Virchows Arch DOI 10.1007/s00428-015-1725-8
ORIGINAL ARTICLE
p16INK4a overexpression is associated with CDKN2A mutation and worse prognosis in HPV-negative laryngeal squamous cell carcinomas Ana B. Larque & Laura Conde & Sofia Hakim & Llucia Alos & Pedro Jares & Isabel Vilaseca & Antonio Cardesa & Alfons Nadal
Received: 21 October 2014 / Revised: 15 December 2014 / Accepted: 21 January 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract We studied the expression of p16INK4a in a series of HPV-negative laryngeal squamous cell carcinomas and assessed its association with prognosis. Forty-five patients with laryngeal carcinoma were included in the study. Clinicopathological features and prognosis were reviewed. p16INK4a protein expression was analysed through immunohistochemistry. We analysed messenger RNA (mRNA) in 25 cases through quantitative reverse transcription polymerase chain reaction. HPV status was assessed by PCR using three different protocols based on MY09/11 and GP5/6 primers. Four out of 45 (9 %) cases overexpressed p16INK4a protein and showed a tendency to worse survival that was significant for stages I– III (log-rank p value=0.001). Expression of p16INK4a mRNA was high in 12 out of 25 (48 %) cases using an arbitrary cut-off level. All tumours were HPV negative with all three detection methods. A CDKN2A mutation was found in eight cases. One case with a missense and one with a frameshift mutation showed p16INK4a protein expression by immunohistochemistry. Six out of seven (86 %) mutated but only 6 out of 18 A. B. Larque : S. Hakim : L. Alos : P. Jares : A. Cardesa : A. Nadal (*) Department of Pathology, Hospital Clínic, Villarroel, 170, 08036 Barcelona, Spain e-mail: [email protected] L. Conde Fundació Clínic per la Recerca Biomèdica, Barcelona, Spain L. Alos : P. Jares : A. Cardesa : A. Nadal Institute d’Investigació Biomèdica August Pi I Sunyer (IDIBAPS), University of Barcelona, Barcelona, Spain I. Vilaseca Otolaryngology Department, Hospital Clínic, Barcelona, Spain I. Vilaseca Faculty of Medicine, Universitat de Barcelona, Barcelona, Spain
(33 %) non-mutated cases presented p16INK4a mRNA overexpression (p=0.03). Our findings suggest that p16INK4a overexpression, both at protein and mRNA levels, may reflect CDKN2A genetic alterations in HPV-negative laryngeal squamous cell carcinomas. Keywords Larynx carcinoma . Head and neck cancer . CDKN2A mutations . Immunohistochemistry . PCR . Reverse transcription
Introduction The implication of human papillomavirus (HPV) in the development of squamous cell carcinomas (SCC) has been well documented in female genital tract [1, 2] and head and neck tumours [3]. HPV is present in almost all cervical SCC [4] whereas its prevalence is lower for vaginal [5], vulvar [6], penile [7] and anal carcinomas [8]. In the head and neck area, the prevalence of HPV-related SCC is dependent on the site of the lesion. Oropharyngeal cancer [3, 9] is most frequently associated with HPV, in particular tonsillar and sinonasal tumours [10–12]. Accumulating evidence indicates that in head and neck carcinomas, the presence of HPV is associated with prognosis [11, 13]. In contrast to methods for the detection of HPV, p16INK4a expression by immunohistochemistry is readily available in histopathology laboratories and moreover is closely correlated with HPV status in female genital SCC and tonsillar and sinonasal carcinomas [14–17]. However, there is controversy as to whether p16INK4a expression reliably indicates HPV infection [18, 19]. Overexpression of p16INK4a by immunohistochemistry has been reported in tumours without
Virchows Arch
any evidence of HPV involvement, such as leiomyosarcomas and ovarian serous carcinomas, pulmonary small cell carcinomas and esophageal carcinomas, indicating that alternative mechanisms can induce p16INK4a overexpression [20–24]. We previously reported that in laryngeal squamous cell carcinomas (LSCC) alterations of the CDKN2A gene are associated with significant change in p16INK4a expression [25], but the involvement of HPV was not investigated. A possible role of HPV in the pathogenesis of LSCC has been intensely debated although currently, the consensus is that the prevalence of HPV infection in LSCC is rather low [26–28]. Few large studies have reported on the value of p16INK4a expression as a surrogate prognostic marker in LSCC [29, 30]. We report here the results of a histological review of a series of HPV-negative LSCC along with data on the expression of p16INK4a protein by immunohistochemistry and messenger RNA (mRNA) by quantitative PCR, in relation to prognosis and the previously reported CDKN2A mutation status.
PCR product, 15 μl was run on an ethidium bromide-stained 1.5 % agarose gel to check for amplification. For the second approach, 1 μl of the previous PCR product was used as template for nested PCR in a mixture including primers GP5 and GP6 at 1 μM (instead of MY09 and MY11) and 23a and 37 at 0.1 μM in a final volume of 50 μl. Hot start was also applied and followed by 35 cycles with annealing at 45 °C. To check for amplification, 15 μl of the PCR product was run on a 2 % agarose gel stained with ethidium bromide. The third method followed the protocol of Evander et al. [35]. Negative controls were included in all amplification batches. As a positive control for amplification, 3 ng of HeLa DNA were used. For sensitivity analysis, serial dilutions (1/10, 1/100, 1/1000 and 1/10,000) of HeLa DNA in normal HPV-negative DNA were used, analysed with the Evander et al. [35] protocol. Tissue collection, DNA extraction and PCR amplifications were done in physically separated laboratories, with disposable tools. p16INK4a protein expression
Materials and methods Patients and tissues The protocol was approved by the local ethics committee (06/ 28/2005, Ref: 2659, Comite Etico de Investigacion Clinica). From patients surgically treated with partial supraglottic or total laryngectomy at the ENT department of our institution, a series of 45 cases of LSCC was selected, based upon availability of tissue samples. Histological grade of differentiation was scored according to Broders [31]. Tumours were classified as keratinizing or non-keratinizing [32]. Staging of tumours was established according to the American Joint Committee on Cancer criteria [33]. All tumour tissue samples had been snap-frozen in isopentane precooled in liquid nitrogen and stored at −80 °C until studied. DNA and RNA extraction methods have been described previously [25, 34]. HPV DNA detection In 45 cases, the presence of HPV DNA in tumour tissue was analysed with three different PCR-based methods. The first was a modification of that reported by Evander et al. [35]. Multiplex-PCR consisted of HPV-specific (MY09 and MY11, 0.5 μM each) and TP53 exon 4 primers as internal amplification control (23a and 37 0.05 μM each) [35], MgCl2 4 mM, deoxyribonucleotide triphosphates (dNTPs) 0.2 mM each, Taq polymerase 2.5 U and 0.5 μg of DNA sample in a total volume of 100 μl. Amplification consisted of a first step of denaturation at 95 °C after which dNTPs were added (hot start modification) followed by 30 cycles with annealing at 55 °C and a last extension step at 72 °C for 5 min. Of the
Expression of p16INK4a protein was analysed immunohistochemically in formalin-fixed, paraffinembedded sections. Three-micrometre sections were deparaffinized, rehydrated and boiled 2 min in a pressure cooker in ethylenediaminetetraacetic acid (EDTA), pH 8.0 for antigen retrieval, and subsequently incubated with the primary antibody (CINTec Histology kit, clone E6H4 MTM Laboratories, Heidelberg, Germany) in an automated immunostaining system TechMate 500® (Dako, Glostrup, Denmark), using the EnVision system (Dako) following previously reported protocols [14]. Expression of p16INK4a was scored positive only when strong and diffuse cytoplasmic and nuclear staining was observed in all basal and suprabasal cells in all tumour nests. p16INK4a mRNA expression Twenty-five cases were analysed for p16INK4a mRNA expression using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). For reverse transcription, the SuperScript®First Strand Synthesis System kit (Invitrogen, Carlsbad, CA) was used. One microgramme of total RNA was added to 1 μl dNTPs 10 mM each and 1 μl random hexamers in a 10-μl final volume at 65 °C for 5 min. Products were chilled on ice before being added to a mixture made up of 4 μl MgCl2 25 mM, 2 μl 0.1 M DTT, 1 μl of RNAse OUT and 1 μl of SuperScript III enzyme. The mixture was incubated 10 min at 25 °C, 50 min at 50 °C and 5 min at 85 °C. Then, 1 μl RNAse H was added and incubated at 37 °C for 20 min. The complementary DNA (cDNA) obtained was stored at −80 °C.
