PROTEIN

EXPRESSION

AND

PURIFICATION

2,179-187

(1991)

Overproduction and Rapid Purification of the Phosphoeno/pyruvate:Sugar Phosphotransferase System Proteins Enzyme I, HPr, and Protein IIIG’C of Escherichia co/i’ Prasad Reddy, *Z Natalie Fredd-Kuldell,tp3 Ellen Liberman,tv4 and Alan Peterkofskyt *Center for Advanced Research in Biotechnology, National Institute of Standards and Technology, 9600 Gudekky Drive, Rockville, Maryland 20850; and tLaboratory of Biochemical Genetics, National Heart, Lung, and Blood Institute, Bethesda, Maryland 20892 Received

February

11,1991,

and in revised

form

June

4,199l

We present methods for the rapid, simple purification of Enzyme I, HPr, and Protein IIIG’D of the Escherichia coli phosphoenolpyruvate:sugar phosphotransferase system (PTS) using plasmids overproducing gene products. The gene for HPr (PtsH) was cloned into the expression vector pKC30. A simple procedure was devised for the purillcation to homogeneity of this protein from extracts of heat-induced cells containing pKC30/ ptsH recombinant clone. The genes for Enzyme I (ptsl) and Protein IIIG” (err) were cloned separately into the expression vector pRE 1. Rapid purification procedures were developed for the isolation of homogeneous preparations of these two proteins from extracts of heat-induced cells containingpRE llptsland pRE llcrrrecombinants. From about 6 g of cells, these procedures yielded 100,86, and 50 mg of Enzyme I, HPr, and Protein IIIG”, respectively. The activity of the proteins purified by these methods was comparable to that of the proteins isolated by previously published less efficient procedures. Q1991Academic PWS, 1~.

The bacterial phosphoenolpyruvate:sugar phosphotransferase system (PTS) is one of the most complex i Certain commercial equipment, instruments, and materials are identified in this paper in order to specify the experimental procedure as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that the material, instrument, or equipment identified is necessarily the best available for the purpose. ’ To whom correspondence should be addressed. 3 Present address: Harvard Medical School, Department of Microbiology and Molecular Genetics, Boston, MA 02115. * Present address: USDA, APHIS, BBEP, Biotechnology Permits, Hyattsville, MD 20782. 1046-5928/91 $3.00 Copyright 0 1991 by Academic Press, All rights of reproduction in any form

and thoroughly studied biological processes but is as yet not completely understood (1). The PTS consists of two general cytoplasmic proteins, Enzyme I and HPr. Two additional proteins, a sugar-specific Protein III and an integral membrane protein, Enzyme II, function in the vectorial phosphorylation and translocation of the sugar. For certain sugar transport systems, Protein III and Enzyme II exist as individual polypeptides and for others a single polypeptide chain encompasses both functions (2). Protein IIIG’“, in addition to its role in glucose transport, has been implicated in a variety of signal transducing pathways including the regulation of adenylate cyclase activity and a variety of non-PTS carbohydrate permeases (3). In our studies of the reconstitution of the regulatory properties of adenylate cyclase in uitro, only when a combination of the PTS proteins Enzyme I, HPr, and Protein IIIG” was added at normal intracellular concentrations did we observe a partial reconstitution (4). In order to carry out reconstitution studies, we needed to routinely purify these three proteins. The method for the purification of these PTS proteins to homogeneity has previously been published by Roseman and co-workers (57), but this required substantial cell mass to obtain quantities in the order of 20-50 mg of each purified protein. In order to facilitate that purification process, we cloned the corresponding genesptsH, ptsl, and err (8,9) into the vector pKC30 and the recently developed pRE1 expression vector (10). This allowed the overproduction of the PTS proteins and the development of simple purification procedures for the three proteins that could be used on a routine basis. We describe here the optimal conditions for overproduction of Enzyme I, HPr, and Protein IIIG’” and the purification procedures for each protein. From 6 g of wet cell paste, 100 mg of Enzyme I, 86 mg of HPr, and 50 mg of Protein IIIG’” were obtained. 179

Inc. reserved.

