethylene glycol transfection of Arabidopsis protoplasts, as described by Yoo et al. [8]. Transfected cells were imaged by using a Leica TCS SP2 confocal spectral microscope imaging system. 2.4. Plasmid constructions and protoplast transfection analysis in Arabidopsis The constructs of OFP1 prom: GUS,35S:GD-OFP1 and 35S:HAOFP1 have been outlined in an earlier study [5,9]. pUC19 with two 35S enhancer promoters was connected with a PCR fragment, which was cloned in a frame with a GD tag or a Nterminal HA tag [10,11]. The pUC19 vector was digested with the EcoRI restriction enzyme and was inserted into the binary vector pZP211 via plant transformation for corresponding constructs with the HA tag [12]. 35S:GD-OFP1 constructs in the pUC19 vector, which were used for protoplast transfection and plasmid DNA extraction. The effector of AtOFP1 genes, LD-VP16 transactivator, and the reporter genes LexA(2X)-Gal4(2X):GUS and Gal4(2X):GUS were utilized, as described in previous reports [5,9]. The abovementioned methods were employed for the extraction of protoplasts and execution of transfection experiments [11,13]. Student's t-test was applied for statistical analyses. At least three replicates were performed in all transfection analyses, which were repeated at least twice. 2.5. Reverse transcription PCR and GUS expression assay RNA samples from fresh Arabidopsis tissue were extracted by using RNA extraction kit (Takara) according to the manufacturer's instructions, and reverse transcriptase by the RT kit (Takara). AtBLH3-specific primers (50 -ATGGCTGT GTATTACCCTAATAGTGTC30 , 50 - TTAGACAACAAAGTCGTGTAATTGATG-30 ). ACTIN gene (At2g37620) was regarded as a positive control(primers 50 -C CAGAAGGATGCATATGTTGGTGA-30 , 50 -GAGGAGCCTCGGTAAGAAGA-30 ). The prom BLH3:GUS for plant transformation was generate by BLH3 promoter, a 742-bp genomic fragment upstream of the BLH3 coding region was fused to the GUS reporter gene. The GUS expression activity of 7- and 10-day-old Arabidopsis tissues was detected in a buffer solution (pH 7.0), which contained 1 mM 5bromo-4-chloro-3-indolyl-b-D-glucuronide (X-GLUC), 0.1% Triton X-100, and 0.5 mM potassium ferricyanide, and the tissues were incubated for 1e12 h at 37 C. The tissue under investigation was observed via a Leica DM6000 microscope. 3. Results 3.1. BLH3 interaction with OFP1 The complicated interaction network among the proteins, i.e., OFPeKNOXeBELL, indicated potential interactions of BLH3 with some OFPs, including those with OFP2, OFP3, OFP4, and OFP5, beside that with OFP1 [3]. At present, only the insertion mutants of OFP1 and OFP4 among OFP members are used. AtOFP1 is localized in the nucleus and regulates AtGA20ox1, which is a gene encoding the key enzyme in gibberellin(GA) biosynthesis [9]. Further, GA can regulate growth and development in Arabidopsis, including the control over the timing of transition from vegetative to reproductive phase [14e16].
