archives of oral biology 59 (2014) 363–369
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Association of common variants in PAH and LAT1 with non-syndromic cleft lip with or without cleft palate (NSCL/P) in the Polish population Kamil K. Hozyasz a,*, Adrianna Mostowska b, Piotr Wo´jcicki c,d, Agnieszka Lasota e, Anna Wołkowicz a, Izabella Dunin-Wilczyn´ska e, Paweł P. Jagodzin´ski b a
Department of Paediatrics, Institute of Mother and Child, Warsaw, Poland Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences, Poznan, Poland c University Clinic of Medical Academy, Wroclaw, Poland d Department of Plastic Surgery, Specialist Medical Center, Polanica Zdroj, Poland e Department of Jaw Orthopaedics, Medical University of Lublin, Lublin, Poland b
article info
abstract
Article history:
Background: Non-syndromic cleft lip with or without cleft palate (NSCL/P) is a common
Accepted 6 January 2014
structural malformation with a complex and multifactorial aetiology. Associations of
Keywords:
Methods: Eight single nucleotide polymorphisms (SNPs) of genes encoding phenylalanine
Phenylalanine
hydroxylase (PAH) and large neutral L-amino acid transporter type 1 (LAT1), as well as the
abnormalities in phenylalanine metabolism and orofacial clefts have been suggested.
PAH
PAH mutation that is most common in the Polish population (rs5030858; R408W), were
LAT1
investigated in 263 patients with NSCL/P and 270 matched controls using high resolution
Cleft lip and palate
melting curve analysis (HRM). Results: We found that two polymorphic variants of PAH appear to be risk factors for NSCL/P. The odds ratio (OR) for individuals with the rs7485331 A allele (AC or AA) compared to CC homozygotes was 0.616 (95% confidence interval [CI] = 0.437–0.868; p = 0.005) and this association remains statistically significant after multiple testing correction. The PAH rs12425434, previously associated with schizophrenia, was borderline associated with orofacial clefts. Moreover, haplotype analysis of polymorphisms in the PAH gene revealed a 4-marker combination that was significantly associated with NSCL/P. The global p-value for a haplotype comprised of SNPs rs74385331, rs12425434, rs1722392, and the mutation rs5030858 was 0.032, but this association did not survive multiple testing correction. Conclusion: This study suggests the involvement of the PAH gene in the aetiology of NSCL/P in the tested population. Further replication will be required in separate cohorts to confirm the consistency of the observed association. # 2014 Elsevier Ltd. All rights reserved.
* Corresponding author at: Department of Paediatrics, Institute of Mother and Child, 17a Kasprzaka Street, 01-211 Warsaw, Poland. Tel.: +48 022 32 77 190. E-mail address: [email protected] (K.K. Hozyasz). 0003–9969/$ – see front matter # 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.archoralbio.2014.01.003
364
1.
archives of oral biology 59 (2014) 363–369
Introduction
Non-syndromic cleft lip with or without cleft palate (NSCL/P; OMIM 119513) is one of the most common congenital malformations, with an approximate prevalence of 1 in 700 live births.1 The presence of this abnormality has severe consequences on both physical and psychological development and imposes a substantial economic and social burden. Linkage analyses, association studies, direct sequencing, and recently genome wide association studies using a case– control, a case–parent, and a multigenerational pedigrees design have shown that different specific genes may contribute to NSCL/P development; however, their mutations and polymorphisms may still explain only a fraction of the etiologic genetic background.1 Moreover, there are a number of reports showing that some specific nutrients and the general nutritional status of the mother can also be implicated in the pathogenesis of NSCL/P.1–3 Amino acids are highly essential in performing specialized functions inside the cell and play a pivotal role in several metabolic pathways in the developing embryo.4 So far, very few studies have investigated maternal and infant amino acid homeostasis in relation to orofacial clefts.2,5 Phenylketonuria (PKU; OMIM 261600) is the most common inborn error of amino acid metabolism in Europeans with an incidence of 1 in 10,000 to 1 in 4400 live births, and has been biologically lethal until very recently.6,7 PKU is due to a defect in the hepatic enzyme phenylalanine hydroxylase (PAH, EC 1.14.16.1), which catalyzes the iron, dioxygen, and tetrahydrobiopterine dependent oxidation of phenylalanine to tyrosine. If undiagnosed and, therefore, untreated, the disease may lead to mental disability and neurologic disorders. More than 600 different disease-causing