180 MATERIALS

REDDY

AND

METHODS

Enzymes and chemicals. Restriction endonucleases, T4 DNA ligase, T4 DNA polymerase, T4 polynucleotide kinase, and the Klenow fragment of DNA polymerase were purchased from New England Biolabs (Beverly, MA). Calf intestinal alkaline phosphatase was from Boehringer-Mannheim (Indianapolis, IN). Isopropyl-flD-thiogalactopyranoside, 5bromo-4-chloro-3-indolyl/?-D-galactoside, acrylamide, bisacrylamide, and phenol were obtained from Bethesda Research Laboratories (Gaithersburg, MD). Deoxynucleoside triphosphates, dideoxynucleoside triphosphates, and Sephadex G-75 (superfine) were purchased from Pharmacia LKB Biotechnology, Inc. DE-52 was obtained from Whatman. Ultrogel AcA-44 was purchased from IBF Biotechnits, Inc. (Savage, MD). Deoxyadenosine 5’-( [cx-~~S]thio)triphosphate (1335 Ci/mmol) and [U-‘4C]methyl a-glucoside were purchased from New England Nuclear Corp. (Boston, MA). SeaKem GTG agarose and NuSieve GTG agarose were purchased from FMC BioProducts (Rockland, ME). The oligonucleotide-directed mutagenesis kit was obtained from Amersham International. Escherichia coli strains, plasmids, and phage. E. coli strains C600 (r- m+ X c1+) and MZl (h ~1857 lysogen) (11) were kindly provided by Dr. D. Court of the National Cancer Institute. Strain TGl was obtained from Dr. T. Gibson, Laboratory of Molecular Biology, Medical Research Council (Cambridge, England) (12). A PTS deletion strain (DG40), plasmid pDS20 carrying ptsH and p&I genes and a part of the err gene, and plasmid pDS45 carrying the err gene were kindly provided by Drs. David Saffen and Saul Roseman, The Johns Hopkins University (Baltimore, MD) (9). The expression vectors pRE1 (10) and pKC30 (13) were previously described. M13mp18 (14) was obtained from New England Biolabs. DNA procedures. Strain C600 (X d+) harboring a plasmid was grown at 37°C in Luria-Bertani medium (15) containing ampicillin (25 pg/ml) to mid-log phase and the plasmid was amplified in the presence of chloramphenicol(l0 pg/ml) for 3-4 h. Plasmid DNA was purified as previously described (16). Minipreparations of plasmid DNA were isolated by the lysozyme/heat method (17) and treated with RNase. Single-stranded Ml3 DNA templates were isolated from the culture supernatant of TG1 infected with Ml3 phage grown in LB medium (18). The replicative form of Ml3 DNA was purified as described (19). Digestion of DNA with restriction enzymes was performed according to the manufacturer’s recommendation. DNA fragments were separated by electrophoresis on SeaKem GTG agarose or NuSieve GTG agarose and used as is or purified by phenol extraction and ethanol precipitation for ligation.

ET

AL.

Ligation of DNA fragments was performed as described by Maniatis et al. (20). C600 (X cl+) was used as the host for transformation with the ligation mixtures and to isolate recombinant plasmids. Strain MZl was then used as the host for protein expression from the plasmid constructs. Competent cells of the E. coli strains used here were prepared by the Hanahan method (21). The NdeI restriction recognition sequence CATATG was created at the initiation codon of ptsI and err structural gene sequences by oligonucleotide-directed mutagenesis by the method of Eckstein and co-workers (22) as described in the Amersham mutagenesis protocol. Oligonucleotides for mutagenesis were synthesized by the phosphoramidite method on an Applied Biosystems 380B DNA synthesizer. Single-stranded DNA templates were prepared and the DNA sequence was determined using sequenase by the dideoxy method of Sanger et al. (23) as modified by Biggin et al. (24) to identify NdeI recognition sites. Expression of PTS proteins. Strain MZ1 carrying the pRE1 recombinant plasmid containing ptsl or err genes was grown in 300 ml LB medium containing ampicillin (25 pg/ml) at 32°C to an A,, of 0.4. A 40-ml aliquot of this culture was saved for estimating the uninduced level of PTS protein(s). The remainder of the culture was divided into 125-ml volumes and diluted with equal volumes of fresh LB equilibrated to 50°C and immediately shifted to 39 and 42°C waterbath shakers. Aliquots (40 ml) were withdrawn at 15-min, 30-min, l-h, 2-h, 3-h, and 6-h intervals. Cells were immediately chilled and collected by centrifugation at 2500 rpm for 15 min and washed with 25 mM Tris-HCl buffer, pH 7.5, suspended in 1 ml of 25 mM Tris buffer containing 1 mM EDTA and 0.2 mM DTT. The cells were broken by passage through a French pressure cell at 10,000 psi. After determination of the protein concentration (25), the cell lysates were examined by SDS-PAGE to evaluate the level of expression of the PTS proteins. MZl carrying a pKC30 recombinant plasmid containing the ptsH gene was similarly induced for the expression of HPr but only for 2 h at 42°C. For purification of these PTS proteins, cell cultures were scaled up to 6 liters final volume with temperature and time of induction at 42°C for l-2 h, respectively, as described under Results and Discussion. Sugar phosphorylation assay. The phosphoenolpyruvate (PEP)-dependent phosphorylation of a-methylglucoside by the PTS was determined (26) using a membrane preparation of strain LBG 1650 (A pts H5) (27). The reaction mixtures contained the following components in a final volume of 250 pk100 mM Tris-HCl buffer, pH 8.0; 10 mM MgCl,; 1 mM DTT; 0.1 mM a[14C]methylglucoside (4 cpm/pmol); 1 mM PEP; and 0.12 mg of washed membranes of strain LBG 1650. In addition, for analysis of the relative activities of each of