494
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
In addition, microarray analysis results concerning inflorescence stem development implied that OFP1 is upregulated during the course [17], and evidence was provided that OFP1 is an essential pleiotropic developmental regulator [3]. Therefore, OFP1 was selected as a protein that could be a potential interaction partner with BLH3, which regulate the timing of transition from vegetative to reproductive phase in Arabidopsis. The ability of OFP1 to interact with BLH3 was re-tested by using the yeast two-hybrid trial, in a targeted fashion rather than as a part of a largeescale interaction matrix [3]. Fig. 1A reflects that after the expression of a BLH3eDNA binding domain (BD) fusion protein and an OFP1eactivation domain (AD) fusion protein, they could interact adequately in yeast cells. Hackbusch (2005) suggested that the homeodomain (HD) of BLH protein might interact with the ovate domain of the Ovate Family Proteins [3]. To examine the domain of BLH3 interactions with OFP1, we generated two fusions of BLH3 domains, including SKY-BELL domain and HD domain. The two domains were separately fused to GD, and their interaction abilities with ADeOFP1 fusion protein were determined (Fig. 1B). The results indicate that the BLH3 homeodomain interacted with OFP1 protein, suggesting that the HD domain of BLH3 protein is necessary for interaction with OFP1 protein. To further confirm the occurrence of these interactions in vivo, a BiFC assay was performed by using an Arabidopsis protoplast transient expression system Co-expression. of both N-terminal
yellow fluorescent protein (YFPN)-tagged AtBLH3 and C-terminal YFP (YFPC)-tagged AtOFP1, there is not fluorescence of alone YFPN or YFPC. The Arabidopsis leaf mesophyll protoplast transient expression system [13]. YFPN-AtBLH3 and YFPC- AtOFP1 were transformed into protoplasts, which generated fluorescence in vivo (Fig. 1C). RACK1,a non-interacting protein [18] was used as a negative control. These results suggested that the AtBLH3 protein interacts with the AtOFP1 in planta. 3.2. BLH3 is a transcriptional activator BLH3 can integrate with OFP1, and the findings of a previous study implied that OFP1 acted as a transcriptional repressor [9], and BLH3 was localized to the nucleus [1], but the transcriptional activity of BLH3 is still not certain. To determine whether BLH3 could function similarly to OFP1, we applied the protoplast transfection system [5,9], illustrated in Fig. 2. This trial system was employed for testing of transcriptional activity, using a potent LexA DNA-binding domain and Gal4 DNA-binding domain, and the corresponding VP16 transcriptional activator and GD-AtBLH3(AtOFP1) transcription factor. The testing ability of the system has been well exemplified in a number of studies, including those on OFP1 [9], KNAT7 protein [5], and AUX/IAA proteins [19]. The transactivator LDeVP16 and the effector GD were transfected into protoplasts, which resulted in increased activation of the GUS reporter gene (Fig. 2A). However, co-transfection LDeVP16
Fig. 1. Interaction of OFP1 with BLH3 in yeast cells and in planta. (A) BLH3 interacts with OFP1 in yeast cells. Gal4 activation domain (AD) fusion constructs and Gal4 DNA-binding domain (BD) fusion construction were harboured in Yeast Y2HGold cells. The yeast cells were selected on SD medium lacking Leu and Trp (DDO) and interaction was assessed according to their ability to grow on selective SD medium lacking Leu, Trp, His, and Ade (QDO) for 5 d. (B) The fragments of BDeBLH3 interact with ADeOFP1 in yeast cells, Gal4 activation domain (AD). (C) Bimolecular fluorescence complementation analyses of BLH3 interactions with OFP1. The co-transfection of BLH3eYFPN þ OFP1eYFPC in Arabidopsis protoplasts. The different images were analysed by a confocal microscope after transfection. yellow fluorescence implies proteins interaction of BLH3 with OFP1.
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
495
Fig. 2. BLH3 is a transcriptional activator that interacts with OFP1 as a repressor in vivo. The ability of BLH3 and OFP1 to repress or activate GUS reporter gene were tested by using protoplast transfection system. (A) Relative GUS activity indicates BLH3(OFP1) transcriptional activation by co-transfecting with an LD-VP16 transactivator plasmid and a effector plasmid GD or GD-OFP1. The expression of 35S:luciferase (Luc) was used to normalized the expression of the GUS reporter gene. The standard deviation of three replicate transfections were represented by error bars. (B) Relative GUS activity indicates that interaction of OFP1 with BLH3 affect BLH3 transcriptional activity. (C) The location of the BLH3 transcriptional activation domains by using a protoplast transfection system.