mutations in the PAH gene have been identified (www.pahdb.mcgill.ca) and the mutant allele frequency in Europeans is polymorphic (0.01–0.015).7 Mutations vary in their impact on enzyme activity, causing a range of clinical phenotypes from classical PKU, which is the most severe form of the disease, to mild hyperphenylalaninaemia that does not require treatment.6 Among the most common PAH mutations is rs5030858 (R408W), with the highest relative frequency in Balto-Slavic populations: from 0.55 to 0.62 in the Czech Republic and Poland to 0.73 in Lithuania and 0.84 in Estonia.8,9 This severe mutation affecting the catalytic domain of PAH is associated with the enzyme’s very low residual activity and the lack of tetrahydrobiopterin responsiveness.10 Untreated pregnant women with PKU with increased phenylalanine levels place the developing foetus at high risk of low birth weight, microcephaly, anomalous facial features, congenital birth defects, and developmental retardation (maternal PKU syndrome).6,11 Babies of female patients with mild hyperphenylalaninaemia may also be at risk. The degree of offspring protection is related to the timing of maternal dietary treatment, and plasma phenylalanine levels are the benchmark of effective therapy. Maternal PKU syndrome is now becoming a significant public health problem threatening to undermine the success of newborn screening for PKU, as the number of babies born to mothers with this inheritable
disease is now estimated to equal the number of babies born affected with PKU.12 Mutation at the same PAH locus causes two distinct disorders depending upon whether the period of abnormal gene action is prenatal (maternal PKU syndrome) or postnatal (PKU). Even untreated siblings with the same PAH mutations may have different intellectual phenotypes. Large neutral Lamino acid transporter type 1 (LAT1; also called solute carrier 7A5; SLC7A5) is the main amino acid exchanger responsible for the transbarrier transport of phenylalanine from the blood stream into the brain and may influence the clinical course of PKU.13 Moreover, nonphenylalanine large neutral amino acid supplementation is seen as an alternative to the classic PKU treatment that is based on dietary phenyloalanine restriction.14 High concentrations of large neutral amino acids may saturate LAT1 and block the transport of phenylalanine through the blood–brain and gut–blood barriers, as well as through the endometrial glands–embryo barrier.14–17 Broad substrate specificity also enables LAT1 to transport compounds which are structurally related to amino acids, such as L-dopa and thyroid hormones.18 A correlation exists between the severity of mutations in the PAH gene and the blood phenylalanine levels of heterozygous PKU carriers. There is of increasing interest in the concept that overdominant selection (‘‘heterozygote advantage’’) appears to play an important role during the history of PKU in European and Near East populations.7,19 In the absence of overdominant selection the PAH mutation rs5030858, which is almost certainly of prehistoric origin, should currently be less frequent.7 Facial dysmorphisms in maternal PKU syndrome show increased similarity to those occurring in foetal alcohol syndrome (FAS) and abnormal palatogenesis is observed in both syndromes.11,20 In the 1960/1970s, Tocci and Beber21 investigated an increased excretion of phenolic acids in urine and abnormal results of orally administered phenylalanine loading tests in mothers of children with orofacial clefts, indicating that some of them might have had an altered metabolism of phenylalanine. Very recently Lei et al.22 reported increased urine phenylalanine excretion in NSCL/P children. However, the molecular mechanism of phenylalaninedependent teratogenicity is still unclear.23 This mechanism was not explained even in case of cardiac malformations, occurring at a higher rate in comparison to orofacial clefts, in patients with maternal PKU syndrome.23 The teratogenic effect of phenylalanine on palate development may involve a number of biochemical pathways as well as common teratogens, i.e. ethanol and maternal diabetes mellitus. Such findings have prompted the search for cleft-associated variants of genes involved in phenylalanine metabolism. Therefore, the present study was designed to evaluate whether common nucleotide variations in the PAH and LAT1 genes and the most common PAH mutation in the population from which participants were recruited may contribute to the risk of NSCL/P. The study also aimed to determine the effect of the haplotypes of PAH and LAT1, as well as to analyze the effect of the combined occurrence of polymorphisms in these genes in the NSCL/P risk.