PURIFICATION

OF

the PTS proteins purified in this study and those obtained from Dr. Roseman’s laboratory, sugar phosphorylation was carried out in the presence of an excess of two PTS proteins obtained from Dr. Roseman’s laboratory and a limiting concentration of the third PTS protein either purified in this study or obtained from Dr. Roseman’s laboratory. Thus, HPr activity was determined in the presence of 17 pg of Enzyme I, 10.7 pg of Protein IIIG’“, and 0.025 pg of either HPr purified in this study or HPr obtained from Dr. Roseman; Enzyme I activity was determined in the presence of 10.7 pg of Protein IIIG’“, 10 pg of HPr, and 0.085 pg of Enzyme I purified here or Enzyme I from Roseman’s laboratory; Protein IIIG’” activity was determined in the presence of 17 pg of Enzyme I, 10 pg of HPr, and 0.05 pg of Protein IIIG”purified here or Protein IIIG’” from Roseman’s laboratory. At 5, lo-, and 20-min intervals, 50-~1 aliquots were withdrawn onto DE 81 ion-exchange filter discs (25 mm diameter, Whatman), which were then washed with water, dried, and counted in a LS counter. RESULTS

AND

Hindlll

0

Hpal

q

BamHl

I kb

0

l

1.

) I p&H

FIG. 1. sites used direction pts1 is the

181

PROTEINS Hind111

I

blunt end cloning of HindIII-BamHI fragment into Hpal site of pKC30

XPL

cII RBS

DISCUSSION

PTS operon. The organization of the PTS operon was shown to be ptsH followed by ptsI and then err (Fig. 1) and the nucleotide sequences of ptsH, ptsl, and err and the flanking regions have been determined (89). It has been shown that ptsH and ptsI are transcribed from a single promoter, and an independent promoter has been identified within theptsI sequence that could transcribe err. The genes for Enzyme I (ptsl), HPr (ptsH), and Protein IIIG1” (err) have been cloned by Saffen et al. (9) into the pBR322 background. These clones were the source of pts genes for subcloning into the pKC30 and pRE1 expression vectors and overproduction of the corresponding gene products. Cloning of the HPr and Enzyme Igenes into thepKC30 of a plasmid expression vector. The construction (pNF12) containing the ptsH andptsI genes and a frag-

0

PTS

pts1

0

t

0

IJ

err

Schematic structure of the PTS operon. Unique restriction for cloning are shown. The horizontal arrow designates the of transcription of the PTS genes. ptsH is the gene for HPr, gene for Enzyme I and Crr is the gene for Protein III”.

BamHI/HpaI FIG. 2. The construction of plasmid pNF12. Plasmid pDS20 containing the genes ptsH, ptsl, and a fragment of err was used as the starting material for constructing the recombinant plasmid pNFl2, which was used for the overproduction of HPr (see Results and Discussion).

ment of the err gene into the pKC30 expression vector is illustrated in Fig. 2. Plasmid pDS20 was the source of ptsH and ptsI. The HindIII-BamHI fragment of pDS20 containing ptsH and ptsl was cloned as a blunt-ended molecule into the HpaI site of pKC30. A recombinant molecule, pNF12, in the orientation X PL-ptsH-ptsl was chosen for overproduction of HPr and Enzyme I. Expression and purification of HPr. E. coli MZl transformed with the pNF12 recombinant plasmid was used for the attempted overproduction of HPr and Enzyme I. A standard 2-h induction at 42°C was chosen. Examination of a crude extract of induced cells (see Fig. 3, Lane 2) indicated that HPr was overproduced (about 20% of the cell protein determined by scanning a Coomassie blue-stained gel on a Shimadzu dual wavelength TLC scanner), but, to our surprise, there was no over-

182

REDDY 123456

kDa

67

43

30

20.1

14.4

-

12

FIG. 3.