and GDeOFP1 effectors caused a decrease in GUS expression level (Fig. 2B). Co-transfection of the effector Gal4[2$]:GUS and the effector GD resulted in an exceedingly lower expression level of the GUS reporter gene (Fig. 2B). However, the co-transfection of Gal4[2$]:GUS and GDeBLH3 effectors led to a higher GUS expression level compared to that of the GD control (Fig. 2B). BLH3 functioned as a transcriptional activator. HAeOFP1 is a protein obtained by the fusion of OFP1 and HA tag under the control of CaMV 35S promoter. GUS reporter plasmid (Gal4[2$]:GUS) and the effector of the GDeBLH3 fusion protein were transfected into protoplasts in order to test the integration of BLH3 and OFP1 affecting BLH3 transcriptional activity. Fig. 2B illustrates the difference between the suppressed expression of GUS gene by OFP1 and the activity of BLH3 alone. This result indicated that BLH3 can interact with OFP1 in vivo, and the transcriptional activity of BLH3 could be inhibited by OFP1. The N-terminal region containing SKY and BELL domains was fused to GD (GDeSKY-BELL), which remarkably increased GUS expression level, which was near to the integral BLH3 rate (Fig. 2C), implying that the SKY and BELL domains are involved in this activation. At the same time, the fusion of BLH3 HD region to GD (GDeBLH3-homoedomain) did not activate the expression of the reporter gene (Fig. 2C). These results indicate that a domain exerting major transcriptional activity is present within SKY and BELL domains. 3.3. Expression of BLH3 To investigate the patterns of tissue and organ expression of BLH3, we generated transgenic plants by transforming wild-type plants with an AtBLH3 promoter: GUS (b-glucuronidase) fusion construct. The GUS expression activity was inspected in three transgene lines which were similar in their expression patterns revealed by histochemical analysis. BLH3 representative expression is shown in Fig. 3A. The expression of AtOFP1prom:GUS was evidenced in a previous study [9]and is presented in Fig. 3B. 3.4. BLH3 and OFP1 in plant development To clarify the deep roles of BLH3 and OFP1 in the BELL-OFP protein complex in the regulation of timing of transition from
Fig. 3. Expression of AtBLH3. (A) Top: Expression of AtBLH3prom:GUS in 7-day-old seedlings. (from left to right):leaf, hypocotyl, close view of root, root tip. Bottom: Expression of AtBLH3prom:GUS in 11-day-old seedlings. (from left to right):leaf, hypocotyl, close view of root, root tip. (B) Expression of AtBLH3 in young seedlings and various parts of adult plants. ACTIN was used as a control in each PCR reaction.
vegetative to reproductive phase in Arabidopsis, the detailed phenotypic characterization of BLH3 and OFP1 loss-of-function mutants was analysed. The phenotype of ofp1-1 has been characterized earlier and has been established to be similar to that of the wild-type control [9]. We ordered the blh3 mutant (GK-961A08) from the European Arabidopsis Stock Centre (NASC) and obtained blh3 T-DNA insertion alleles. Further, we verified that blh3-1 contained a T-DNA insertion position in the exon region (Fig. 4). To elucidate the regulatory roles of BLH3/OFP1 in the BLHeOFP protein complex and the dependency relationship with OFP1/BLH3, 35S:BLH3/ofp lines were generated by crossing a ofp1-1 mutant line with 35S:BLH3 overexpression lines, and 35S:OFP1/blh lines by crossing a blh1-1 mutant line with 35S:OFP1 overexpression lines. The results are showed in Supplemental Fig. S1. In order to explore the involvement of the interactions of
496
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
(35s:BLH3/ofp1) in the Student's t-test, these differences in flowering time were highly significant (Table 1). In addition, the plastochron was estimated to be 1.44 for the wild type. However, no significant deviation in the plastochron was observed in ofp1, blh3, 35s:OFP1. 4. Discussion Previous results implied that some OFPs can interact with certain BLH and KNOX, which were reflected by a interaction network of OFPs with TALE transcription factors [3]. Ovate Family proteins themselves do not harbour putative a DNA-binding sequence, and OFP1 is not a transcriptional activator, but functions as a transcriptional repressor [9]. A possible speculation model is that OFPeBLHeKNOX protein complexes regulate transcription functions by the interaction of OFPs with BLH, or possibly by containing KNOX [4,5,9]. The results obtained in our study support the presumption that the interaction of OFP1 with BLH3 results in the formation of a transcription binding protein and indicate that a BLH3eOFP1 complex regulates the timing of transition from vegetative to reproductive phase in Arabidopsis.