Virchows Arch
Ten nanogramme of cDNA were added to 10 μl TaqMan Gene Expression Master Mix (Applied Biosystems, Foster City, CA), 1 μl of 5 μM TaqMan p16 probe and 1 μl of each p16 primer 50 ng/μl (Applied Biosystems, Foster City, CA) in a final volume of 20 μl. Relative quantification of gene expression was done as described in the TaqMan user manual and expression levels were analysed with the 2−ΔΔCt method using human β-glucuronidase (ref: 4326320E, Applied Biosystems, Foster City, CA) as endogenous control. As calibrator, we used cDNA obtained from normal laryngeal mucosa. Expression was classified as high or low with an arbitrary cut-off at 0.5. Primers and amplicon length are listed in Table 1. Statistical analyses Descriptive statistical analysis was carried out using SPSS software 18.0 (SPSS Inc., Chicago, IL). Qualitative variables are presented as percentages and quantitative variables as mean with standard deviation (SD). Comparison between qualitative variables was performed using Fisher’s exact test. Differences in quantitative variables were analysed with Student’s t test. All statistical tests were two-sided, and significance was considered with an α-risk of 0.05. Overall survival was defined as the time from the date of registration to the date of death or to the last date of follow-up. Death without documented progression was censored at the date of death. Survival data were analysed by the Kaplan– Meier method, and survival curves were compared by using the log-rank test.
Results
Clinicopathologic characteristics of the patients included in the No.(%) of patients/tumours
Age, mean±SD Gender Male Female Histological classification of tumours Keratinizing SCC Non-Keratinizing Ca Histological grade I–II III–IV Localization Supraglottic Glottic Transglottic Pyriform sinus Stage I–II III IV Local invasion T1–T3 T4
65±11 45(100) 0(0) 41(91.1) 4(8.9) 17(37.8) 28(62.2) 13(28.9) 12(26.7) 16(35.5) 4(8.9) 4(8.9) 22(48.9) 19(42.2) 32(71.1) 13(28.9)
corresponding to the predicted size of the internal control, a fragment of TP53 exon 4. Negative controls showed no amplification. The DNA HeLa serial dilution test showed specific bands of the 150-bp predicted size at 1/10 and 1/100 dilution (Fig. 1). p16INK4a protein and mRNA expression and CDKN2A mutations
Clinicopathological results Clinicopathological features of the patients and histological characteristics of the tumours are listed in Table 2. HPV DNA analysis In none of the 45 cases analysed for its presence, HPV DNA was identified with the three PCR protocols used. Adequacy of DNA for amplification was confirmed for all cases and the HeLa DNA samples by the presence of a 248-bp band Table 1
Table 2 analysis
Primers designed for RT-PCR p16INK4a analysis
Sequences
Target gene
Amplicon size
F- CCAACGCACCGAATAGTTACG R- GGGCGCTGCCCATCA Probe: CCGATCCAGGTCATG
CDKN2A
60 nt
Correlations between p16INK4a and mRNA expression values, CDKN2A mutations and histological characteristics of the tumours are listed in Table 3. Overexpression of p16INK4a protein was detected in 4 out of 45 samples (9 %) characterized by strong and diffuse immunostaining in 100 % of the basal and parabasal cells irrespective of keratinization (Fig. 2). Focal and discontinuous expression of p16INK4a was observed in nine additional cases, all without CDKN2A mutation. The expression ratio of p16INK4a mRNA in the tumours, measured through qRTPCR, was 0.7±0.42 (mean±SD, range 0.01 to 1.74), and 12 out of 25 (48 %) had mRNA overexpression with an arbitrary cut-off 0.5. Information on CDKN2A mutation status was available for 31 cases [33]. A CDKN2A mutation was present in 8 out of 31 (26 %) cases. Two cases immunohistochemically
Virchows Arch Table 3
Molecular and histological results
Cases p16INK4a IHC
Fig. 1 a PCR products obtained with the MY09 and MY 11 primers. Lane 1, 1-kb DNA ladder as a molecular weight marker. Lanes 2 to 9, samples amplified from 0.5-μg DNA of laryngeal SCC cases. All cases show a band of 248 bp corresponding to the internal control amplification of exon 4 of p53 and nonspecific high molecular weight bands (well above the 500 bp). Lane 10, HeLa DNA as positive control, which shows the expected band of about 450 bp. Lane 11, negative control. b PCR products obtained with the primers GP5 and GP6 in a nested amplification. Lane 1, 1-kb DNA ladder as a molecular weight marker. Lanes 2 to 9, samples of laryngeal SCC. All cases show a band of 248 bp corresponding to the internal control amplification of exon 4 of p53. Lane 10, product obtained from HeLa DNA showing 2 bands: one of 248 bp corresponding to exon 4 of p53 (not seen with MY09 and MY11) and another about 150 bp with the expected band size used as positive control. Lane 11, negative control. c Dilution assay of genomic DNA from HeLa in normal DNA. Lane 1, undiluted HeLa DNA. Lane 2, 1/10. Lane 3, 1/100. Lane 4, 1/1000. Lane 5, 1/10,000. Arrows indicate the expected 150-bp band
positive for p16INK4a contained a CDKN2A mutation. For the other two positive cases, the available tumour tissue was insufficient for assessment of CDKN2A mutation. The 23 CDKN2A wild-type tumours either did not express
p16INK4a mRNA expression
CDKN2A mutations
Histological classification of tumours K
T1
−
0.49
−
T2
−
0.51
Splicing site
K
T3
−
0.01
Splicing site
K
T4
−
1.01
−
K
T6
−
0.47
−
NK
T7
−
1.16
−
K
T8
−
0.6
Glu-stop
K
T9
−
0.83
Frameshift
K
T10
−
n.a.
−
K
T11
−
1.74
−
K
T12
−
0.47
−
K
T13
−
0.49
−
K
T14
−
n.a.
−
K K
T15
−
0.31
−
T17
−
1.1
Frameshift
K
T18
−
0.7
−
K
T20
−
0.33
−
K
T22
−
0.34
−
K
T24
−
0.38
−
K
T25
−
0.44
−
K
T26
−
0.45
−
K
T27
−
0.46
−
K K
T28
−
0.47
−
T30
+
0.53
Frameshift
K
T32
−
0.85
−
K
T33
−
1.05
Arg-stop
K
T35
−
1.72
−
K
T37
−
n.a.
−
K
T38
+
n.a.
Asp-Tyr
K NK
T39
+
n.a.
n.a.
T40
−
n.a.
−
K
T41
−
n.a.
−
NK
T42
−
n.a.
n.a.
K
T43
−
n.a.
n.a.
K
T44
−
n.a.
n.a.
K
T45
−
n.a.
n.a.
NK
T46
−
n.a.
n.a.
K
T47
−
n.a.
n.a.
K
T48
−
n.a.
n.a.
K
T49
−
n.a.
n.a.
K
T50
−
n.a.
n.a.
K
T51
+
n.a.
n.a.
K
T52
−
n.a.
n.a.
K
T53
−
n.a.
n.a.
K
T54
−
n.a.
n.a.
K
n. a. not assessed, K keratinizing squamous cell carcinomas, NK nonkeratinizing squamous cell carcinoma
p16INK4a by immunohistochemistry or showed focal and discontinuous expression. Six out of seven (86 %) mutated
Virchows Arch
Fig. 2 a Keratinizing squamous cell carcinoma (original magnification ×10). b Non-keratinizing squamous cell carcinoma (original magnification ×10). c Negativity of p16INK4a expression in the nonkeratinizing carcinoma shown in b (original magnification ×10). d Positive p16 INK4a expression in the keratinizing squamous cell
carcinoma shown in a (original magnification ×10). e Positive p16INK4a expression in a non-keratinizing squamous cell carcinoma (original magnification ×10). f Negative (patchy) p16INK4a expression in a keratinizing squamous cell carcinoma (original magnification ×10)
cases presented high p16INK4a mRNA expression (Table 4; p=0.03, Fisher’s exact test). No statistical association was found between the expression of p16INK4a mRNA and protein.
such as oropharyngeal and sinonasal SCC. We present p16INK4a expression data of a large series of HPV-negative LSCC in association with patient outcome. Some hypopharyngeal tumours were also included because of similar HPV prevalence and topographical proximity to LSCC. Immunohistochemical expression of p16INK4a has been proposed as a surrogate marker for viral oncogene activity in a variety of SCC, including those of head and neck. This association has been extensively documented in oropharyngeal carcinomas [16, 17] and more recently in sinonasal carcinomas [12], but data on p16INK4a expression in LSCC is lacking. The reports on p16INK4a expression differ because
Survival Follow-up was available for 41 patients. Median follow-up was 48 months (range, 1–180 months). There were seven deaths from disease in the group as a whole. Two of 4 (50 %) cases positive for p16INK4a protein and 5 of 37 (13.5 %) cases negative for p16INK4a protein died from disease (log-rank p=0.082). Among stages I–III, p16INK4a proteinnegative patients showed improved survival (log-rank p= 0.001; Fig. 3).
