Pediatrics International (2015) 57, 541–545
doi: 10.1111/ped.12684
Original Article
Oxygenation decreases elastin secretion from rat ductus arteriosus smooth muscle cells* Shoji Kawakami1 and Susumu Minamisawa1,2 Department of Life Science and Medical Bioscience, Waseda University and 2Department of Cell Physiology, Jikei University, Tokyo, Japan 1
Abstract
Background: The ductus arteriosus (DA), a fetal arterial connection between the main pulmonary artery and the descending aorta, normally closes immediately after birth. The oxygen concentration in the blood rises after birth, and in the DA this increase in oxygen concentration causes functional closure, which is induced by smooth muscle contraction. Previous studies have demonstrated that hypoxia and/or oxygenation affect vascular remodeling of various vessels. Therefore, we hypothesized that the rise in oxygen concentration would affect the vascular structure of the DA due to production of proteins secreted from DA smooth muscle cells (SMC). Methods and Results: Liquid chromatography–tandem mass spectrometry was used to comprehensively investigate the secreted proteins in the supernatant of rat DA SMC harvested under hypoxic conditions (1% oxygen) or under normoxic conditions (21% oxygen). We found that the rise in oxygen concentration reduced the secretion of elastin from DA SMC. On reverse transcription–polymerase chain reaction, the expression of elastin mRNA was not significantly changed in DA SMC from hypoxic to normoxic conditions. Conclusions: Given that elastin forms internal elastic lamina and elastic fibers in the vascular muscle layers, and that a rise in oxygen concentration reduced the secretion of elastin, this suggests that the rise in blood oxygen concentration after birth reduces the secretion of elastin, and therefore may play a role in DA structural remodeling after birth.
Key words ductus arteriosus, elastin, hypoxia, liquid chromatography–tandem mass spectrometry, oxygen.
The ductus arteriosus (DA), a fetal arterial connection between the pulmonary artery and the descending aorta, normally closes immediately after birth. DA closure involves two kinds of mechanisms: (i) functional vasoconstriction and (ii) anatomical vascular remodeling, which result in a permanent blockade. Vasoconstriction after birth is caused by a reduction in prostaglandin E2 and a rise in blood oxygen after the beginning of spontaneous breathing. The increase in oxygen concentration inhibits potassium channels, and then raises membrane potential, which stimulates the opening of voltage-dependent calcium channels, and the intracellular calcium concentration rises to contract DA smooth muscles.1 Anatomical vascular remodeling is characterized by intimal thickening of the DA through the invasion of DA smooth muscle cells (SMC) into the subendothelial layer and accumulation of extracellular matrix. The DA finally causes blood vessel fibrosis through subsequent progression of apoptosis.2 Hypoxia after blood blockade has been reported to induce DA apoptosis.3 To our knowledge, however, the effect of oxygenation Correspondence: Susumu Minamisawa, MD, PhD, Department of Cell Physiology, Jikei University, 3-25-8 NIshishinbashi, Minatoku, 105-8461 Tokyo, Japan. Email: [email protected] * Second publication based on Pediatr. Cardiol. Cardiac Surg. 2013; 29: 35–41. Correction of the original article was issued in Pediatr. Cardiol. Cardiac Surg. 2015; 31: 75. Received 29 December 2013; revised 9 December 2014; accepted 23 January 2015. © 2015 Japan Pediatric Society
on DA remodeling has not been investigated when the blood oxygen concentration rises from hypoxia to normoxia by spontaneous breathing. In contrast, a comprehensive analysis has been carried out, using DNA microarray, of the differences in gene expression profiles in SMC of the human pulmonary artery cultured under normoxic and hypoxic conditions.4 Here, we hypothesize that the changes in protein secretion in response to the rise in oxygen concentration affect vascular remodeling of the DA. We harvested rat DA SMC cultured in a hypoxic chamber and then transferred to a normoxic chamber, and we comprehensively measured proteins secreted in the supernatant from DA SMC using liquid chromatography–tandem mass spectrometry (LC-MS/MS).