Fig. 4. Identification of Atblh31-1 T-DNA insertion mutant. (A) The T-DNA insertion site in At blh3-1. (B) RT-PCR analysis of AtBLH3 transcript in the Atblh3e1 mutant. (C) Left: Atblh3e1 mutant plant, Right:wild plant.
AtBLH3 and AtOFP1 proteins in the regulatory mechanisms of the timing of transition from vegetative to reproductive phase, we subjected the progeny of the abovementioned lines to a detailed phenotypic analysis (at least 150 plants each line) by using the method described by Cole (2006) [1] (Table 1). Early flowering in BLH3-overexpressing plants was manifested by a reduction in leaf number in comparison with the control plants (12 or 14 leaves on average). At the same time, OFP1 transgenic plants exhibited some pleiotropic phenotype and flowered approximately two days later than wild-type controls, producing an number increased of leaves, on average two more leaf than the wild type (Table 1). The blh3 plants flowered at the same time as OFP1 overexpressing plants, and developed a similar quantity of leaves. In contrast, ofp1 plants flowered about two days earlier than the wildtype controls and produced less leaves, nearly two less leaves than the wild type. 35s:OFP1/blh3 plants displayed flowering and leaf quantity patterns similar to those of the wild-type controls, though pleiotropic OFP1 overexpression phenotype was not effectively suppressed in the blh3 mutant background. Conversely, 35s:BLH3/ ofp1 plants flowered five more days earlier than the wild-type controls and produced less leaves average four more leaves than wild type (Fig. S1). With P-values ranging from 0.001 (ofp1), 0.0002 (blh3), 0.002 (OFP1), 0.00001 (BLH3), 0.002 (35s:OFP1/blh3) to 0.002
4.1. OFP1 interacts with BLH3 in vivo to form transcription complexes By using yeast two-hybrid assays, we evidenced that OFP1 interacts with BLH3, and the OFP1eBLH3 interaction was further confirmed via BiFC analysis after protoplast transfection (Fig. 1C). Furthermore, in our examination, OFP1 was able to decrease BLH3 activity in the protoplast system (Fig. 2B). Similarly, AtOFP5 was reported to negatively regulate the activity of the BLH1-KNAT3 complex [4]. The results of co-transfection of the different effectors imply that there is a region with a predominant transcriptional activity within SKY-BELL domains of BLH3 (Fig. 2C), because the SKY-BELL domain individually enhanced the expression levels, similarly to the integrated BLH3 protein, and the SKY-BELL domain of BLH protein is also known to be necessary for heterodimerization with KNAT proteins through their HD domain [20,21]. The results of the yeast two-hybrid analyses indicated that the BLH3 HD domain can regulate the interaction with OFP1, which was verified [3]. At the same time, this finding supports the hypothesis that the HD domain of BLH and KNOX proteins might regulate the interactions with OFP conserved domain. Since the obvious domain of transcriptional activation was known in BLH3, and the domain could interact with KNAT, we concluded that it is possible that the interaction of BLH3 with OFP1 was not direct in vivo, but other possible interacting proteins also existed in protoplasts. Transfection assays using protoplasts from lines with mutations in genes encoding such interacting proteins could be used to address this point [5].
Table 1 The number of leaves at flowering, plastochron, and inflorescence length in at least T3 progeny of the wild control, ofp1, blh3, 35s:OFP1, 35s:BLH3, 35s:OFP1/blh3, and 35s:BLH3/ ofp1. T-test P-values in the plastochron column are relative to the wild type.