365
archives of oral biology 59 (2014) 363–369
2.
Materials and methods
2.1.
Patients and controls
2.2. Single nucleotide polymorphism selection and genotyping
Peripheral blood samples from 263 unrelated subjects with NSCL/P were obtained from the Department of Paediatrics and Paediatric Surgery at the Institute of Mother and Child in Warsaw, the Department of Plastic Surgery Specialist Medical Center in Polanica Zdroj, as well as from the Department of Jaw Orthopaedics at the Medical University of Lublin. Eligibility to the patient group was ascertained from detailed medical records. Patients were examined by experienced medical geneticists. The non-syndromic designation was based on diagnosis of isolated CL/P with no other apparent cognitive and structural anomalies.24 Individuals with cleft palate only (CPO) were excluded from the study. Both genetic and embryological studies suggest that NSCL/P and CPO have distinct aetiology and result from different disruptive mechanisms.1,24 Almost all of individuals affected with NSCL/P and their guardians accepted the invitation to participate in the study. The patient group included 208 (79%) children aged 7 months–15 years with NSCLP and 55 (21%) children aged 7 months–15 years with NSCL. The control group compromised 270 healthy, non-related individuals with no family history of clefting or other congenital structural anomalies, whom were mostly patients attending local primary care paediatricians and general practitioners. The control group was matched by age, gender and place of birth. All participants were Caucasians of Polish origin born in Poland. Participants in the case and control groups were excluded if PKU was reported in themselves or their parents. Characteristics of cases and controls are summarized in online supplementary Table 1. DNA was isolated from peripheral blood lymphocytes by salt extraction. The experiments were approved by the local Ethics Committee. Written and oral consent was obtained from the legal guardians of all the participants. See Table S1 as supplementary file. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.archoralbio.2014.01. 003
Single nucleotide polymorphisms (SNPs) in the PAH and LAT1 genes were identified from the NCBI dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/) and with the use of genome browsers of the International HapMap Project (http://www.hapmap.org/index.html.en) and 1000 genomes (http://www.1000genomes.org/). A final set of 8 SNPs (Table 1) was selected based on the following criteria: location within protein coding or putative regulatory regions, haplotypetagging properties and minor allele frequency (MAF) of at least 10% in the Caucasian population. In addition, the common PAH mutation (rs5030858; R408W) was included for analyses. The linkage disequilibrium (LD) patterns and the structure of haplotype blocks across each gene were determined using genotype data from the HapMap database and Haploview 4.0 software package (http://www.broad.mit. edu/mpg/haploview/). Genotyping of all nucleotide variants was carried out by high resolution melting curve analysis (HRM) on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA) with the use of 5 HOT FIREPol EvaGreen HRM Mix (Solis BioDyne, Tartu, Estonia). The PCR programme consisted of an initial step at 95 8C for 15 min to activate HOT FIREPol DNA polymerase, followed by 50 amplification cycles of denaturation at 95 8C for 10 s, primer-dependent annealing (Table 2) for 10 s, and elongation at 72 8C for 15 s. Amplified DNA fragments were then subjected to HRM with 0.1 8C increments in temperatures ranging from 68 to 93 8C (Table 2). The final concentrations of reagents in HRM reactions were as follows: 1 HOT FIREPol EvaGreen HRM Mix, 0.2 pmol/ml of each primer and DNA template 2 ng/ml. The HRM reactions were performed in a 10 ml volume. Genotyping quality was tested by regenotyping of approximately 10% of randomly selected samples. Samples that failed the genotyping were excluded from further statistical analyses.
2.3.
Statistical analysis
For each SNP, the Hardy–Weinberg (HW) equilibrium was evaluated in both patients and controls by the Chi-square (x2)
Table 1 – Characteristics of polymorphisms genotyped in the data set. Gene symbol
Gene name
rs no.