Methods Primary culture and passage of DA SMC
Timed pregnant Wistar rats were purchased from Japan SLC (Shizuoka, Japan). DA tissues were collected from the rat fetuses at embryonic day 21 (e21) via cesarean section. We treated the tissues with 800 μL collagenase/dispase enzyme mixture, consisting of 1.5 mg/mL collagenase/dispase (Roche, Basel, Switzerland), 0.5 mg/mL elastase type II-A (Sigma-Aldrich, St Louis, MO, USA), 1 mg/mL trypsin inhibitor type II-S (Sigma), and 2 mg/mL BSA V (Sigma), shaken at 37°C for 15 min using a shaker. They were centrifuged at 1000 ×g for 1 min, and the
542 S Kawakami and S Minamisawa supernatant mixed with collagenase II (Worthington biochem, Lakewood, NJ, USA), trypsin inhibitor type I-S (Sigma), BSA V (Sigma), and HBSS (Sigma). The mixture was shaken at 37°C for 12 min. DMEM with 10% FBS was added to the mixture. After the mixture was centrifuged at 1000 ×g for 3 min and the supernatant was removed, DA SMC in DMEM with 10% FBS were spread on a 3.5 cm dish coated with poly-L-lysine hydrobromide (Wako, Osaka, Japan). We subcultured the DA SMC and applied the EP4 agonist (ONO-AE1-329, 10-6M), to plates. These cells were passaged four times and the concentration of hyaluronic acid measured. According to our previous studies, when the cultured cells maintained DA SMC properties, hyaluronic acid concentration in a supernatant was >50 ng/mL in response to EP4 stimulation. In this study, we used DA SMC suitable for this condition and which were passaged six times. Hypoxia stimulation
Rat DA SMC that had been passaged six times, were cultured in an incubator under normoxic conditions (O2,21%; CO2, 5%; N2, 74%; pO2, 163 mmHg) for 2 days to promote adhesion of the cells to the dish. The cells were then placed into a hypoxic incubator (O2, 1%; CO2, 5%; N2, 94%; pO2, 26.8 mmHg) for 3 days. We then replaced the supernatants with 2 mL fresh DMEM, which had been placed into the hypoxic incubator, and placed them in a hypoxic or normoxic incubator. We then collected the supernatants 24 h after changing from hypoxic to normoxic conditions to assess the effects of oxygenation. In addition, according to the same procedure described here, we collected the whole cell lysate immediately (0 min), and at 1 h and 24 h after changing from hypoxic to normoxic conditions to investigate mRNA expression (Fig. 1).
Oxygenation effects Quantitative reverse transcription–polymerase chain reaction
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was prepared using a High Capacity cDNA Reverse Transcription Kit (ABI, Foster City, CA, USA), and quantitative reverse transcription–polymerase chain reaction (qRT-PCR) was performed using Fast SYBR Green Master Mix (ABI), per the manufacturer instructions for each kit. 18S rRNA was used as an internal control. Sequences for PCR primers are listed in Table 1. LC-MS/MS
To compare the secreted proteins between normoxic condition and hypoxic conditions, the supernatant proteins were concentrated using centrifugal filter units (Millipore, Billerica, MA, USA) to an average of 0.03 mg/mL. The absorbance at 595 nm was measured using protein assay kit (Bio-Rad, Hercules, CA, USA) to assess protein concentration. BSA was used to produce a standard curve. We used 0.2 μg protein of the concentrated supernatant from each sample. We then applied 15 μL reduction buffer (8 mol/L urea; 500 mmol/L Tris-HCl; 2.5 mmol/L EDTA) and DTT. The cells were then incubated at 37°C for 90 min, 5 μL 250 mmol/L iodoacetamide was added, and the cells were incubated at 37°C for 30 min in the dark. Next, 180 μL 50 nmol/L ammonium hydrogen carbonate, 200 ng trypsin, and 0.08 μL 100 mmol/L calcium chloride were applied. The cells were then incubated at 37°C for 16 h. The samples were treated three times with ZIP-TIP pipette tips and were analyzed on LC-MS/MS (Hitachi, Tokyo, Japan). The amino acid sequence obtained was then identified using protein or genome sequences located in the Mascot Server (Matrix science, Boston, MA, USA) databases, and the protein contained in the sample was identified. Accuracy control was performed based on previously reported guidelines.5 Western blot
Fig. 1 Experimental design. We collected the culture media of rat ductus arteriosus smooth muscle cells under normoxic or hypoxic conditions. For quantitative reverse transcription–polymerase chain reaction (RT-PCR), we also collected the whole cell lysates at 0 min, 1 h, and 24 h after change from a hypoxic to normoxic condition. LC-MS/MS, liquid chromatography–tandem mass spectrometry.