Table 4 Association between p16INK4a mRNA expression and CDKN2A mutations p16INK4a mRNA expression
Discussion Whether or not HPV is implicated in the pathogenesis of H & NSCC or its presence is related to p16INK4a expression has been intensively investigated in recent years. However, most of the reports focus on tumours with high HPV prevalence,
0.5 Total p=0.03
CDKN2A mutations Negative
Positive
Total
12 6 18
1 6 7
13 12 25
Virchows Arch
Fig. 3 a Kaplan–Meier curves of overall survival in LSCC patients according to p16INK4a protein expression. b Kaplan–Meier curves of overall survival in LSCC patients according to p16INK4a protein expression in stages I to III
of differences in the used criteria for positivity. Focal and/or discontinuous staining of unknown significance is rarely noted in a variety of tissues (including the samples we studied). Expression of p16INK4a can be called positive when strong, diffuse nuclear and cytoplasmic staining is observed in basal and parabasal cells and then can be considered a surrogate marker for HPV presence [15, 18, 36, 37]. We applied these criteria. The inclusion of p16INK4a expression in the classification of oropharyngeal squamous carcinoma would require definition and general acceptance of a cut-off [37]. Expression of p16INK4a in the absence of detectable HPV in carcinomas with low incidence of HPV implies that it is not a reliable marker for HPV presence, as others have reported [29, 30]. In contrast, in carcinomas with high prevalence of HPV such as oropharyngeal and sinonasal squamous carcinomas, p16INK4a expression is highly correlated with HPV presence [11, 12]. CDKN2A mutations are relatively frequent and in LCCs consistently associated with LOH at 9p21-23 [34]. We previously showed that alterations of the CDKN2A gene are associated with the expression of p16INK4a mRNA and protein. However, the applied techniques were not histology based, whereas immunohistochemistry allows the visualization of antigen expression in tumour cells. Our results show p16INK4a expression in CDKN2A-mutated LSCC cells in the absence of HPV. In view of the limited number of cases, additional studies would be desirable to confirm this result, notably in young LSCC patients that never smoked nor consumed alcohol, in order to investigate possible similarities with other head and neck cancers such as oropharyngeal cancer. This might not be easy as we found that even LSCC patients below the age of 50 tend to be heavy smokers with important alcohol intake [38]. CDKN2A-mutated cases also strongly expressed p16INK4a mRNA. This might be explained by pRB inactivation
mediated by CCND1/CDK4 complexes in the absence of functional p16INK4a. Functional pRB recruits polycomb repression complexes that silence p16INK4a expression [39]. Hence, loss of CDKN2A function would eventually induce p16INK4a mRNA transcription. Interestingly, the only mutant case with low p16INK4a mRNA expression had the same splice site mutation as a case with high p16INK4a mRNA expression, which we speculatively explain through preservation of the nonsense-mediated mRNA decay pathway [40]. High-risk HPV is involved in the aetiology of anogenital [4, 8, 14] and head and neck SCC [3, 27]. However, the prevalence of high-risk HPV in LSCC is low, in spite of the increase in HPV-positive head and neck SCCs reported in the oropharynx [41, 42]. We selected our cases from a larger series of 54 HPVnegative LSCC, in view of the available information on mutation status and survival. We chose HPV detection tests (PCR with general primers MY09-MY11 and GP5-GP6) with sufficient sensitivity to exclude HPV-positive cases with certainty. Additional RT-PCRbased techniques for the detection of viral mRNA might have been useful to assess HPV involvement, but it is unlikely that this would have resulted in more positive cases. Our results suggest that HPV is rarely involved in SCC of the larynx, even of p16INK4a-positive non-keratinizing cancers. Only for very few LSCC cases that convincing evidence in favour of a causative role of HPV has been published [28]. The striking differences in aetiology between keratinizing and non-keratinizing SCC do not seem to apply to LSCC [32]. Our data suggests that p16INK4a overexpression is associated with CDKN2A mutation in a subset of cases, which is supported by the p16INK4a mRNA expression results. However, firm conclusions cannot be drawn in view of the limited number of positive cases.
Virchows Arch
The prognostic impact of HPV in oropharyngeal and sinonasal carcinomas calls for an easy method of detection, and p16INK4a immunohistochemistry has emerged as a surrogate method for the detection of its involvement as it is relatively simple, affordable and widely available. Expression of p16INK4a has prognostic value in oropharyngeal tumours, whether by its association with HPV [11, 12] or by itself [43]. Also in non-oropharyngeal carcinomas, p16INK4a expression has been shown of prognostic value but this varied according to the presence of HPV, as p16INK4a expression was no longer prognostic in HPV-negative patients [44]. p16INK4a positive patients have a better prognosis as they respond better to chemo- and radiotherapy. A limitation of our study is the small sample size, but the trend for p16INK4a-positive tumours to have a shorter disease-free survival than p16INK4a negative tumours, particularly for stages I–III, is striking. Recent gene expression studies in head and neck tumours indicate that p16INK4a mRNA expressing but HPV-negative SCC show similar behaviour [45]. However, the relationship between mRNA expression and protein expression by immunohistochemistry is complex, and results from studies using these techniques cannot be simply compared. In summary, our results indicate HPV does not play a leading role in the aetiology of LSCC. In the rare LSCC which express p16INK4a, this probably reflects CDKN2A mutation rather than HPV involvement.
Conflict of interest The authors declare that they have no conflict of interest.
References 1. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, Schiffman MH, Moreno V, Kurman R, Shah KV (1995) Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst 87:796–802 2. Parkin DM (2006) The global health burden of infection-associated cancers in the year 2002. Int J Cancer 118:3030–3044 3. Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, Zahurak ML, Daniel RW, Viglione M, Symer DE, Shah KV, Sidransky D (2000) Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 92:709–720 4. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Munoz N (1999) Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189:12–19 5. Fuste V, del Pino M, Perez A, Garcia A, Torne A, Pahisa J, Ordi J (2010) Primary squamous cell carcinoma of the vagina: human papillomavirus detection, p16(INK4A) overexpression and clinicopathological correlations. Histopathology 57:907–916 6. Fox H, Wells M (2003) Recent advances in the pathology of the vulva. Histopathology 42:209–216
7. Rubin MA, Kleter B, Zhou M, Ayala G, Cubilla AL, Quint WG, Pirog EC (2001) Detection and typing of human papillomavirus DNA in penile carcinoma: evidence for multiple independent pathways of penile carcinogenesis. Am J Pathol 159:1211–1218 8. Lu DW, El-Mofty SK, Wang HL (2003) Expression of p16, Rb, and p53 proteins in squamous cell carcinomas of the anorectal region harboring human papillomavirus DNA. Mod Pathol 16:692–699 9. D'Souza G, Kreimer AR, Viscidi R, Pawlita M, Fakhry C, Koch WM, Westra WH, Gillison ML (2007) Case-control study of human papillomavirus and oropharyngeal cancer. N Engl J Med 356:1944–1956 10. El-Mofty SK, Lu DW (2005) Prevalence of high-risk human papillomavirus DNA in nonkeratinizing (cylindrical cell) carcinoma of the sinonasal tract: a distinct clinicopathologic and molecular disease entity. Am J Surg Pathol 29:1367–1372 11. Alos L, Moyano S, Nadal A, Alobid I, Blanch JL, Ayala E, Lloveras B, Quint W, Cardesa A, Ordi J (2009) Human papillomaviruses are identified in a subgroup of sinonasal squamous cell carcinomas with favorable outcome. Cancer 115:2701–2709 12. Larque AB, Hakim S, Ordi J, Nadal A, Diaz A, Pino MD, Marimon L, Alobid I, Cardesa A, Alos L (2014) High-risk human papillomavirus is transcriptionally active in a subset of sinonasal squamous cell carcinomas. Mod Pathol 27:343–351 13. Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, Nguyen-Tan PF, Westra WH, Chung CH, Jordan RC, Lu C, Kim H, Axelrod R, Silverman CC, Redmond KP, Gillison ML (2010) Human papillomavirus and survival of patients with oropharyngeal cancer. N Engl J Med 363:24–35 14. Santos M, Landolfi S, Olivella A, Lloveras B, Klaustermeier J, Suarez H, Alos L, Puig-Tintore LM, Campo E, Ordi J (2006) p16 overexpression identifies HPV-positive vulvar squamous cell carcinomas. Am J Surg Pathol 30:1347–1356 15. Klaes R, Benner A, Friedrich T, Ridder R, Herrington S, Jenkins D, Kurman RJ, Schmidt D, Stoler M, von Knebel DM (2002) p16INK4a immunohistochemistry improves interobserver agreement in the diagnosis of cervical intraepithelial neoplasia. Am J Surg Pathol 26: 1389–1399 16. Klussmann JP, Gultekin E, Weissenborn SJ, Wieland U, Dries V, Dienes HP, Eckel HE, Pfister HJ, Fuchs PG (2003) Expression of p16 protein identifies a distinct entity of tonsillar carcinomas associated with human papillomavirus. Am J Pathol 162:747–753 17. Singhi AD, Westra WH (2010) Comparison of human papillomavirus in situ hybridization and p16 immunohistochemistry in the detection of human papillomavirus-associated head and neck cancer based on a prospective clinical experience. Cancer 116:2166–2173 18. Smeets SJ, Hesselink AT, Speel EJ, Haesevoets A, Snijders PJ, Pawlita M, Meijer CJ, Braakhuis BJ, Leemans CR, Brakenhoff RH (2007) A novel algorithm for reliable detection of human papillomavirus in paraffin embedded head and neck cancer specimen. Int J Cancer 121:2465–2472 19. Hoffmann M, Ihloff AS, Gorogh T, Weise JB, Fazel A, Krams M, Rittgen W, Schwarz E, Kahn T (2010) p16(INK4a) overexpression predicts translational active human papillomavirus infection in tonsillar cancer. Int J Cancer 127:1595–1602 20. Bodner-Adler B, Bodner K, Czerwenka K, Kimberger O, Leodolter S, Mayerhofer K (2005) Expression of p16 protein in patients with uterine smooth muscle tumors: an immunohistochemical analysis. Gynecol Oncol 96:62–66 21. O'Neill CJ, McBride HA, Connolly LE, McCluggage WG (2007) Uterine leiomyosarcomas are characterized by high p16, p53 and MIB1 expression in comparison with usual leiomyomas, leiomyoma variants and smooth muscle tumours of uncertain malignant potential. Histopathology 50:851–858 22. O'Neill CJ, McBride HA, Connolly LE, Deavers MT, Malpica A, McCluggage WG (2007) High-grade ovarian serous carcinoma exhibits significantly higher p16 expression than low-grade serous carcinoma and serous borderline tumour. Histopathology 50:773–779
Virchows Arch 23. Zhang H, Liu J, Cagle PT, Allen TC, Laga AC, Zander DS (2005) Distinction of pulmonary small cell carcinoma from poorly differentiated squamous cell carcinoma: an immunohistochemical approach. Mod Pathol 18:111–118 24. Malik SM, Nevin DT, Cohen S, Hunt JL, Palazzo JP (2011) Assessment of immunohistochemistry for p16INK4 and high-risk HPV DNA by in situ hybridization in esophageal squamous cell carcinoma. Int J Surg Pathol 19:31–34 25. Jares P, Nadal A, Fernandez PL, Pinyol M, Hernandez L, Cazorla M, Hernandez S, Bea S, Cardesa A, Campo E (1999) Disregulation of p16MTS1/CDK4I protein and mRNA expression is associated with gene alterations in squamous-cell carcinoma of the larynx. Int J Cancer 81:705–711 26. Chernock RD, Wang X, Gao G, Lewis JS Jr, Zhang Q, Thorstad WL, El-Mofty SK (2013) Detection and significance of human papillomavirus, CDKN2A(p16) and CDKN1A(p21) expression in squamous cell carcinoma of the larynx. Mod Pathol 26:223–231 27. Kreimer AR, Clifford GM, Boyle P, Franceschi S (2005) Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev 14:467–475 28. Halec G, Holzinger D, Schmitt M, Flechtenmacher C, Dyckhoff G, Lloveras B, Hofler D, Bosch FX, Pawlita M (2013) Biological evidence for a causal role of HPV16 in a small fraction of laryngeal squamous cell carcinoma. Br J Cancer 109:172–183 29. Salazar CR, Anayannis N, Smith RV, Wang Y, Haigentz M Jr, Garg M, Schiff BA, Kawachi N, Elman J, Belbin TJ, Prystowsky MB, Burk RD, Schlecht NF (2014) Combined P16 and human papillomavirus testing predicts head and neck cancer survival. Int J Cancer 135: 2404–2412 30. Deng Z, Hasegawa M, Aoki K, Matayoshi S, Kiyuna A, Yamashita Y, Uehara T, Agena S, Maeda H, Xie M, Suzuki M (2014) A comprehensive evaluation of human papillomavirus positive status and p16INK4a overexpression as a prognostic biomarker in head and neck squamous cell carcinoma. Int J Oncol 45:67–76 31. Broders A (1941) The microscopic grading of cancer. Surg Clin N Am 21:947–962 32. Chernock RD, El-Mofty SK, Thorstad WL, Parvin CA, Lewis JS Jr (2009) HPV-related nonkeratinizing squamous cell carcinoma of the oropharynx: utility of microscopic features in predicting patient outcome. Head Neck Pathol 3:186–194 33. Edge SB, Compton CC (2010) The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol 17:1471–1474 34. Jares P, Fernandez PL, Nadal A, Cazorla M, Hernandez L, Pinyol M, Hernandez S, Traserra J, Cardesa A, Campo E (1997) p16MTS1/ CDK4I mutations and concomitant loss of heterozygosity at 9p2123 are frequent events in squamous cell carcinoma of the larynx. Oncogene 15:1445–1453 35. Evander M, Edlund K, Boden E, Gustafsson A, Jonsson M, Karlsson R, Rylander E, Wadell G (1992) Comparison of a one-step and a two-
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
step polymerase chain reaction with degenerate general primers in a population-based study of human papillomavirus infection in young Swedish women. J Clin Microbiol 30:987–992 Lewis JS Jr, Chernock RD, Ma XJ, Flanagan JJ, Luo Y, Gao G, Wang X, El-Mofty SK (2012) Partial p16 staining in oropharyngeal squamous cell carcinoma: extent and pattern correlate with human papillomavirus RNA status. Mod Pathol 25:1212–1220 Lewis JS Jr, Chernock RD (2014) Human papillomavirus and Epstein Barr virus in head and neck carcinomas: suggestions for the new WHO classification. Head Neck Pathol 8:50–58 Conde L, Moyano S, Vilaseca I, Moragas M, Cardesa A, Nadal A (2011) Role of microsatellite instability in young patients with laryngeal carcinoma. Anal Quant Cytol Histol 33:111–118 Kotake Y, Cao R, Viatour P, Sage J, Zhang Y, Xiong Y (2007) pRB family proteins are required for H3K27 trimethylation and polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene. Genes Dev 21:49–54 Schweingruber C, Rufener SC, Zund D, Yamashita A, Muhlemann O (2013) Nonsense-mediated mRNA decay—mechanisms of substrate mRNA recognition and degradation in mammalian cells. Biochim Biophys Acta 1829:612–623 Lewis JS Jr, Ukpo OC, Ma XJ, Flanagan JJ, Luo Y, Thorstad WL, Chernock RD (2012) Transcriptionally-active high-risk human papillomavirus is rare in oral cavity and laryngeal/hypopharyngeal squamous cell carcinomas—a tissue microarray study utilizing E6/E7 mRNA in situ hybridization. Histopathology 60:982–991 Chaturvedi AK, Engels EA, Pfeiffer RM, Hernandez BY, Xiao W, Kim E, Jiang B, Goodman MT, Sibug-Saber M, Cozen W, Liu L, Lynch CF, Wentzensen N, Jordan RC, Altekruse S, Anderson WF, Rosenberg PS, Gillison ML (2011) Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J Clin Oncol 29: 4294–4301 Lewis JS Jr, Thorstad WL, Chernock RD, Haughey BH, Yip JH, Zhang Q, El-Mofty SK (2010) p16 positive oropharyngeal squamous cell carcinoma: an entity with a favorable prognosis regardless of tumor HPV status. Am J Surg Pathol 34:1088–1096 Chung CH, Zhang Q, Kong CS, Harris J, Fertig EJ, Harari PM, Wang D, Redmond KP, Shenouda G, Trotti A, Raben D, Gillison ML, Jordan RC, Le QT (2014) p16 protein expression and human papillomavirus status as prognostic biomarkers of nonoropharyngeal head and neck squamous cell carcinoma. J Clin Oncol. doi:10.1200/JCO. 2013.54.5228 Walter V, Yin X, Wilkerson MD, Cabanski CR, Zhao N, Du Y, Ang MK, Hayward MC, Salazar AH, Hoadley KA, Fritchie K, Sailey CJ, Weissler MC, Shockley WW, Zanation AM, Hackman T, Thorne LB, Funkhouser WD, Muldrew KL, Olshan AF, Randell SH, Wright FA, Shores CG, Hayes DN (2013) Molecular subtypes in head and neck cancer exhibit distinct patterns of chromosomal gain and loss of canonical cancer genes. PLoS ONE. doi:10.1371/journal.pone. 0056823
ORIGINAL ARTICLE
p16INK4a overexpression is associated with CDKN2A mutation and worse prognosis in HPV-negative laryngeal squamous cell carcinomas Ana B. Larque & Laura Conde & Sofia Hakim & Llucia Alos & Pedro Jares & Isabel Vilaseca & Antonio Cardesa & Alfons Nadal