SDS-polyacrylamide gel (15%) analysis of the purification profile of HPr. Lane 1, crude extract before induction of HPr (83 Mg); Lane 2, crude extract after induction of HPr (83 jig); Lane 3,100,OOOg supernatant (70 bg); Lane 4, DE-52 pool (47 rg); Lane 5, Sephadex G-75 pool (25 rg); Lane 6, protein molecular weight standards, bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20.1 kDa), cu-lactalbumin (14.4 kDa) and cytochrome c (12 kDa) as indicated. HPr is indicated by the arrow.

production of Enzyme I. Therefore, another strategy was followed for Enzyme I overproduction (see below) and HPr was purified from these extracts as follows. Seven grams of induced cells obtained from 6 liters of culture was suspended in 70 ml of Buffer T (10 mM Tris, pH 7.5, containing 1 mM EDTA and 0.2 mM DTT), ruptured in a French press at 10,000 psi, and centrifuged at 100,OOOg for 1 h. The supernatant fraction was loaded onto a DE-52 anion-exchange column (1.5 X 40 cm) equilibrated with Buffer T. The column was washed with two column volumes of the buffer and then HPr was eluted with Buffer T containing 50 mM NaCl. The elution pattern of HPr was followed by SDS-PAGE electrophoresis and the fractions containing HPr as judged by the prominent band corresponding to HPr were pooled. HPr eluted as a sharp peak (15 ml). This DE-52 pool was directly chromatographed on a Sephadex G-75 column (2.6 X 100 cm) equilibrated with Buffer T containing 100 mM NaCl. Once again, the elution profile of HPr was followed by SDS-PAGE electrophoresis and the fractions containing HPr were pooled. HPr was essentially homogeneous after these two steps of purification (Fig. 3, Lane 5). The yield of HPr at the DE-52 step

ET

AL.

and at the Sephadex G-75 step was 177 and 86 mg, respectively (Table 1). The specific activity measurements on the purified HPr were determined by assaying for sugar phosphorylation (see Materials and Methods). Briefly, excess Enzyme I and Protein IIIG’” (obtained from Drs. Meadow and Roseman) were incubated with limiting amounts of either HPr purified by the previously described method (( 7), courtesy of Drs. Meadow and Roseman) or the HPr purified in this study. HPr purified by the method described in this study was 71% as active as the protein purified by the previously described method (7) (Table 2). Cloning of the Enzyme I gene into the pRE expression vector. Since the attempt to overproduce Enzyme I in the pKC30 expression vector was unsuccessful, we used our recently described pRE expression vector (Ref. (lo), Fig. 4) to accomplish that objective. The pRE vector has a unique NdeI restriction endonuclease sequence CAT ATG 3’ to the X P, promoter and X cI1 ribosome binding sequence followed by a polylinker. The pRE vector also has a transcription termination signal, X t,, 5’to the X P, promoter to block nonspecific transcription into the cloned gene and has enabled the cloning of lethal genes (10). Any gene with its second codon precisely fused to the ATG sequence of the NdeI site theoretically should be expressed under the transcriptional-translational initiation signals of the X P, promoter and the X cI1 ribosome binding sequence, respectively. Therefore, the strategy used in cloning the ptd gene into this vector for overexpression is to create a NdeI restriction endonuclease site at the initiation codon of the ptd gene and then fuse the gene into the NdeI site of the pRE expression vector. The plasmid containing the ptsl gene in the pRE1 expression vector is depicted in Fig. 5. A 64-bp SmaI fragment encompassing the initiation codon of ptsI from pDS20 (9) was cloned into the SmaI site of M13mplS. The sequence 5’ GTTATG 3’ at the initiation

TABLE

Purification of Purification

step

100,OOOg supernatant DE-52 chromatogwhy AcA-44 chromatogwhy Sephadex G-75 chromatography

Enzyme

1

I, HPr,

Enzyme I (mg protein) 708 200

100 (14%)

and Protein HPr (mg protein) 1014 177

-

IIIG” Protein IIIG” (mg protein) 645

100 -

(8.5:)

(7.&

Note. The details of the purification of these PTS proteins are described under Results and Discussion. The yield of each protein from the 100,000g supernatant fraction is given in parentheses.

PURIFICATION TABLE Relative Study

Activities of the (Procedure A) Procedures

PTS

2 Proteins

Purified

HPr Enzyme Protein

(Procedure

Note. Methods.