Total proteins from the hypoxic and normoxic supernatants, which had been condensed to an average of 0.22 μg/μL using centrifugal filter units (Millipore) were analyzed on western blot, as described previously.6 The protein samples (3.4 μg/sample) were separated using sodium dodecylsulphate polyacrylamide gel electrophoresis. Anti-elastin antibody (RA75, Elastin Products, Owensville, MO, USA) was used as the primary antibody and anti-goat IgG-HRP (SC-2020 J169, Santa Cruz Biotechnology, Santa Cruz, CA, USA) was used as a secondary antibody. Quantification of the
Table 1 Primer sequences used in quantitative RT-PCR Gene VEGF Tropoelastin Biglycan Fibronectin 18s
NCBI ref_seq accession NM_001110333 NM_012722 NM_017087.1 NM_019143.2 NR_003286.2
Primer sequences Forward
Reverse
CCGGACGGGCCTCTGAAACC GCTATGGACTGCCCTATACCAA GGTTGGCCCTGACGGACAGAC TGACCCCATCGACCAGTGCCA GTAACCCGTTGAACCCCATT
GGTGCAGCCTGGGACCACTTG CGCCTGTAATGCCTCCAA CGCATGGTCAATGTTCCTGGGGA CCCCAATGCCACGGCCGTAA CCATCCAATCGGTAGTAGCG
RT-PCR, reverse transcription–polymerase chain reaction; NCBI, The National Center for Biotechnology Information. © 2015 Japan Pediatric Society
Reduced elastin secretion in rat DA SMC 543 target signals was performed using the LAS-3000 imaging system (Fujifilm, Tokyo, Japan). There is no suitable internal control protein because we used the culture supernatant, and we thus plotted the raw values without any revision using contrast samples, by assuming that the amount of protein was constant.
Western blot
Because LC-MS/MS showed that oxygenation decreased elastin expression, we examined the protein expression of tropoelastin, the precursor of elastin, in the cell supernatant on western blot (Fig. 3). We found that tropoelastin protein expression was decreased by approximately half by normoxic stimulation.
Results qRT-PCR
Verification of hypoxic stimulation
To verify the effect of hypoxic conditions on DA SMC, vascular endothelial growth factor (VEGF) expression was examined in DA SMC using RT-PCR at 0 min, 1 h and 24 h after transfer from hypoxic to normoxic conditions. As expected, oxygenation decreased VEGF mRNA expression (Fig. 2).
Tropoelastin, fibronectin and biglycan mRNA expression in the cell lysate at 0 min, 1 h, and 24 h were measured (Fig. 4). The expression of tropoelastin and biglycan mRNAs was not significantly altered from a hypoxic to a normoxic condition, although the expression tended to decrease at 1 h. Fibronectin mRNA expression was continually reduced for 24 h.