Received: 21 October 2014 / Revised: 15 December 2014 / Accepted: 21 January 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract We studied the expression of p16INK4a in a series of HPV-negative laryngeal squamous cell carcinomas and assessed its association with prognosis. Forty-five patients with laryngeal carcinoma were included in the study. Clinicopathological features and prognosis were reviewed. p16INK4a protein expression was analysed through immunohistochemistry. We analysed messenger RNA (mRNA) in 25 cases through quantitative reverse transcription polymerase chain reaction. HPV status was assessed by PCR using three different protocols based on MY09/11 and GP5/6 primers. Four out of 45 (9 %) cases overexpressed p16INK4a protein and showed a tendency to worse survival that was significant for stages I– III (log-rank p value=0.001). Expression of p16INK4a mRNA was high in 12 out of 25 (48 %) cases using an arbitrary cut-off level. All tumours were HPV negative with all three detection methods. A CDKN2A mutation was found in eight cases. One case with a missense and one with a frameshift mutation showed p16INK4a protein expression by immunohistochemistry. Six out of seven (86 %) mutated but only 6 out of 18 A. B. Larque : S. Hakim : L. Alos : P. Jares : A. Cardesa : A. Nadal (*) Department of Pathology, Hospital Clínic, Villarroel, 170, 08036 Barcelona, Spain e-mail: [email protected] L. Conde Fundació Clínic per la Recerca Biomèdica, Barcelona, Spain L. Alos : P. Jares : A. Cardesa : A. Nadal Institute d’Investigació Biomèdica August Pi I Sunyer (IDIBAPS), University of Barcelona, Barcelona, Spain I. Vilaseca Otolaryngology Department, Hospital Clínic, Barcelona, Spain I. Vilaseca Faculty of Medicine, Universitat de Barcelona, Barcelona, Spain
(33 %) non-mutated cases presented p16INK4a mRNA overexpression (p=0.03). Our findings suggest that p16INK4a overexpression, both at protein and mRNA levels, may reflect CDKN2A genetic alterations in HPV-negative laryngeal squamous cell carcinomas. Keywords Larynx carcinoma . Head and neck cancer . CDKN2A mutations . Immunohistochemistry . PCR . Reverse transcription
Introduction The implication of human papillomavirus (HPV) in the development of squamous cell carcinomas (SCC) has been well documented in female genital tract [1, 2] and head and neck tumours [3]. HPV is present in almost all cervical SCC [4] whereas its prevalence is lower for vaginal [5], vulvar [6], penile [7] and anal carcinomas [8]. In the head and neck area, the prevalence of HPV-related SCC is dependent on the site of the lesion. Oropharyngeal cancer [3, 9] is most frequently associated with HPV, in particular tonsillar and sinonasal tumours [10–12]. Accumulating evidence indicates that in head and neck carcinomas, the presence of HPV is associated with prognosis [11, 13]. In contrast to methods for the detection of HPV, p16INK4a expression by immunohistochemistry is readily available in histopathology laboratories and moreover is closely correlated with HPV status in female genital SCC and tonsillar and sinonasal carcinomas [14–17]. However, there is controversy as to whether p16INK4a expression reliably indicates HPV infection [18, 19]. Overexpression of p16INK4a by immunohistochemistry has been reported in tumours without
Virchows Arch
any evidence of HPV involvement, such as leiomyosarcomas and ovarian serous carcinomas, pulmonary small cell carcinomas and esophageal carcinomas, indicating that alternative mechanisms can induce p16INK4a overexpression [20–24]. We previously reported that in laryngeal squamous cell carcinomas (LSCC) alterations of the CDKN2A gene are associated with significant change in p16INK4a expression [25], but the involvement of HPV was not investigated. A possible role of HPV in the pathogenesis of LSCC has been intensely debated although currently, the consensus is that the prevalence of HPV infection in LSCC is rather low [26–28]. Few large studies have reported on the value of p16INK4a expression as a surrogate prognostic marker in LSCC [29, 30]. We report here the results of a histological review of a series of HPV-negative LSCC along with data on the expression of p16INK4a protein by immunohistochemistry and messenger RNA (mRNA) by quantitative PCR, in relation to prognosis and the previously reported CDKN2A mutation status.
PCR product, 15 μl was run on an ethidium bromide-stained 1.5 % agarose gel to check for amplification. For the second approach, 1 μl of the previous PCR product was used as template for nested PCR in a mixture including primers GP5 and GP6 at 1 μM (instead of MY09 and MY11) and 23a and 37 at 0.1 μM in a final volume of 50 μl. Hot start was also applied and followed by 35 cycles with annealing at 45 °C. To check for amplification, 15 μl of the PCR product was run on a 2 % agarose gel stained with ethidium bromide. The third method followed the protocol of Evander et al. [35]. Negative controls were included in all amplification batches. As a positive control for amplification, 3 ng of HeLa DNA were used. For sensitivity analysis, serial dilutions (1/10, 1/100, 1/1000 and 1/10,000) of HeLa DNA in normal HPV-negative DNA were used, analysed with the Evander et al. [35] protocol. Tissue collection, DNA extraction and PCR amplifications were done in physically separated laboratories, with disposable tools. p16INK4a protein expression
Materials and methods Patients and tissues The protocol was approved by the local ethics committee (06/ 28/2005, Ref: 2659, Comite Etico de Investigacion Clinica). From patients surgically treated with partial supraglottic or total laryngectomy at the ENT department of our institution, a series of 45 cases of LSCC was selected, based upon availability of tissue samples. Histological grade of differentiation was scored according to Broders [31]. Tumours were classified as keratinizing or non-keratinizing [32]. Staging of tumours was established according to the American Joint Committee on Cancer criteria [33]. All tumour tissue samples had been snap-frozen in isopentane precooled in liquid nitrogen and stored at −80 °C until studied. DNA and RNA extraction methods have been described previously [25, 34]. HPV DNA detection In 45 cases, the presence of HPV DNA in tumour tissue was analysed with three different PCR-based methods. The first was a modification of that reported by Evander et al. [35]. Multiplex-PCR consisted of HPV-specific (MY09 and MY11, 0.5 μM each) and TP53 exon 4 primers as internal amplification control (23a and 37 0.05 μM each) [35], MgCl2 4 mM, deoxyribonucleotide triphosphates (dNTPs) 0.2 mM each, Taq polymerase 2.5 U and 0.5 μg of DNA sample in a total volume of 100 μl. Amplification consisted of a first step of denaturation at 95 °C after which dNTPs were added (hot start modification) followed by 30 cycles with annealing at 55 °C and a last extension step at 72 °C for 5 min. Of the
Expression of p16INK4a protein was analysed immunohistochemically in formalin-fixed, paraffinembedded sections. Three-micrometre sections were deparaffinized, rehydrated and boiled 2 min in a pressure cooker in ethylenediaminetetraacetic acid (EDTA), pH 8.0 for antigen retrieval, and subsequently incubated with the primary antibody (CINTec Histology kit, clone E6H4 MTM Laboratories, Heidelberg, Germany) in an automated immunostaining system TechMate 500® (Dako, Glostrup, Denmark), using the EnVision system (Dako) following previously reported protocols [14]. Expression of p16INK4a was scored positive only when strong and diffuse cytoplasmic and nuclear staining was observed in all basal and suprabasal cells in all tumour nests. p16INK4a mRNA expression Twenty-five cases were analysed for p16INK4a mRNA expression using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). For reverse transcription, the SuperScript®First Strand Synthesis System kit (Invitrogen, Carlsbad, CA) was used. One microgramme of total RNA was added to 1 μl dNTPs 10 mM each and 1 μl random hexamers in a 10-μl final volume at 65 °C for 5 min. Products were chilled on ice before being added to a mixture made up of 4 μl MgCl2 25 mM, 2 μl 0.1 M DTT, 1 μl of RNAse OUT and 1 μl of SuperScript III enzyme. The mixture was incubated 10 min at 25 °C, 50 min at 50 °C and 5 min at 85 °C. Then, 1 μl RNAse H was added and incubated at 37 °C for 20 min. The complementary DNA (cDNA) obtained was stored at −80 °C.