The

Procedure

B)

assay

A

conditions

are

protein)

Procedure

48 3 4.8

I IIIG’c

in This

and by Previously Described

Specific activity (nmol a-methylglucoside phosphorylated/min/mg Protein

OF

B

67.5 4 4.2 described

under

Materials

and

codon was changed to the NdeI recognition sequence 5’ CATATG 3’ by oligonucleotide-directed mutagenesis using the oligonucleotide, 5’ CAGTCACAAGTAAGGTAGGCATATGATTTCAGGCATTTAGC3’(NdeIrecognition sequence underlined). The 64-bp pst1 SmaI fragment in Ml3 containing the NdeI sequence was cloned back into a derivative of pDS20 plasmid deleted of the SmaI 64-bp fragment. A clone, pPR14, with the SmaI fragment in the correct orientation reconstructing the ptsl sequence was chosen for further manipulations. The ptsl fragment from the N&I site at the initiation codon to a BamHI site beyond the termination codon was cloned into the NdeI and BamHI sites of pRE1. One of the recombinants, pPR6, was chosen for expression of Enzyme I. Expression ad purification of Enzyme I. The pPR6 recombinant isolated in the C600 X host was used to transform an E. coli strain MZl for induction and overexpression of Enzyme I. Enzyme I expression was monitored in MZl as a function of time and temperature of induction as described under Materials and Methods and the results are presented in Fig. 6. There was no detectable Enzyme I when the cells were grown at 32°C (Lane 1). Upon induction at 39’C (Lanes 2-7), there was a gradual increase in the accumulation of Enzyme I from 15 min to 3 h; the accumulated Enzyme I was substantially degraded upon further induction over another 3-h time period (Lane 7). Expression of the enzyme at 42°C approached 40% of the total cell protein after 1 h (Lane 10). However, after prolonged incubation at 42°C (Lane 13), Enzyme I degradation was more than that observed at 39°C (Lane 7). Six grams of cell paste, obtained from a 6-liter culture of cells induced at 42°C for 2 h was suspended in 60 ml of Buffer T. The cells were then ruptured in a French press at 10,000 psi, and the extract was centrifuged at 100,OOOg for 1 h. The supernatant fraction was directly applied to a DE-52 anion-exchange column (1.5 X 40

PTS

183

PROTEINS

cm) equilibrated with Buffer T containing 0.1 M NaCl (Buffer T*). After the column was washed with Buffer T*, Enzyme I was eluted with a NaCl gradient generated from 500 ml Buffer T* (in a l-liter bottle) and 270 ml Buffer T containing 0.5 M NaCl (in a 500-ml bottle) by arranging the two solutions to the same height. Fractions containing Enzyme I eluted at 0.25 M NaCl as determined by conductivity measurements and confirmed in SDS-PAGE profiles. The fractions containing the prominent band corresponding to the Enzyme I molecular weight of 56 kDa on SDS-PAGE profiles were pooled (103 ml) and concentrated by ultrafiltration through a PM 10 Amicon filter. The Enzyme I preparation was greater than 95% pure by this one ion-exchange chromatography step (Fig. 7, Lane 4). Further purification was achieved by gel filtration chromatography on a AcA-44 Ultrogel column (2.6 X 100 cm) (Lane 5). Fractions containing Enzyme I as judged by SDSPAGE were pooled (31 ml). The purification procedure was followed only by SDS-PAGE analysis of Enzyme I; activity measurements were not made. The yield of Enzyme I was about 200 mg at the DE-52 step and about 100 mg at the AcA-44 step (Table 1). After final purification, a comparison of the activity of Enzyme I prepared by this procedure and the previously published procedure ((5), kindly provided by Drs. Meadow and Roseman) showed that the specific activity of Enzyme I prepared by the procedure described here was 75% as high as that of Enzyme I prepared by the previously published procedure (5) (Table 2).

Sal I pRE1

-NdeI-SstI-KpnI-SmaIBamHI-Xbal-

EcoRV-Sal1

pRE2-NdeI-EcoRV-XbaI-BamHISmal-Kpnl-WI-Sal1 FIG. 4. Structure of the pRE vector. See Results and Discussion for a description of its use. The restriction sites found in the polylinker region between the N&I and Sun sites in pRE1 and PREP are shown.

REDDY

Enz 1 initiation

ET

AL.

codon

Enz I stop codon

I

site-directed mutagenesis to create NdeI site at the Enzyme I initiation ccdon followed by cloning of Ndel-BarnHI fragment into the pRE 1 Vector

hPL

cIIRBS Enz I initiation

FIG. 6. SDS-polyacrylamide gel (8%) analysis of the expression of Enzyme I as a function of time and temperature of induction. Induction of Enzyme I was carried out at 39 and 42°C for 15 min to 6 h as described under Materials and Methods. Each lane contains 60 bg of the total cell protein with the exception of Lane 14, which contains 3 pg of purified Enzyme I as a marker (arrow). Lane 1, uninduced cell extract; Lanes 2-7, extract of the cells induced at 39°C for 15 min, 30 min, 1 h, 2 h, 3 h, and 6 h, respectively; Lanes 8-13, extract of the cells induced at 42°C for 15 min, 30 min, 1 h, 2 h, 3 h, and 6 h, respectively.