Col ofp1 blh3 35s:OFP1 35s:BLH3 35s:OFP1/blh3 35s:BLH3/ofp1
Leaf number at flowering
Plastochron day/leaf
p:t test
13.8(þ/0.72) 11.9(þ/0.61) 15.5(þ/0.80) 15.3(þ/0.73) 11.2(þ/0.86) 14.1(þ/0.71) 9.6(þ/0.75)
1.44(þ/0.15) 1.49(þ/0.11) 1.41(þ/0.20) 1.43(þ/0.09) 1.51(þ/0.12) 1.41(þ/0.17) 1.46(þ/0.12)
0.008 0.045 0.013 0.019 0.025 0.006
Inflorescence height(cm)
7.8(þ/0.63) 8.7(þ/0.81) 7.1(þ/0.53) 6.7(þ/0.61) 9.0(þ/0.83) 7.9(þ/0.72) 8.9(þ/0.91)
L. Zhang et al. / Biochemical and Biophysical Research Communications 470 (2016) 492e497
4.2. A BELLeOVATE complex is involved in the control of timing of transition from vegetative to reproductive phase BLH3 exerts a regulatory function in the timing of transition from vegetative to reproductive phase [1]. The interaction between BLH3 and OFP1 in vivo indicates that OFP1 is possibly a part of a BLHeOVATE complex regulating the time of this transition. Our finding that BLH3 is a transcriptional activator, rather than a repressor similar to OFP1 (in vitro), suggests that, in fact, BLH3 may be able to promote the transition from vegetative to reproductive phase, rather than to repress it. At the same time, OFP1 is a transcription repressor [9](Fig. 2A), and the result that 35s:BLH3/ofp1 plants flowered earlier and produced less leaves than 35s:BLH3 plants, and 35s:OFP1 flowered later and produced more leaves than the wild type, indicated also that OFP1 is possibly involved in the negative regulation of BLH3 or the complexes BLH3-KNOX, thus sustaining normal transition from vegetative to reproductive phase in Arabidopsis. If BLH3 functions together with OFP1 as part of a function protein complex in vivo, the expression pattern of BLH3 and OFP1 would be expected to be similar. Moreover, the experimental plants ceased to produce leaf primordia, and, instead, initiated floral meristems (FMs) during the transition from vegetative to reproductive phase. The expression of AtBLH3 revealed that BLH3 expression was basically consistent with the expression pattern of the promOFP1 expression (Fig. 3), including leaf, hypocotyl, close view of root, root tip, inflorescence stem and flower, which indicated that BLH3 proteins and OFP1 proteins were probably present in the same tissue cells. AtOFP1 contains a possible nuclear localization sequence but lacks a putative DNA-binding domain [9]. Thus, OFP1 could depend on other proteins as a complex to exert its action. Our data show that 35s:OFP1/blh3 plants exhibited flowering and leaf quantity that were similar to those of the wild-type controls, and 35s:BLH3/ofp1 plants flowered earlier and less leaves were formed than in the wild-type controls. Nevertheless, the pleiotropic OFP1 phenotype was not effectively suppressed in the blh3 mutant, suggesting that OFP1 functions possibly depend partly on BLH3 function in regulating the timing of transition from vegetative to reproductive phase. Furthermore, ofp1 shows significant changes in flowering time and leaf quantity compared to the wild-type control plants, suggesting that OFP1 have a potentially important regulatory function in the transition from vegetative to reproductive phase. In summary, the results support a model in which, by its interactions, the protein complex OFP1eBLH3 is involved in regulating the timing of transition from vegetative to reproductive phase. The OFPeBLH regulatory complex might also contain unknown KNOX proteins. In addition, OFP1 could possibly negatively regulate BLH3 or BLH3-KNOX complex, and functions in a module similar to those of other TALE homeodomain proteins and OFPs, including the negative regulation of BLH1-KNAT3 by OFP5 [4]. Acknowledgements We are grateful to Hemeng Wang and Wei Zhang for assistance with observation and data analysis. Research was supported by the National Nature Science Foundation of China (grant 31370221).