Location
SNP functiona
MAFb
PAH
Phenylalanine hydroxylase
rs1801153 rs5030858 rs12425434 rs1722392 rs7485331
chr12:103232766 chr12:103234271 chr12:103240067 chr12:103278745 chr12:103312619
UTR-3 missense (Arg408Trp) intron intron nearGene-5
0.18 0.00 0.24 0.49 0.33
LAT1 (SLC7A5)
L-Amino acid transporter type 1 (solute carrier family 7, member 5)
rs16943315
chr16:87869640
intron
0.33
rs8052746 rs6540092 rs4465613
chr16:87878708 chr16:87883721 chr16:87892271
intron intron intron
0.35 0.29 0.36
a b
According to the single nucleotide polymorphism database (dbSNP). MAF, minor allele frequency calculated from the control samples.
366
archives of oral biology 59 (2014) 363–369
Table 2 – HRM conditions for the identification of polymorphisms genotyped in the data set. Gene symbol PAH
LAT1
a
Allelesa
rs no.
Location
rs1801153
chr12:103232766
a/G
rs5030858
chr12:103234271
C/t
rs12425434
chr12:103240067
C/t
rs1722392
chr12:103278745
C/t
rs7485331
chr12:103312619
a/C
rs16943315
chr16:87869640
a/G
rs8052746
chr16:87878708
a/G
rs6540092
chr16:87883721
a/C
rs4465613
chr16:87892271
C/t
Primers for PCR amplification (50 –30 )
Annealing temp. (8C)
PCR product length (bp)
Melting temp. range (8C)
F: AATGCGACAGATTACTGATTTAAC R: AATCTGAAATGACAGGATATGAGT F: GTATGGGTCGTAGCGAACTGA R: TGTTGAAGACCCTGCTCTAGG F: ATTTGCACTCATTGGCAGTCC R: ATTGCCTGTCCTGGAAGTTGA F: CCCAGGTGGTAGACATTATTGC R: CAAAATTGTTCTTTCGGCTCA F: TTCCCATAGTAAGTTGGAAGC R: TGAGGCTGAGGAATACAACA
60.6
125
74–84
60.6
180
81–91
60.6
68
68–80
60.6
107
76–86
60.6
146
76–86
F: GCCCCGTTTTTGGAGAAG R: CCAGCGGCTCATTCAGAG F: ACCTTGGGTCTGGACCTCT R: GGCTTTAGCAACAGACATGC F: ACCTGCTTGGTGTGGAGAC R: GCTGTACGTGGCACTTCG F: TTATAGCCGGGGTAAACGTAG R: GATTGAAAATCCCAGTCAAGTG
53.8
60
77–87
63.0
62
78–88
60.6
71
80–90
60.6
142
83–93
Uppercase denotes the more frequent allele in the control samples.
test. Statistically significant deviation from HW expectations was interpreted as p-value < 0.05. The differences in allele and genotype frequencies between cases and controls were determined using standard x2 and Fisher exact tests. The strength of association was estimated by odds ratio (OR) and corresponding 95% confidence intervals (95% CIs). Both recessive and dominant inheritance models were analyzed. To assess the strength of association in the additive model, the Cochran–Armitage trend test was used. A statistical adjustment for multiple comparisons was accomplished by using the Single Nucleotide Polymorphism Spectral Decomposition (SNPSpD) method proposed by Nyholt.25 Power analysis was performed using Qunato v.1.2.4 software. Haplotype based association analysis was performed using the UNPHASED 3.1.5 programme with the following analysis options: all window sizes, full model and uncertain haplotype option.26 Haplotypes with a frequency below 0.01 were set to zero. Significant p-values were corrected using the 1000-fold permutation test. An epistatic interaction between the tested SNPs was analyzed using the logistic regression and epistasis option in the PLINK software (http://pngu.mgh.harvard.edu/purcell/plink/). PLINK makes a model based on allele dosage for each SNP, A and B, and fits the model in the form of: Y b0 + b1 A + b2 B + b3 AB + e. The test for interaction is based on the coefficient of b3, therefore only the allelic by allelic epistasis is considered.
3.