Virchows Arch
Ten nanogramme of cDNA were added to 10 μl TaqMan Gene Expression Master Mix (Applied Biosystems, Foster City, CA), 1 μl of 5 μM TaqMan p16 probe and 1 μl of each p16 primer 50 ng/μl (Applied Biosystems, Foster City, CA) in a final volume of 20 μl. Relative quantification of gene expression was done as described in the TaqMan user manual and expression levels were analysed with the 2−ΔΔCt method using human β-glucuronidase (ref: 4326320E, Applied Biosystems, Foster City, CA) as endogenous control. As calibrator, we used cDNA obtained from normal laryngeal mucosa. Expression was classified as high or low with an arbitrary cut-off at 0.5. Primers and amplicon length are listed in Table 1. Statistical analyses Descriptive statistical analysis was carried out using SPSS software 18.0 (SPSS Inc., Chicago, IL). Qualitative variables are presented as percentages and quantitative variables as mean with standard deviation (SD). Comparison between qualitative variables was performed using Fisher’s exact test. Differences in quantitative variables were analysed with Student’s t test. All statistical tests were two-sided, and significance was considered with an α-risk of 0.05. Overall survival was defined as the time from the date of registration to the date of death or to the last date of follow-up. Death without documented progression was censored at the date of death. Survival data were analysed by the Kaplan– Meier method, and survival curves were compared by using the log-rank test.
Results
Clinicopathologic characteristics of the patients included in the No.(%) of patients/tumours
Age, mean±SD Gender Male Female Histological classification of tumours Keratinizing SCC Non-Keratinizing Ca Histological grade I–II III–IV Localization Supraglottic Glottic Transglottic Pyriform sinus Stage I–II III IV Local invasion T1–T3 T4
65±11 45(100) 0(0) 41(91.1) 4(8.9) 17(37.8) 28(62.2) 13(28.9) 12(26.7) 16(35.5) 4(8.9) 4(8.9) 22(48.9) 19(42.2) 32(71.1) 13(28.9)
corresponding to the predicted size of the internal control, a fragment of TP53 exon 4. Negative controls showed no amplification. The DNA HeLa serial dilution test showed specific bands of the 150-bp predicted size at 1/10 and 1/100 dilution (Fig. 1). p16INK4a protein and mRNA expression and CDKN2A mutations
Clinicopathological results Clinicopathological features of the patients and histological characteristics of the tumours are listed in Table 2. HPV DNA analysis In none of the 45 cases analysed for its presence, HPV DNA was identified with the three PCR protocols used. Adequacy of DNA for amplification was confirmed for all cases and the HeLa DNA samples by the presence of a 248-bp band Table 1
Table 2 analysis
Primers designed for RT-PCR p16INK4a analysis
Sequences
Target gene
Amplicon size
F- CCAACGCACCGAATAGTTACG R- GGGCGCTGCCCATCA Probe: CCGATCCAGGTCATG
CDKN2A
60 nt
Correlations between p16INK4a and mRNA expression values, CDKN2A mutations and histological characteristics of the tumours are listed in Table 3. Overexpression of p16INK4a protein was detected in 4 out of 45 samples (9 %) characterized by strong and diffuse immunostaining in 100 % of the basal and parabasal cells irrespective of keratinization (Fig. 2). Focal and discontinuous expression of p16INK4a was observed in nine additional cases, all without CDKN2A mutation. The expression ratio of p16INK4a mRNA in the tumours, measured through qRTPCR, was 0.7±0.42 (mean±SD, range 0.01 to 1.74), and 12 out of 25 (48 %) had mRNA overexpression with an arbitrary cut-off 0.5. Information on CDKN2A mutation status was available for 31 cases [33]. A CDKN2A mutation was present in 8 out of 31 (26 %) cases. Two cases immunohistochemically
Virchows Arch Table 3
Molecular and histological results
Cases p16INK4a IHC
Fig. 1 a PCR products obtained with the MY09 and MY 11 primers. Lane 1, 1-kb DNA ladder as a molecular weight marker. Lanes 2 to 9, samples amplified from 0.5-μg DNA of laryngeal SCC cases. All cases show a band of 248 bp corresponding to the internal control amplification of exon 4 of p53 and nonspecific high molecular weight bands (well above the 500 bp). Lane 10, HeLa DNA as positive control, which shows the expected band of about 450 bp. Lane 11, negative control. b PCR products obtained with the primers GP5 and GP6 in a nested amplification. Lane 1, 1-kb DNA ladder as a molecular weight marker. Lanes 2 to 9, samples of laryngeal SCC. All cases show a band of 248 bp corresponding to the internal control amplification of exon 4 of p53. Lane 10, product obtained from HeLa DNA showing 2 bands: one of 248 bp corresponding to exon 4 of p53 (not seen with MY09 and MY11) and another about 150 bp with the expected band size used as positive control. Lane 11, negative control. c Dilution assay of genomic DNA from HeLa in normal DNA. Lane 1, undiluted HeLa DNA. Lane 2, 1/10. Lane 3, 1/100. Lane 4, 1/1000. Lane 5, 1/10,000. Arrows indicate the expected 150-bp band
positive for p16INK4a contained a CDKN2A mutation. For the other two positive cases, the available tumour tissue was insufficient for assessment of CDKN2A mutation. The 23 CDKN2A wild-type tumours either did not express
p16INK4a mRNA expression
CDKN2A mutations
Histological classification of tumours K
T1
−
0.49
−
T2
−
0.51
Splicing site
K
T3
−
0.01
Splicing site
K
T4
−
1.01
−
K
T6
−
0.47
−
NK
T7
−
1.16
−
K
T8
−
0.6
Glu-stop
K
T9
−
0.83
Frameshift
K
T10
−
n.a.
−
K
T11
−
1.74
−
K
T12
−
0.47
−
K
T13
−
0.49
−
K
T14
−
n.a.
−
K K
T15
−
0.31
−
T17
−
1.1
Frameshift
K
T18
−
0.7
−
K
T20
−
0.33
−
K
T22
−
0.34
−
K
T24
−
0.38
−
K
T25
−
0.44
−
K
T26
−
0.45
−
K
T27
−
0.46
−
K K
T28
−
0.47
−
T30
+
0.53
Frameshift
K
T32
−
0.85
−
K
T33
−
1.05
Arg-stop
K
T35
−
1.72
−
K
T37
−
n.a.
−
K
T38
+
n.a.
Asp-Tyr
K NK
T39
+
n.a.
n.a.
T40
−
n.a.
−
K
T41
−
n.a.
−
NK
T42
−
n.a.
n.a.
K
T43
−
n.a.
n.a.
K
T44
−
n.a.
n.a.
K
T45
−
n.a.
n.a.
NK
T46
−
n.a.
n.a.
K
T47
−
n.a.
n.a.
K
T48
−
n.a.
n.a.
K
T49
−
n.a.
n.a.
K
T50
−
n.a.
n.a.
K
T51
+
n.a.
n.a.
K
T52
−
n.a.
n.a.
K
T53
−
n.a.
n.a.
K
T54
−
n.a.
n.a.
K
n. a. not assessed, K keratinizing squamous cell carcinomas, NK nonkeratinizing squamous cell carcinoma
p16INK4a by immunohistochemistry or showed focal and discontinuous expression. Six out of seven (86 %) mutated
Virchows Arch
Fig. 2 a Keratinizing squamous cell carcinoma (original magnification ×10). b Non-keratinizing squamous cell carcinoma (original magnification ×10). c Negativity of p16INK4a expression in the nonkeratinizing carcinoma shown in b (original magnification ×10). d Positive p16 INK4a expression in the keratinizing squamous cell
carcinoma shown in a (original magnification ×10). e Positive p16INK4a expression in a non-keratinizing squamous cell carcinoma (original magnification ×10). f Negative (patchy) p16INK4a expression in a keratinizing squamous cell carcinoma (original magnification ×10)
cases presented high p16INK4a mRNA expression (Table 4; p=0.03, Fisher’s exact test). No statistical association was found between the expression of p16INK4a mRNA and protein.
such as oropharyngeal and sinonasal SCC. We present p16INK4a expression data of a large series of HPV-negative LSCC in association with patient outcome. Some hypopharyngeal tumours were also included because of similar HPV prevalence and topographical proximity to LSCC. Immunohistochemical expression of p16INK4a has been proposed as a surrogate marker for viral oncogene activity in a variety of SCC, including those of head and neck. This association has been extensively documented in oropharyngeal carcinomas [16, 17] and more recently in sinonasal carcinomas [12], but data on p16INK4a expression in LSCC is lacking. The reports on p16INK4a expression differ because
Survival Follow-up was available for 41 patients. Median follow-up was 48 months (range, 1–180 months). There were seven deaths from disease in the group as a whole. Two of 4 (50 %) cases positive for p16INK4a protein and 5 of 37 (13.5 %) cases negative for p16INK4a protein died from disease (log-rank p=0.082). Among stages I–III, p16INK4a proteinnegative patients showed improved survival (log-rank p= 0.001; Fig. 3).