123456

FIG. 5. The construction of plasmid pPR6. Plasmid pDS20 containing the genes p&H, ptd, and a fragment of err was used as the starting material for constructing the recombinant plasmid pPR6, which was used for the overproduction of Enzyme I (see Results and Discussion).

Cloning of the Protein IIF” gene into the pRE expression vector. The plasmid containing the err gene in the pRE1 expression vector is diagrammed in Fig. 8. pDS45 was used as the source of the err gene (9). A HpaI fragment of pDS45 containing the err gene was cloned into the SmaI site of M13mp18. The sequence 5’ATCATG 3’ at the initiation codon was changed to the NdeI recognition sequence 5’ CATATG 3’ by oligonucleotide-directed mutagenesis using the oligonucleotide 5’ GAACAAACCCATATGCTTCTCCTA 3’ (NdeI site underlined). The complete err structural gene was sequenced to ensure that no mutations were present. Our sequence agreed completely with that of Saffen et al. (9). The err gene from the M13mplWcrr clone was excised at the newly created Na!eI site at the initiation codon and the SalI site of Ml3 and cloned between the NdeI and Sal1 sites of pRE1. One of the recombinants, pPR3,

kDa

94

67

30

FIG. profile I (70 Lane lane dards cates

7. SDS-polyacrylamide gel (8%) analysis of the purification of Enzyme I. Lane 1, crude extract before induction of Enzyme pg); Lane 2, crude extract after induction of Enzyme I (71 pg); 3, 100,OOOg supematant (45 pg); Lane 4, DE-52 pool (20 pg); 5, AcA-44 pool (20 ag); Lane 6, protein molecular weight stan(see Fig. 3 except 94 kDa for phosphorylase b). The arrow indithe expected mobility of Enzyme I.

PURIFICATION

Protein

III initiation

HpaI EcoRI

Site-directed mutagenesis at the initiation codon of Protein III to create NdeI site followed by cloning of NdeI-Sal1 fragment into pREl vector hPL

cI1 RBS . I w

Protein 111 initiation codon

+

stop codon

OF

PTS

PROTEINS

185

Five grams of cell paste, obtained from 6 liters culture of induced cells, was suspended in 50 ml of Buffer T; the cells were ruptured in a French pressure cell at 10,000 psi and the extract was centrifuged at 100,OOOg for 1 h. The supernatant fraction containing Protein IIIG’” was chromatographed on a DE-52 anion-exchange column (1.5 X 40 cm) equilibrated with Buffer T. After the column was washed with Buffer T, Protein IIIG’” was eluted with a NaCl gradient generated from 230 ml Buffer T (in a 500-ml bottle) and 150 ml Buffer T containing 0.5 M NaCl (in a 250-ml bottle) by arranging the two solutions to the same height. Fractions containing Protein IIIG1” eluting at 0.1 M NaCl, as judged by the prominent band corresponding to the Protein IIIGLc molecular weight of 20 kDa by SDS-PAGE, were pooled (10.5 ml). The DE-52 pool of Protein IIIG’” was further purified to homogeneity on a Sephadex G-75 gel filtration column (2.6 X 100 cm) equilibrated with Buffer T* and eluted with the same buffer. Fractions containing Protein IIIG” were pooled as judged by SDS-PAGE. These analyses demonstrated that nearly homogeneous protein was obtained by these two steps of purification (Fig. 10, Lane 5). The yield of Protein IIIG” was about 100 mg at the DE-52 step and 50 mg after Sephadex G-75 chromatography (Table 1). After final purification, specific activity measurements were determined by assaying for (Ymethylglucoside phosphorylation (see Materials and Methods). A comparison of the activity of Protein IIIG”

s HpaI/SmaI

FIG. 8. The construction of plasmid pPR3. Plasmid pDS45 containing the err gene was used as the starting material for constructing the recombinant plasmid pPR3, which was used for the overproduction of Protein IIIGL (see Results and Discussion).

isolated in the strain C600 X was chosen for overproducing the err gene product, Protein IIIGLc. Expression and purification of Protein IIF”. E. coli strain MZl was transformed with pPR3. Optimal conditions for expression of Protein IIIG” were determined essentially as described for Enzyme I and the results are shown in Fig. 9. Protein IIIG1” was not detected when the cells were grown at 32°C (Lane 1). Upon induction at 39”C, Protein IIIG’” was expressed within 15 min and increased up to 3 h (Lanes 2-6), but decreased upon further induction as was the case with Enzyme I (Lane 7). The expression of Protein IIIG’” at 42°C (Lanes 8-13) was greater than that observed at 39°C representing about 15% of the total cell protein at the 2-h induction (Lane 11). We chose the 2-h induction at 42°C for largescale expression and purification of Protein IIIG’“.