497
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.135. References [1] M. Cole, C. Nolte, W. Werr, Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana, Nucleic Acids Res. 34 (2006) 1281e1292. [2] J. Liu, J. Van Eck, B. Cong, S.D. Tanksley, A new class of regulatory genes underlying the cause of pear-shaped tomato fruit, P. Natl. Acad. U. S. A. 99 (2002) 13302e13306. [3] J. Hackbusch, K. Richter, J. Müller, F. Salamini, J.F. Uhrig, A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins, P. Natl. Acad. U. S. A. 102 (2005) 4908e4912. [4] G.C. Pagnussat, H.J. Yu, V. Sundaresan, Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1, Plant Cell 19 (2007) 3578e3592. [5] E. Li, S. Wang, Y. Liu, J.G. Chen, C.J. Douglas, OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana, Plant J. 67 (2011) 328e341. [6] S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. [7] T. Tzfira, G.W. Tian, S. Vyas, J. Li, Y. Leitner-Dagan, A. Krichevsky, V. Citovsky, pSAT vectors: a modular series of plasmids for autofluorescent protein tagging and expression of multiple genes in plants, Plant Mol. Biol. 57 (2005) 503e516. [8] S.D. Yoo, Y.H. Cho, J. Sheen, Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis, Nat. Protoc. 2 (2007) 1565e1572. [9] S. Wang, Y. Chang, J. Guo, J.G. Chen, Arabidopsis ovate family protein 1 is a transcriptional repressor that suppresses cell elongation, Plant J. 50 (2007) 858e872. [10] S.B. Tiwari, G. Hagen, T. Guilfoyle, The roles of auxin response factor domains in auxin-responsive transcription, Plant Cell 15 (2003) 533e543. [11] S. Wang, S.B. Tiwari, G. Hagen, T.J. Guilfoyle, AUXIN RESPONSE FACTOR7 restores the expression of auxin-responsive genes in mutant Arabidopsis leaf mesophyll protoplasts, Plant Cell 17 (2005) 1979e1993. [12] P. Hajdukiewicz, Z. Svab, P. Maliga, The small, versatilep PZP family of Agrobacterium binary vectors for plant transformation, Plant Mol. Biol. 25 (1994) 989e994. [13] S.B. Tiwari, S. Wang, G. Hagen, T.J. Guilfoyle, Transfection assays with Arabidopsis protoplasts containing integrated reporter genes, in: J. Salinas, J.J. Sanchez-Serrano (Eds.), Methods in Molecular Biology, Arabidopsis Protocols, The Humana Press, Totowa, NJ, 2006, pp. 241e249. [14] S. Huang, A.S. Raman, J.E. Ream, H. Fujiwara, R.E. Cerny, S.M. Brown, Overexpression of 20-oxidase confers a gibberellin-overproduction phenotype in Arabidopsis, Plant Physiol. 118 (1998) 773e781. [15] R.N. Wilson, C.R. Somerville, Phenotypic suppression of the gibberellininsensitive mutant (gai) of Arabidopsis, Plant Physiol. 108 (1995) 495e502. [16] J. Moon, S.S. Suh, H. Lee, K.R. Choi, C.B. Hong, N.C. Paek, I. Lee, The SOC1 MADSbox gene integrates vernalization and gibberellin signals for flowering in Arabidopsis, Plant J. (2003) 613e623. [17] J. Ehlting, N. Mattheus, D.S. Aeschliman, E. Li, B. Hamberger, I.F. Cullis, C.J. Douglas, Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation, Plant J. 42 (2005) 618e640. [18] J. Guo, J.G. Chen, RACK1 genes regulate plant development with unequal genetic redundancy in Arabidopsis, BMC Plant Biol. 8 (2008) 108. [19] S.B. Tiwari, G. Hagen, T.J. Guilfoyle, Aux/IAA proteins contain a potent transcriptional repression domain, Plant Cell 16 (2004) 533e543. [20] M. Bellaoui, M.S. Pidkowich, A. Samach, K. Kushalappa, S.E. Kohalmi, Z. Modrusan, G.W. Haughn, The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals, Plant Cell 13 (2001) 2455e2470. [21] J. Müller, Y. Wang, R. Franzen, L. Santi, F. Salamini, W. Rohde, In vitro interactions between barley TALE homeodomain proteins suggest a role for proteineprotein associations in the regulation of Knox gene function, Plant J. 27 (2001) 13e23.