Table 4 Association between p16INK4a mRNA expression and CDKN2A mutations p16INK4a mRNA expression
Discussion Whether or not HPV is implicated in the pathogenesis of H & NSCC or its presence is related to p16INK4a expression has been intensively investigated in recent years. However, most of the reports focus on tumours with high HPV prevalence,
0.5 Total p=0.03
CDKN2A mutations Negative
Positive
Total
12 6 18
1 6 7
13 12 25
Virchows Arch
Fig. 3 a Kaplan–Meier curves of overall survival in LSCC patients according to p16INK4a protein expression. b Kaplan–Meier curves of overall survival in LSCC patients according to p16INK4a protein expression in stages I to III
of differences in the used criteria for positivity. Focal and/or discontinuous staining of unknown significance is rarely noted in a variety of tissues (including the samples we studied). Expression of p16INK4a can be called positive when strong, diffuse nuclear and cytoplasmic staining is observed in basal and parabasal cells and then can be considered a surrogate marker for HPV presence [15, 18, 36, 37]. We applied these criteria. The inclusion of p16INK4a expression in the classification of oropharyngeal squamous carcinoma would require definition and general acceptance of a cut-off [37]. Expression of p16INK4a in the absence of detectable HPV in carcinomas with low incidence of HPV implies that it is not a reliable marker for HPV presence, as others have reported [29, 30]. In contrast, in carcinomas with high prevalence of HPV such as oropharyngeal and sinonasal squamous carcinomas, p16INK4a expression is highly correlated with HPV presence [11, 12]. CDKN2A mutations are relatively frequent and in LCCs consistently associated with LOH at 9p21-23 [34]. We previously showed that alterations of the CDKN2A gene are associated with the expression of p16INK4a mRNA and protein. However, the applied techniques were not histology based, whereas immunohistochemistry allows the visualization of antigen expression in tumour cells. Our results show p16INK4a expression in CDKN2A-mutated LSCC cells in the absence of HPV. In view of the limited number of cases, additional studies would be desirable to confirm this result, notably in young LSCC patients that never smoked nor consumed alcohol, in order to investigate possible similarities with other head and neck cancers such as oropharyngeal cancer. This might not be easy as we found that even LSCC patients below the age of 50 tend to be heavy smokers with important alcohol intake [38]. CDKN2A-mutated cases also strongly expressed p16INK4a mRNA. This might be explained by pRB inactivation
mediated by CCND1/CDK4 complexes in the absence of functional p16INK4a. Functional pRB recruits polycomb repression complexes that silence p16INK4a expression [39]. Hence, loss of CDKN2A function would eventually induce p16INK4a mRNA transcription. Interestingly, the only mutant case with low p16INK4a mRNA expression had the same splice site mutation as a case with high p16INK4a mRNA expression, which we speculatively explain through preservation of the nonsense-mediated mRNA decay pathway [40]. High-risk HPV is involved in the aetiology of anogenital [4, 8, 14] and head and neck SCC [3, 27]. However, the prevalence of high-risk HPV in LSCC is low, in spite of the increase in HPV-positive head and neck SCCs reported in the oropharynx [41, 42]. We selected our cases from a larger series of 54 HPVnegative LSCC, in view of the available information on mutation status and survival. We chose HPV detection tests (PCR with general primers MY09-MY11 and GP5-GP6) with sufficient sensitivity to exclude HPV-positive cases with certainty. Additional RT-PCRbased techniques for the detection of viral mRNA might have been useful to assess HPV involvement, but it is unlikely that this would have resulted in more positive cases. Our results suggest that HPV is rarely involved in SCC of the larynx, even of p16INK4a-positive non-keratinizing cancers. Only for very few LSCC cases that convincing evidence in favour of a causative role of HPV has been published [28]. The striking differences in aetiology between keratinizing and non-keratinizing SCC do not seem to apply to LSCC [32]. Our data suggests that p16INK4a overexpression is associated with CDKN2A mutation in a subset of cases, which is supported by the p16INK4a mRNA expression results. However, firm conclusions cannot be drawn in view of the limited number of positive cases.
Virchows Arch
The prognostic impact of HPV in oropharyngeal and sinonasal carcinomas calls for an easy method of detection, and p16INK4a immunohistochemistry has emerged as a surrogate method for the detection of its involvement as it is relatively simple, affordable and widely available. Expression of p16INK4a has prognostic value in oropharyngeal tumours, whether by its association with HPV [11, 12] or by itself [43]. Also in non-oropharyngeal carcinomas, p16INK4a expression has been shown of prognostic value but this varied according to the presence of HPV, as p16INK4a expression was no longer prognostic in HPV-negative patients [44]. p16INK4a positive patients have a better prognosis as they respond better to chemo- and radiotherapy. A limitation of our study is the small sample size, but the trend for p16INK4a-positive tumours to have a shorter disease-free survival than p16INK4a negative tumours, particularly for stages I–III, is striking. Recent gene expression studies in head and neck tumours indicate that p16INK4a mRNA expressing but HPV-negative SCC show similar behaviour [45]. However, the relationship between mRNA expression and protein expression by immunohistochemistry is complex, and results from studies using these techniques cannot be simply compared. In summary, our results indicate HPV does not play a leading role in the aetiology of LSCC. In the rare LSCC which express p16INK4a, this probably reflects CDKN2A mutation rather than HPV involvement.
Conflict of interest The authors declare that they have no conflict of interest.
References 1. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, Schiffman MH, Moreno V, Kurman R, Shah KV (1995) Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst 87:796–802 2. Parkin DM (2006) The global health burden of infection-associated cancers in the year 2002. Int J Cancer 118:3030–3044 3. Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, Zahurak ML, Daniel RW, Viglione M, Symer DE, Shah KV, Sidransky D (2000) Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 92:709–720 4. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Munoz N (1999) Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189:12–19 5. Fuste V, del Pino M, Perez A, Garcia A, Torne A, Pahisa J, Ordi J (2010) Primary squamous cell carcinoma of the vagina: human papillomavirus detection, p16(INK4A) overexpression and clinicopathological correlations. Histopathology 57:907–916 6. Fox H, Wells M (2003) Recent advances in the pathology of the vulva. Histopathology 42:209–216
7. Rubin MA, Kleter B, Zhou M, Ayala G, Cubilla AL, Quint WG, Pirog EC (2001) Detection and typing of human papillomavirus DNA in penile carcinoma: evidence for multiple independent pathways of penile carcinogenesis. Am J Pathol 159:1211–1218 8. Lu DW, El-Mofty SK, Wang HL (2003) Expression of p16, Rb, and p53 proteins in squamous cell carcinomas of the anorectal region harboring human papillomavirus DNA. Mod Pathol 16:692–699 9. D'Souza G, Kreimer AR, Viscidi R, Pawlita M, Fakhry C, Koch WM, Westra WH, Gillison ML (2007) Case-control study of human papillomavirus and oropharyngeal cancer. N Engl J Med 356:1944–1956 10. El-Mofty SK, Lu DW (2005) Prevalence of high-risk human papillomavirus DNA in nonkeratinizing (cylindrical cell) carcinoma of the sinonasal tract: a distinct clinicopathologic and molecular disease entity. Am J Surg Pathol 29:1367–1372 11. Alos L, Moyano S, Nadal A, Alobid I, Blanch JL, Ayala E, Lloveras B, Quint W, Cardesa A, Ordi J (2009) Human papillomaviruses are identified in a subgroup of sinonasal squamous cell carcinomas with favorable outcome. Cancer 115:2701–2709 12. Larque AB, Hakim S, Ordi J, Nadal A, Diaz A, Pino MD, Marimon L, Alobid I, Cardesa A, Alos L (2014) High-risk human papillomavirus is transcriptionally active in a subset of sinonasal squamous cell carcinomas. Mod Pathol 27:343–351 13. Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, Nguyen-Tan PF, Westra WH, Chung CH, Jordan RC, Lu C, Kim H, Axelrod R, Silverman CC, Redmond KP, Gillison ML (2010) Human papillomavirus and survival of patients with oropharyngeal cancer. N Engl J Med 363:24–35 14. Santos M, Landolfi S, Olivella A, Lloveras B, Klaustermeier J, Suarez H, Alos L, Puig-Tintore LM, Campo E, Ordi J (2006) p16 overexpression identifies HPV-positive vulvar squamous cell carcinomas. Am J Surg Pathol 30:1347–1356 15. Klaes R, Benner A, Friedrich T, Ridder R, Herrington S, Jenkins D, Kurman RJ, Schmidt D, Stoler M, von Knebel DM (2002) p16INK4a immunohistochemistry improves interobserver agreement in the diagnosis of cervical intraepithelial neoplasia. Am J Surg Pathol 26: 1389–1399 16. Klussmann JP, Gultekin E, Weissenborn SJ, Wieland U, Dries V, Dienes HP, Eckel HE, Pfister HJ, Fuchs PG (2003) Expression of p16 protein identifies a distinct entity of tonsillar carcinomas associated with human papillomavirus. Am J Pathol 162:747–753 17. Singhi AD, Westra WH (2010) Comparison of human papillomavirus in situ hybridization and p16 immunohistochemistry in the detection of human papillomavirus-associated head and neck cancer based on a prospective clinical experience. Cancer 116:2166–2173 18. Smeets SJ, Hesselink AT, Speel EJ, Haesevoets A, Snijders PJ, Pawlita M, Meijer CJ, Braakhuis BJ, Leemans CR, Brakenhoff RH (2007) A novel algorithm for reliable detection of human papillomavirus in paraffin embedded head and neck cancer specimen. Int J Cancer 121:2465–2472 19. Hoffmann M, Ihloff AS, Gorogh T, Weise JB, Fazel A, Krams M, Rittgen W, Schwarz E, Kahn T (2010) p16(INK4a) overexpression predicts translational active human papillomavirus infection in tonsillar cancer. Int J Cancer 127:1595–1602 20. Bodner-Adler B, Bodner K, Czerwenka K, Kimberger O, Leodolter S, Mayerhofer K (2005) Expression of p16 protein in patients with uterine smooth muscle tumors: an immunohistochemical analysis. Gynecol Oncol 96:62–66 21. O'Neill CJ, McBride HA, Connolly LE, McCluggage WG (2007) Uterine leiomyosarcomas are characterized by high p16, p53 and MIB1 expression in comparison with usual leiomyomas, leiomyoma variants and smooth muscle tumours of uncertain malignant potential. Histopathology 50:851–858 22. O'Neill CJ, McBride HA, Connolly LE, Deavers MT, Malpica A, McCluggage WG (2007) High-grade ovarian serous carcinoma exhibits significantly higher p16 expression than low-grade serous carcinoma and serous borderline tumour. Histopathology 50:773–779
Virchows Arch 23. Zhang H, Liu J, Cagle PT, Allen TC, Laga AC, Zander DS (2005) Distinction of pulmonary small cell carcinoma from poorly differentiated squamous cell carcinoma: an immunohistochemical approach. Mod Pathol 18:111–118 24. Malik SM, Nevin DT, Cohen S, Hunt JL, Palazzo JP (2011) Assessment of immunohistochemistry for p16INK4 and high-risk HPV DNA by in situ hybridization in esophageal squamous cell carcinoma. Int J Surg Pathol 19:31–34 25. Jares P, Nadal A, Fernandez PL, Pinyol M, Hernandez L, Cazorla M, Hernandez S, Bea S, Cardesa A, Campo E (1999) Disregulation of p16MTS1/CDK4I protein and mRNA expression is associated with gene alterations in squamous-cell carcinoma of the larynx. Int J Cancer 81:705–711 26. Chernock RD, Wang X, Gao G, Lewis JS Jr, Zhang Q, Thorstad WL, El-Mofty SK (2013) Detection and significance of human papillomavirus, CDKN2A(p16) and CDKN1A(p21) expression in squamous cell carcinoma of the larynx. Mod Pathol 26:223–231 27. Kreimer AR, Clifford GM, Boyle P, Franceschi S (2005) Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev 14:467–475 28. Halec G, Holzinger D, Schmitt M, Flechtenmacher C, Dyckhoff G, Lloveras B, Hofler D, Bosch FX, Pawlita M (2013) Biological evidence for a causal role of HPV16 in a small fraction of laryngeal squamous cell carcinoma. Br J Cancer 109:172–183 29. Salazar CR, Anayannis N, Smith RV, Wang Y, Haigentz M Jr, Garg M, Schiff BA, Kawachi N, Elman J, Belbin TJ, Prystowsky MB, Burk RD, Schlecht NF (2014) Combined P16 and human papillomavirus testing predicts head and neck cancer survival. Int J Cancer 135: 2404–2412 30. Deng Z, Hasegawa M, Aoki K, Matayoshi S, Kiyuna A, Yamashita Y, Uehara T, Agena S, Maeda H, Xie M, Suzuki M (2014) A comprehensive evaluation of human papillomavirus positive status and p16INK4a overexpression as a prognostic biomarker in head and neck squamous cell carcinoma. Int J Oncol 45:67–76 31. Broders A (1941) The microscopic grading of cancer. Surg Clin N Am 21:947–962 32. Chernock RD, El-Mofty SK, Thorstad WL, Parvin CA, Lewis JS Jr (2009) HPV-related nonkeratinizing squamous cell carcinoma of the oropharynx: utility of microscopic features in predicting patient outcome. Head Neck Pathol 3:186–194 33. Edge SB, Compton CC (2010) The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol 17:1471–1474 34. Jares P, Fernandez PL, Nadal A, Cazorla M, Hernandez L, Pinyol M, Hernandez S, Traserra J, Cardesa A, Campo E (1997) p16MTS1/ CDK4I mutations and concomitant loss of heterozygosity at 9p2123 are frequent events in squamous cell carcinoma of the larynx. Oncogene 15:1445–1453 35. Evander M, Edlund K, Boden E, Gustafsson A, Jonsson M, Karlsson R, Rylander E, Wadell G (1992) Comparison of a one-step and a two-
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
step polymerase chain reaction with degenerate general primers in a population-based study of human papillomavirus infection in young Swedish women. J Clin Microbiol 30:987–992 Lewis JS Jr, Chernock RD, Ma XJ, Flanagan JJ, Luo Y, Gao G, Wang X, El-Mofty SK (2012) Partial p16 staining in oropharyngeal squamous cell carcinoma: extent and pattern correlate with human papillomavirus RNA status. Mod Pathol 25:1212–1220 Lewis JS Jr, Chernock RD (2014) Human papillomavirus and Epstein Barr virus in head and neck carcinomas: suggestions for the new WHO classification. Head Neck Pathol 8:50–58 Conde L, Moyano S, Vilaseca I, Moragas M, Cardesa A, Nadal A (2011) Role of microsatellite instability in young patients with laryngeal carcinoma. Anal Quant Cytol Histol 33:111–118 Kotake Y, Cao R, Viatour P, Sage J, Zhang Y, Xiong Y (2007) pRB family proteins are required for H3K27 trimethylation and polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene. Genes Dev 21:49–54 Schweingruber C, Rufener SC, Zund D, Yamashita A, Muhlemann O (2013) Nonsense-mediated mRNA decay—mechanisms of substrate mRNA recognition and degradation in mammalian cells. Biochim Biophys Acta 1829:612–623 Lewis JS Jr, Ukpo OC, Ma XJ, Flanagan JJ, Luo Y, Thorstad WL, Chernock RD (2012) Transcriptionally-active high-risk human papillomavirus is rare in oral cavity and laryngeal/hypopharyngeal squamous cell carcinomas—a tissue microarray study utilizing E6/E7 mRNA in situ hybridization. Histopathology 60:982–991 Chaturvedi AK, Engels EA, Pfeiffer RM, Hernandez BY, Xiao W, Kim E, Jiang B, Goodman MT, Sibug-Saber M, Cozen W, Liu L, Lynch CF, Wentzensen N, Jordan RC, Altekruse S, Anderson WF, Rosenberg PS, Gillison ML (2011) Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J Clin Oncol 29: 4294–4301 Lewis JS Jr, Thorstad WL, Chernock RD, Haughey BH, Yip JH, Zhang Q, El-Mofty SK (2010) p16 positive oropharyngeal squamous cell carcinoma: an entity with a favorable prognosis regardless of tumor HPV status. Am J Surg Pathol 34:1088–1096 Chung CH, Zhang Q, Kong CS, Harris J, Fertig EJ, Harari PM, Wang D, Redmond KP, Shenouda G, Trotti A, Raben D, Gillison ML, Jordan RC, Le QT (2014) p16 protein expression and human papillomavirus status as prognostic biomarkers of nonoropharyngeal head and neck squamous cell carcinoma. J Clin Oncol. doi:10.1200/JCO. 2013.54.5228 Walter V, Yin X, Wilkerson MD, Cabanski CR, Zhao N, Du Y, Ang MK, Hayward MC, Salazar AH, Hoadley KA, Fritchie K, Sailey CJ, Weissler MC, Shockley WW, Zanation AM, Hackman T, Thorne LB, Funkhouser WD, Muldrew KL, Olshan AF, Randell SH, Wright FA, Shores CG, Hayes DN (2013) Molecular subtypes in head and neck cancer exhibit distinct patterns of chromosomal gain and loss of canonical cancer genes. PLoS ONE. doi:10.1371/journal.pone. 0056823