FIG. 9. SDS-polyacrylamide gel (12%) analysis of the expression of Protein IIIG’ as a function of time and temperature of induction. Induction of Protein III” was carried out at 39 and 42“C for 15 min to 6 h as described under Materials and Methods. Each lane contains 60 pg of the total cell protein with the exception of Lane 14, which contains 3 pg of purified Protein IIIG’” as a marker (arrow). Lane 1, uninduced cell extract; Lanes 2-7, extract of the cells induced at 39°C for 15 min, 30 min, 1 h, 2 h, 3 h, and 6 h, respectively; Lanes 8-13, extract of the cells induced at 42°C for 15 min, 30 min, 1 h, 2 h, 3 h, and 6 h, respectively.

REDDY 123456

kDa

94

67

ET

AL.

PTS proteins purified from physiologically grown wildtype cells. Although purification procedures have been described for these PTS proteins, the ease with which these and presumably other PTS proteins can be purified in abundance will greatly simplify biochemical, biophysical, and structural studies aimed at a further understanding of the complexities in the sugar transport pathways. ACKNOWLEDGMENTS

30

We thank Joel Hoskins, Center for Advanced Research in Biotechnology, for the synthesis of the oligonucleotide used in the engineering of the NdeI site at the initiation codon of Protein III”“.

REFERENCES

14.4

FIG. 10.

SDS-polyacrylamide gel (12%) analysis of the purification profile of Protein IIIG”. Lane 1, crude extract before induction of Protein IIIGL (80 pg); Lane 2, crude extract after induction of Protein IIIG” (83 pg); Lane 3, 100,OOOg supernatant (68 pg); Lane 4: DE-52 pool (24 ag); Lane 5, Sephadex G-75 pool (17 pg); Lane 6, protein molecular weight standards (see Figs. 3 and 7). The arrow indicates the predicted mobility of Protein IIIGL.

1. Meadow, N. D., Fox, D. K., and Roseman, S. (1990) The bacterial phosphoenolpyruvate:glycose phosphotransferase system. Annu. Rev. Biochem. 59,497-542. 2. Lengeler, J. W., Titgemeyer, F., Vogler, A. P., and Wohrl, M. B. (1990) Structures and homologies of carbohydrate:phosphotransferase system (PTS) proteins. Philos. Trans. R. Sot. London

326,489-504. 3. Presper, K. A., Wong,

4.

C. Y., Liu, L., Meadow, N. D., and Roseman, S. (1989) Site-directed mutagenesis of the phosphocarrier protein, BIG”, a major signal-transducing protein in Escherichia coli. Proc. Natl. Acad. Sci. USA 86, 4052-4055. Reddy, P., Meadow, N. D., Roseman, S., and Peterkofsky, A. (1985) Reconstitution of regulatory properties of adenylate cyclase in Escherichia coli extracts. Proc. Natl. Acad. Sci. USA 62,

8300-8304. 5. Weigel, N., Waygood,

purified here with that of Protein IIIG’” purified by a previously described method ((6), courtesy of Drs. Meadow and Roseman) indicated that the relative activities of these two preparations of Protein IIIGLc were 114% versus 100% for Protein IIIG’” purified here versus Protein IIIGLc purified previously (6) (Table 2). CONCLUSIONS

We have described the overproduction and two-step purification procedures for three PTS proteins, Enzyme I, HPr, and Protein IIIG’“. These PTS proteins have been expressed in abundance, representing 15-40% of the total cell protein. The overproduced proteins remained exclusively in the soluble fraction unlike the problem encountered with overproduction of adenylate cyclase (10) in which a substantial fraction of this protein was precipitated. From about 6 g of cells, 50-100 mg of each of the PTS proteins have been purified as nearly homogeneous proteins (Table 1). In results not shown here, we have scaled up the production of cells in a 12liter New Brunswick fermenter and have obtained proportionately increased amounts of these PTS proteins. We have also demonstrated that the PTS proteins synthesized by heat induction have activities comparable to

B. E., Kukuruzinska, M. A., Nakazawa, A., and Roseman, S. (1982) Sugar transport by the bacterial phosphotransferase system. Isolation and characterization of Enzyme I from Salmonella typhimurium. J. Biol. Chem. 257, 14,46114,469.