Results
The sample success rate was on average 99.6% for the genotyped SNPs and the concordance rate was 100% according to duplicate analysis. None of the tested polymorphisms showed evidence of deviation from HW equilibrium in either cases or controls. The MAF for all SNPs was at least 18%. The MAF was
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Association of common variants in PAH and LAT1 with non-syndromic cleft lip with or without cleft palate (NSCL/P) in the Polish population Kamil K. Hozyasz a,*, Adrianna Mostowska b, Piotr Wo´jcicki c,d, Agnieszka Lasota e, Anna Wołkowicz a, Izabella Dunin-Wilczyn´ska e, Paweł P. Jagodzin´ski b a
Department of Paediatrics, Institute of Mother and Child, Warsaw, Poland Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences, Poznan, Poland c University Clinic of Medical Academy, Wroclaw, Poland d Department of Plastic Surgery, Specialist Medical Center, Polanica Zdroj, Poland e Department of Jaw Orthopaedics, Medical University of Lublin, Lublin, Poland b
article info
abstract
Article history:
Background: Non-syndromic cleft lip with or without cleft palate (NSCL/P) is a common
Accepted 6 January 2014
structural malformation with a complex and multifactorial aetiology. Associations of
Keywords:
Methods: Eight single nucleotide polymorphisms (SNPs) of genes encoding phenylalanine
Phenylalanine
hydroxylase (PAH) and large neutral L-amino acid transporter type 1 (LAT1), as well as the
abnormalities in phenylalanine metabolism and orofacial clefts have been suggested.
PAH
PAH mutation that is most common in the Polish population (rs5030858; R408W), were
LAT1
investigated in 263 patients with NSCL/P and 270 matched controls using high resolution
Cleft lip and palate
melting curve analysis (HRM). Results: We found that two polymorphic variants of PAH appear to be risk factors for NSCL/P. The odds ratio (OR) for individuals with the rs7485331 A allele (AC or AA) compared to CC homozygotes was 0.616 (95% confidence interval [CI] = 0.437–0.868; p = 0.005) and this association remains statistically significant after multiple testing correction. The PAH rs12425434, previously associated with schizophrenia, was borderline associated with orofacial clefts. Moreover, haplotype analysis of polymorphisms in the PAH gene revealed a 4-marker combination that was significantly associated with NSCL/P. The global p-value for a haplotype comprised of SNPs rs74385331, rs12425434, rs1722392, and the mutation rs5030858 was 0.032, but this association did not survive multiple testing correction. Conclusion: This study suggests the involvement of the PAH gene in the aetiology of NSCL/P in the tested population. Further replication will be required in separate cohorts to confirm the consistency of the observed association. # 2014 Elsevier Ltd. All rights reserved.
* Corresponding author at: Department of Paediatrics, Institute of Mother and Child, 17a Kasprzaka Street, 01-211 Warsaw, Poland. Tel.: +48 022 32 77 190. E-mail address: [email protected] (K.K. Hozyasz). 0003–9969/$ – see front matter # 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.archoralbio.2014.01.003
364
1.
archives of oral biology 59 (2014) 363–369
Introduction
Non-syndromic cleft lip with or without cleft palate (NSCL/P; OMIM 119513) is one of the most common congenital malformations, with an approximate prevalence of 1 in 700 live births.1 The presence of this abnormality has severe consequences on both physical and psychological development and imposes a substantial economic and social burden. Linkage analyses, association studies, direct sequencing, and recently genome wide association studies using a case– control, a case–parent, and a multigenerational pedigrees design have shown that different specific genes may contribute to NSCL/P development; however, their mutations and polymorphisms may still explain only a fraction of the etiologic genetic background.1 Moreover, there are a number of reports showing that some specific nutrients and the general nutritional status of the mother can also be implicated in the pathogenesis of NSCL/P.1–3 Amino acids are highly essential in performing specialized functions inside the cell and play a pivotal role in several metabolic pathways in the developing embryo.4 So far, very few studies have investigated maternal and infant amino acid homeostasis in relation to orofacial clefts.2,5 Phenylketonuria (PKU; OMIM 261600) is the most common inborn error of amino acid metabolism in Europeans with an incidence of 1 in 10,000 to 1 in 4400 live births, and has been biologically lethal until very recently.6,7 PKU is due to a defect in the hepatic enzyme phenylalanine hydroxylase (PAH, EC 1.14.16.1), which catalyzes the iron, dioxygen, and tetrahydrobiopterine dependent oxidation of phenylalanine to tyrosine. If undiagnosed