LC-MS/MS
We performed LC-MS/MS to comprehensively detect the proteins secreted from DA SMC under normoxic or hypoxic conditions (Table 2). If the ratio of a secreted protein under normoxic conditions to that in hypoxic conditions is
doi: 10.1111/ped.12684
Original Article
Oxygenation decreases elastin secretion from rat ductus arteriosus smooth muscle cells* Shoji Kawakami1 and Susumu Minamisawa1,2 Department of Life Science and Medical Bioscience, Waseda University and 2Department of Cell Physiology, Jikei University, Tokyo, Japan 1
Abstract
Background: The ductus arteriosus (DA), a fetal arterial connection between the main pulmonary artery and the descending aorta, normally closes immediately after birth. The oxygen concentration in the blood rises after birth, and in the DA this increase in oxygen concentration causes functional closure, which is induced by smooth muscle contraction. Previous studies have demonstrated that hypoxia and/or oxygenation affect vascular remodeling of various vessels. Therefore, we hypothesized that the rise in oxygen concentration would affect the vascular structure of the DA due to production of proteins secreted from DA smooth muscle cells (SMC). Methods and Results: Liquid chromatography–tandem mass spectrometry was used to comprehensively investigate the secreted proteins in the supernatant of rat DA SMC harvested under hypoxic conditions (1% oxygen) or under normoxic conditions (21% oxygen). We found that the rise in oxygen concentration reduced the secretion of elastin from DA SMC. On reverse transcription–polymerase chain reaction, the expression of elastin mRNA was not significantly changed in DA SMC from hypoxic to normoxic conditions. Conclusions: Given that elastin forms internal elastic lamina and elastic fibers in the vascular muscle layers, and that a rise in oxygen concentration reduced the secretion of elastin, this suggests that the rise in blood oxygen concentration after birth reduces the secretion of elastin, and therefore may play a role in DA structural remodeling after birth.
Key words ductus arteriosus, elastin, hypoxia, liquid chromatography–tandem mass spectrometry, oxygen.
The ductus arteriosus (DA), a fetal arterial connection between the pulmonary artery and the descending aorta, normally closes immediately after birth. DA closure involves two kinds of mechanisms: (i) functional vasoconstriction and (ii) anatomical vascular remodeling, which result in a permanent blockade. Vasoconstriction after birth is caused by a reduction in prostaglandin E2 and a rise in blood oxygen after the beginning of spontaneous breathing. The increase in oxygen concentration inhibits potassium channels, and then raises membrane potential, which stimulates the opening of voltage-dependent calcium channels, and the intracellular calcium concentration rises to contract DA smooth muscles.1 Anatomical vascular remodeling is characterized by intimal thickening of the DA through the invasion of DA smooth muscle cells (SMC) into the subendothelial layer and accumulation of extracellular matrix. The DA finally causes blood vessel fibrosis through subsequent progression of apoptosis.2 Hypoxia after blood blockade has been reported to induce DA apoptosis.3 To our knowledge, however, the effect of oxygenation Correspondence: Susumu Minamisawa, MD, PhD, Department of Cell Physiology, Jikei University, 3-25-8 NIshishinbashi, Minatoku, 105-8461 Tokyo, Japan. Email: [email protected] * Second publication based on Pediatr. Cardiol. Cardiac Surg. 2013; 29: 35–41. Correction of the original article was issued in Pediatr. Cardiol. Cardiac Surg. 2015; 31: 75. Received 29 December 2013; revised 9 December 2014; accepted 23 January 2015. © 2015 Japan Pediatric Society
on DA remodeling has not been investigated when the blood oxygen concentration rises from hypoxia to normoxia by spontaneous breathing. In contrast, a comprehensive analysis has been carried out, using DNA microarray, of the differences in gene expression profiles in SMC of the human pulmonary artery cultured under normoxic and hypoxic conditions.4 Here, we hypothesize that the changes in protein secretion in response to the rise in oxygen concentration affect vascular remodeling of the DA. We harvested rat DA SMC cultured in a hypoxic chamber and then transferred to a normoxic chamber, and we comprehensively measured proteins secreted in the supernatant from DA SMC using liquid chromatography–tandem mass spectrometry (LC-MS/MS).