6. Meadow,

N. D., and Roseman, S. (1982) Sugar transport by the bacterial phosphotransferase system. Isolation and characterization of a glucose-specific phosphocarrier protein (IIIGk) from Salmonella typhimurium. J. Biol. Chem. 257, 14,526-14,537.

7. Beneski,

D., Nakazawa, A., Weigel, N., Hartman, P. E., and Roseman, S. (1982) Sugar transport by the bacterial phosphotransferase system. Isolation and characterization of a phosphocarrier protein HPr from wild type and mutants of Salmonella typhimurium. J. Biol. Chem. 257, 14,492-14,498.

8. DeReuse,

H., and Danchin, A. (1988) The ptsH, ptsI genes of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system: A complex operon with modes of transcription. J. Bacterial. 170, 3827-3837.

and

err

several

9. Saffen,

D. W., Presper, K. A., Doering, T. L., and Roseman, S. (1987) Sugar transport by the bacterial phosphotransferase system. Molecular cloning and structural analysis of the Escherichia coli ptsH, pts1, and err genes. J. Biol. Chem. 262, 16,241-16,253.

10. Reddy, P., Peterkofsky, A., and McKenney, K. (1989) Hyperexpression and purification of Escherichia coli adenylate cyclase using. a vector - designed for ~.expression~~ of lethal gene products. Nu.&cc

11.

Acrds

fles.

17,

l&473-10,466.

Zuber, M., Patterson, T. A., and Court, D. L. (1987) nutR, a site required for transcription antitermination lambda. Proc. Natl. Acad. Sci. USA 84,45144518.

Analysis of in phage

PURIFICATION 12. Carter, P., Bedouelle, H., and Winter, nucleotide site-directed mutagenesis AcidsRes. 13,4431-4443. 13. Rao, R. N. (1984) Construction a pBR322 derivative containing Gene3 1,247-250.

G. (1985) using Ml3

Improved vectors.

and properties of plasmid the P,-N region of phage

Miller, J. H. (1972) Cold Spring Harbor

Experiments, Laboratory,

in “Molecular Cold Spring

16. Birnboim, H. C. (1983) A rapid alkaline isolation of plasmid DNA, in “Methods Grossman, L., and Moldave, K., Eds.), demic Press, San Diego. 17.

oligoNucleic pKC30, lambda.

PTS

Maniatis, Cloning: oratory,

21.

Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166,557-580. Sayers, J. R., Schmidt, W., and Eckstein, F. (1988) 5’-B’Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis. Nucleic Acids Res. 16,791-802.

Improved sequence

Genetics,” p. 433, Harbor, NY.

extraction method for the in Enzymology” (Wu, R., Vol. 100, pp. 243-255, Aca-

Holmes, D. (1984) Improved rapid heating technique for screening recombinant DNA plasmids in E. coli. Biotechniques 2,68-69. 18. Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H., and Roe, B. A. (1980) Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143, 161-178. 19. Messing, J. (1983) New Ml3 vectors for cloning, in “Methods in Enzymology” (Wu, R., Grossman, L., and Moldave, K., Eds.), Vol. 101, pp. 20-78, Academic Press, San Diego.

187

PROTEINS

20.

22.

14. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Ml3 phage cloning vectors and host strains: Nucleotide of the M13mp18 and pUC19 vectors. Gene 33,103-119. 15.

OF

23.

Sanger, ing with

T., Fritsch, A Laboratory Cold Spring

E. F., and Sambrook, J. (1982) “Molecular Manual,” p. 245, Cold Spring Harbor LabHarbor, NY.

F., Nicklen, S., and Coulson, chain-terminating inhibitors.

A. R. (1977) Proc. Natl.

DNA Acad.

sequencSci. USA

74,5463-5467. 24. Biggin, M. D., Gibson,

T. J., and Hong, G. F. (1983) Buffer gradient gels and %S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80, 3963-3965.

25.

Lowry, 0. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193,265-275. 26. Liberman, E., Reddy, P., Gazdar, C., and Peterkofsky, A. (1985) The Escherichia coli adenylate cyclase complex: Stimulation by potassium and phosphate. J. Biol. Chem. 260, 4075-4081. 27. Bolshakova, T. N., Dobrynina, 0. Y., and Gershanovitch, V. N. (1979) Isolation and investigation of the Escherichia coli mutant with the deletion in the ptsH gene. FEBS Lett. 107, 169-172.