and, therefore, untreated, the disease may lead to mental disability and neurologic disorders. More than 600 different disease-causing mutations in the PAH gene have been identified (www.pahdb.mcgill.ca) and the mutant allele frequency in Europeans is polymorphic (0.01–0.015).7 Mutations vary in their impact on enzyme activity, causing a range of clinical phenotypes from classical PKU, which is the most severe form of the disease, to mild hyperphenylalaninaemia that does not require treatment.6 Among the most common PAH mutations is rs5030858 (R408W), with the highest relative frequency in Balto-Slavic populations: from 0.55 to 0.62 in the Czech Republic and Poland to 0.73 in Lithuania and 0.84 in Estonia.8,9 This severe mutation affecting the catalytic domain of PAH is associated with the enzyme’s very low residual activity and the lack of tetrahydrobiopterin responsiveness.10 Untreated pregnant women with PKU with increased phenylalanine levels place the developing foetus at high risk of low birth weight, microcephaly, anomalous facial features, congenital birth defects, and developmental retardation (maternal PKU syndrome).6,11 Babies of female patients with mild hyperphenylalaninaemia may also be at risk. The degree of offspring protection is related to the timing of maternal dietary treatment, and plasma phenylalanine levels are the benchmark of effective therapy. Maternal PKU syndrome is now becoming a significant public health problem threatening to undermine the success of newborn screening for PKU, as the number of babies born to mothers with this inheritable
disease is now estimated to equal the number of babies born affected with PKU.12 Mutation at the same PAH locus causes two distinct disorders depending upon whether the period of abnormal gene action is prenatal (maternal PKU syndrome) or postnatal (PKU). Even untreated siblings with the same PAH mutations may have different intellectual phenotypes. Large neutral Lamino acid transporter type 1 (LAT1; also called solute carrier 7A5; SLC7A5) is the main amino acid exchanger responsible for the transbarrier transport of phenylalanine from the blood stream into the brain and may influence the clinical course of PKU.13 Moreover, nonphenylalanine large neutral amino acid supplementation is seen as an alternative to the classic PKU treatment that is based on dietary phenyloalanine restriction.14 High concentrations of large neutral amino acids may saturate LAT1 and block the transport of phenylalanine through the blood–brain and gut–blood barriers, as well as through the endometrial glands–embryo barrier.14–17 Broad substrate specificity also enables LAT1 to transport compounds which are structurally related to amino acids, such as L-dopa and thyroid hormones.18 A correlation exists between the severity of mutations in the PAH gene and the blood phenylalanine levels of heterozygous PKU carriers. There is of increasing interest in the concept that overdominant selection (‘‘heterozygote advantage’’) appears to play an important role during the history of PKU in European and Near East populations.7,19 In the absence of overdominant selection the PAH mutation rs5030858, which is almost certainly of prehistoric origin, should currently be less frequent.7 Facial dysmorphisms in maternal PKU syndrome show increased similarity to those occurring in foetal alcohol syndrome (FAS) and abnormal palatogenesis is observed in both syndromes.11,20 In the 1960/1970s, Tocci and Beber21 investigated an increased excretion of phenolic acids in urine and abnormal results of orally administered phenylalanine loading tests in mothers of children with orofacial clefts, indicating that some of them might have had an altered metabolism of phenylalanine. Very recently Lei et al.22 reported increased urine phenylalanine excretion in NSCL/P children. However, the molecular mechanism of phenylalaninedependent teratogenicity is still unclear.23 This mechanism was not explained even in case of cardiac malformations, occurring at a higher rate in comparison to orofacial clefts, in patients with maternal PKU syndrome.23 The teratogenic effect of phenylalanine on palate development may involve a number of biochemical pathways as well as common teratogens, i.e. ethanol and maternal diabetes mellitus. Such findings have prompted the search for cleft-associated variants of genes involved in phenylalanine metabolism. Therefore, the present study was designed to evaluate whether common nucleotide variations in the PAH and LAT1 genes and the most common PAH mutation in the population from which participants were recruited may contribute to the risk of NSCL/P. The study also aimed to determine the effect of the haplotypes of PAH and LAT1, as well as to analyze the effect of the combined occurrence of polymorphisms in these genes in the NSCL/P risk.