Methods Primary culture and passage of DA SMC
Timed pregnant Wistar rats were purchased from Japan SLC (Shizuoka, Japan). DA tissues were collected from the rat fetuses at embryonic day 21 (e21) via cesarean section. We treated the tissues with 800 μL collagenase/dispase enzyme mixture, consisting of 1.5 mg/mL collagenase/dispase (Roche, Basel, Switzerland), 0.5 mg/mL elastase type II-A (Sigma-Aldrich, St Louis, MO, USA), 1 mg/mL trypsin inhibitor type II-S (Sigma), and 2 mg/mL BSA V (Sigma), shaken at 37°C for 15 min using a shaker. They were centrifuged at 1000 ×g for 1 min, and the
542 S Kawakami and S Minamisawa supernatant mixed with collagenase II (Worthington biochem, Lakewood, NJ, USA), trypsin inhibitor type I-S (Sigma), BSA V (Sigma), and HBSS (Sigma). The mixture was shaken at 37°C for 12 min. DMEM with 10% FBS was added to the mixture. After the mixture was centrifuged at 1000 ×g for 3 min and the supernatant was removed, DA SMC in DMEM with 10% FBS were spread on a 3.5 cm dish coated with poly-L-lysine hydrobromide (Wako, Osaka, Japan). We subcultured the DA SMC and applied the EP4 agonist (ONO-AE1-329, 10-6M), to plates. These cells were passaged four times and the concentration of hyaluronic acid measured. According to our previous studies, when the cultured cells maintained DA SMC properties, hyaluronic acid concentration in a supernatant was >50 ng/mL in response to EP4 stimulation. In this study, we used DA SMC suitable for this condition and which were passaged six times. Hypoxia stimulation
Rat DA SMC that had been passaged six times, were cultured in an incubator under normoxic conditions (O2,21%; CO2, 5%; N2, 74%; pO2, 163 mmHg) for 2 days to promote adhesion of the cells to the dish. The cells were then placed into a hypoxic incubator (O2, 1%; CO2, 5%; N2, 94%; pO2, 26.8 mmHg) for 3 days. We then replaced the supernatants with 2 mL fresh DMEM, which had been placed into the hypoxic incubator, and placed them in a hypoxic or normoxic incubator. We then collected the supernatants 24 h after changing from hypoxic to normoxic conditions to assess the effects of oxygenation. In addition, according to the same procedure described here, we collected the whole cell lysate immediately (0 min), and at 1 h and 24 h after changing from hypoxic to normoxic conditions to investigate mRNA expression (Fig. 1).
Oxygenation effects Quantitative reverse transcription–polymerase chain reaction
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was prepared using a High Capacity cDNA Reverse Transcription Kit (ABI, Foster City, CA, USA), and quantitative reverse transcription–polymerase chain reaction (qRT-PCR) was performed using Fast SYBR Green Master Mix (ABI), per the manufacturer instructions for each kit. 18S rRNA was used as an internal control. Sequences for PCR primers are listed in Table 1. LC-MS/MS
To compare the secreted proteins between normoxic condition and hypoxic conditions, the supernatant proteins were concentrated using centrifugal filter units (Millipore, Billerica, MA, USA) to an average of 0.03 mg/mL. The absorbance at 595 nm was measured using protein assay kit (Bio-Rad, Hercules, CA, USA) to assess protein concentration. BSA was used to produce a standard curve. We used 0.2 μg protein of the concentrated supernatant from each sample. We then applied 15 μL reduction buffer (8 mol/L urea; 500 mmol/L Tris-HCl; 2.5 mmol/L EDTA) and DTT. The cells were then incubated at 37°C for 90 min, 5 μL 250 mmol/L iodoacetamide was added, and the cells were incubated at 37°C for 30 min in the dark. Next, 180 μL 50 nmol/L ammonium hydrogen carbonate, 200 ng trypsin, and 0.08 μL 100 mmol/L calcium chloride were applied. The cells were then incubated at 37°C for 16 h. The samples were treated three times with ZIP-TIP pipette tips and were analyzed on LC-MS/MS (Hitachi, Tokyo, Japan). The amino acid sequence obtained was then identified using protein or genome sequences located in the Mascot Server (Matrix science, Boston, MA, USA) databases, and the protein contained in the sample was identified. Accuracy control was performed based on previously reported guidelines.5 Western blot
Fig. 1 Experimental design. We collected the culture media of rat ductus arteriosus smooth muscle cells under normoxic or hypoxic conditions. For quantitative reverse transcription–polymerase chain reaction (RT-PCR), we also collected the whole cell lysates at 0 min, 1 h, and 24 h after change from a hypoxic to normoxic condition. LC-MS/MS, liquid chromatography–tandem mass spectrometry.