365
archives of oral biology 59 (2014) 363–369
2.
Materials and methods
2.1.
Patients and controls
2.2. Single nucleotide polymorphism selection and genotyping
Peripheral blood samples from 263 unrelated subjects with NSCL/P were obtained from the Department of Paediatrics and Paediatric Surgery at the Institute of Mother and Child in Warsaw, the Department of Plastic Surgery Specialist Medical Center in Polanica Zdroj, as well as from the Department of Jaw Orthopaedics at the Medical University of Lublin. Eligibility to the patient group was ascertained from detailed medical records. Patients were examined by experienced medical geneticists. The non-syndromic designation was based on diagnosis of isolated CL/P with no other apparent cognitive and structural anomalies.24 Individuals with cleft palate only (CPO) were excluded from the study. Both genetic and embryological studies suggest that NSCL/P and CPO have distinct aetiology and result from different disruptive mechanisms.1,24 Almost all of individuals affected with NSCL/P and their guardians accepted the invitation to participate in the study. The patient group included 208 (79%) children aged 7 months–15 years with NSCLP and 55 (21%) children aged 7 months–15 years with NSCL. The control group compromised 270 healthy, non-related individuals with no family history of clefting or other congenital structural anomalies, whom were mostly patients attending local primary care paediatricians and general practitioners. The control group was matched by age, gender and place of birth. All participants were Caucasians of Polish origin born in Poland. Participants in the case and control groups were excluded if PKU was reported in themselves or their parents. Characteristics of cases and controls are summarized in online supplementary Table 1. DNA was isolated from peripheral blood lymphocytes by salt extraction. The experiments were approved by the local Ethics Committee. Written and oral consent was obtained from the legal guardians of all the participants. See Table S1 as supplementary file. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.archoralbio.2014.01. 003
Single nucleotide polymorphisms (SNPs) in the PAH and LAT1 genes were identified from the NCBI dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/) and with the use of genome browsers of the International HapMap Project (http://www.hapmap.org/index.html.en) and 1000 genomes (http://www.1000genomes.org/). A final set of 8 SNPs (Table 1) was selected based on the following criteria: location within protein coding or putative regulatory regions, haplotypetagging properties and minor allele frequency (MAF) of at least 10% in the Caucasian population. In addition, the common PAH mutation (rs5030858; R408W) was included for analyses. The linkage disequilibrium (LD) patterns and the structure of haplotype blocks across each gene were determined using genotype data from the HapMap database and Haploview 4.0 software package (http://www.broad.mit. edu/mpg/haploview/). Genotyping of all nucleotide variants was carried out by high resolution melting curve analysis (HRM) on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA) with the use of 5 HOT FIREPol EvaGreen HRM Mix (Solis BioDyne, Tartu, Estonia). The PCR programme consisted of an initial step at 95 8C for 15 min to activate HOT FIREPol DNA polymerase, followed by 50 amplification cycles of denaturation at 95 8C for 10 s, primer-dependent annealing (Table 2) for 10 s, and elongation at 72 8C for 15 s. Amplified DNA fragments were then subjected to HRM with 0.1 8C increments in temperatures ranging from 68 to 93 8C (Table 2). The final concentrations of reagents in HRM reactions were as follows: 1 HOT FIREPol EvaGreen HRM Mix, 0.2 pmol/ml of each primer and DNA template 2 ng/ml. The HRM reactions were performed in a 10 ml volume. Genotyping quality was tested by regenotyping of approximately 10% of randomly selected samples. Samples that failed the genotyping were excluded from further statistical analyses.
2.3.
Statistical analysis
For each SNP, the Hardy–Weinberg (HW) equilibrium was evaluated in both patients and controls by the Chi-square (x2)
Table 1 – Characteristics of polymorphisms genotyped in the data set. Gene symbol
Gene name
rs no.