Total proteins from the hypoxic and normoxic supernatants, which had been condensed to an average of 0.22 μg/μL using centrifugal filter units (Millipore) were analyzed on western blot, as described previously.6 The protein samples (3.4 μg/sample) were separated using sodium dodecylsulphate polyacrylamide gel electrophoresis. Anti-elastin antibody (RA75, Elastin Products, Owensville, MO, USA) was used as the primary antibody and anti-goat IgG-HRP (SC-2020 J169, Santa Cruz Biotechnology, Santa Cruz, CA, USA) was used as a secondary antibody. Quantification of the
Table 1 Primer sequences used in quantitative RT-PCR Gene VEGF Tropoelastin Biglycan Fibronectin 18s
NCBI ref_seq accession NM_001110333 NM_012722 NM_017087.1 NM_019143.2 NR_003286.2
Primer sequences Forward
Reverse
CCGGACGGGCCTCTGAAACC GCTATGGACTGCCCTATACCAA GGTTGGCCCTGACGGACAGAC TGACCCCATCGACCAGTGCCA GTAACCCGTTGAACCCCATT
GGTGCAGCCTGGGACCACTTG CGCCTGTAATGCCTCCAA CGCATGGTCAATGTTCCTGGGGA CCCCAATGCCACGGCCGTAA CCATCCAATCGGTAGTAGCG
RT-PCR, reverse transcription–polymerase chain reaction; NCBI, The National Center for Biotechnology Information. © 2015 Japan Pediatric Society
Reduced elastin secretion in rat DA SMC 543 target signals was performed using the LAS-3000 imaging system (Fujifilm, Tokyo, Japan). There is no suitable internal control protein because we used the culture supernatant, and we thus plotted the raw values without any revision using contrast samples, by assuming that the amount of protein was constant.
Western blot
Because LC-MS/MS showed that oxygenation decreased elastin expression, we examined the protein expression of tropoelastin, the precursor of elastin, in the cell supernatant on western blot (Fig. 3). We found that tropoelastin protein expression was decreased by approximately half by normoxic stimulation.
Results qRT-PCR
Verification of hypoxic stimulation
To verify the effect of hypoxic conditions on DA SMC, vascular endothelial growth factor (VEGF) expression was examined in DA SMC using RT-PCR at 0 min, 1 h and 24 h after transfer from hypoxic to normoxic conditions. As expected, oxygenation decreased VEGF mRNA expression (Fig. 2).
Tropoelastin, fibronectin and biglycan mRNA expression in the cell lysate at 0 min, 1 h, and 24 h were measured (Fig. 4). The expression of tropoelastin and biglycan mRNAs was not significantly altered from a hypoxic to a normoxic condition, although the expression tended to decrease at 1 h. Fibronectin mRNA expression was continually reduced for 24 h.
LC-MS/MS
We performed LC-MS/MS to comprehensively detect the proteins secreted from DA SMC under normoxic or hypoxic conditions (Table 2). If the ratio of a secreted protein under normoxic conditions to that in hypoxic conditions is