Location
SNP functiona
MAFb
PAH
Phenylalanine hydroxylase
rs1801153 rs5030858 rs12425434 rs1722392 rs7485331
chr12:103232766 chr12:103234271 chr12:103240067 chr12:103278745 chr12:103312619
UTR-3 missense (Arg408Trp) intron intron nearGene-5
0.18 0.00 0.24 0.49 0.33
LAT1 (SLC7A5)
L-Amino acid transporter type 1 (solute carrier family 7, member 5)
rs16943315
chr16:87869640
intron
0.33
rs8052746 rs6540092 rs4465613
chr16:87878708 chr16:87883721 chr16:87892271
intron intron intron
0.35 0.29 0.36
a b
According to the single nucleotide polymorphism database (dbSNP). MAF, minor allele frequency calculated from the control samples.
366
archives of oral biology 59 (2014) 363–369
Table 2 – HRM conditions for the identification of polymorphisms genotyped in the data set. Gene symbol PAH
LAT1
a
Allelesa
rs no.
Location
rs1801153
chr12:103232766
a/G
rs5030858
chr12:103234271
C/t
rs12425434
chr12:103240067
C/t
rs1722392
chr12:103278745
C/t
rs7485331
chr12:103312619
a/C
rs16943315
chr16:87869640
a/G
rs8052746
chr16:87878708
a/G
rs6540092
chr16:87883721
a/C
rs4465613
chr16:87892271
C/t
Primers for PCR amplification (50 –30 )
Annealing temp. (8C)
PCR product length (bp)
Melting temp. range (8C)
F: AATGCGACAGATTACTGATTTAAC R: AATCTGAAATGACAGGATATGAGT F: GTATGGGTCGTAGCGAACTGA R: TGTTGAAGACCCTGCTCTAGG F: ATTTGCACTCATTGGCAGTCC R: ATTGCCTGTCCTGGAAGTTGA F: CCCAGGTGGTAGACATTATTGC R: CAAAATTGTTCTTTCGGCTCA F: TTCCCATAGTAAGTTGGAAGC R: TGAGGCTGAGGAATACAACA
60.6
125
74–84
60.6
180
81–91
60.6
68
68–80
60.6
107
76–86
60.6
146
76–86
F: GCCCCGTTTTTGGAGAAG R: CCAGCGGCTCATTCAGAG F: ACCTTGGGTCTGGACCTCT R: GGCTTTAGCAACAGACATGC F: ACCTGCTTGGTGTGGAGAC R: GCTGTACGTGGCACTTCG F: TTATAGCCGGGGTAAACGTAG R: GATTGAAAATCCCAGTCAAGTG
53.8
60
77–87
63.0
62
78–88
60.6
71
80–90
60.6
142
83–93
Uppercase denotes the more frequent allele in the control samples.
test. Statistically significant deviation from HW expectations was interpreted as p-value < 0.05. The differences in allele and genotype frequencies between cases and controls were determined using standard x2 and Fisher exact tests. The strength of association was estimated by odds ratio (OR) and corresponding 95% confidence intervals (95% CIs). Both recessive and dominant inheritance models were analyzed. To assess the strength of association in the additive model, the Cochran–Armitage trend test was used. A statistical adjustment for multiple comparisons was accomplished by using the Single Nucleotide Polymorphism Spectral Decomposition (SNPSpD) method proposed by Nyholt.25 Power analysis was performed using Qunato v.1.2.4 software. Haplotype based association analysis was performed using the UNPHASED 3.1.5 programme with the following analysis options: all window sizes, full model and uncertain haplotype option.26 Haplotypes with a frequency below 0.01 were set to zero. Significant p-values were corrected using the 1000-fold permutation test. An epistatic interaction between the tested SNPs was analyzed using the logistic regression and epistasis option in the PLINK software (http://pngu.mgh.harvard.edu/purcell/plink/). PLINK makes a model based on allele dosage for each SNP, A and B, and fits the model in the form of: Y b0 + b1 A + b2 B + b3 AB + e. The test for interaction is based on the coefficient of b3, therefore only the allelic by allelic epistasis is considered.
3.
Results
The sample success rate was on average 99.6% for the genotyped SNPs and the concordance rate was 100% according to duplicate analysis. None of the tested polymorphisms showed evidence of deviation from HW equilibrium in either cases or controls. The MAF for all SNPs was at least 18%. The MAF was
