brain research 1605 (2015) 31–38
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research Report
p53 inhibition provides a pivotal protective effect against ischemia-reperfusion injury in vitro via mTOR signaling Xiaomu Lia,1, Shixin Gub,1, Yan Linga, Chao Shenb, Xiaoyun Caob, Rong Xieb,n a
Department of Endocrinology, Zhongshan Hospital, Fudan University, Shanghai 200032, China Department of Neurosurgery, Huashan Hospital, Fudan University, 12 Middle Wulumuqi Road, Shanghai 200040, China
b
art i cle i nfo
ab st rac t
Article history:
Tumor suppressor p53 has recently been reported to have numerous functions independent of
Accepted 5 February 2015
tumorigenesis, including neuronal survival during ischemia. The mammalian target of
Available online 12 February 2015
rapamycin (mTOR) signaling pathway plays a central role in the regulation of metabolism, cell
Keywords:
growth, development, and cell survival. Our recent work has demonstrated the neuroprotective
p53
effects of the mTOR pathway. Considering that p53 is also an important regulator of mTOR, to
mTOR
further clarify the role of p53 and the mTOR signaling pathway in neuronal ischemic-
OGD
reperfusion injury, we used mouse primary mixed cultured neurons with an oxygen glucose
Ischemic reperfusion injury
deprivation (OGD) model to mimic an ischemic-reperfusion injury in vitro. A lentiviral system was also used to inhibit or overexpress p53 to determine whether p53 alteration affects OGD and reperfusion injury. Our results show that activated p53 was induced and it suppressed mTOR expression in primary mixed cultured neurons after OGD and reperfusion. Inhibiting p53, using either a chemical inhibitor or lentiviral-mediated shRNA, exhibited neuroprotective effects in primary cultured neurons against OGD and reperfusion injury through the upregulation of mTOR activity. Such protective effects could be reversed by rapamycin, an mTOR inhibitor. Conversely, p53 overexpression tended to exacerbate the detrimental effects of OGD injury by downregulating mTOR activity. These results suggest that p53 inhibition has a pivotal protective effect against an in vitro ischemia-reperfusion injury via mTOR signaling and provides a potential and promising therapeutic target for stroke treatment. & 2015 Elsevier B.V. All rights reserved.
1.
Introduction
The molecular mechanisms that underlie neuronal survival following stroke are important for the development of effective neuroprotective strategies. Under the conditions of ischemiareperfusion, the mechanisms of neuronal survival involve n
Corresponding author. Fax: þ86 216248999. E-mail address: [email protected] (R. Xie). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.brainres.2015.02.009 0006-8993/& 2015 Elsevier B.V. All rights reserved.
factors related to apoptosis, necrosis, and proliferation; the underlying molecular signaling pathways still need to be fully clarified and investigated. Tumor suppressor p53 is a well-documented transcription factor, which can bind to its response element (RE) and control the expression of target genes (Nagaich et al., 1997).
32
brain research 1605 (2015) 31–38
It has recently been reported that p53 possesses numerous novel functions independent of tumorigenesis. In addition to its effects on the metabolic regulation of adipocytes (Shimizu et al., 2012), liver (Kodama et al., 2011), beta cells (Hoshino et al., 2014), and other tissues, p53 has also been reported to be involved in cerebral ischemia (Chopp et al., 1992). Inhibition of p53 by p53 inhibitors may protect against cerebral ischemic-reperfusion injury (Crumrine et al., 1994; Culmsee et al., 2001). Considering the multiple and non-specific effects of p53 inhibitors, including their direct activity on subsequent downstream targets of p53, causing G0/G1 cell cycle arrest, and generating in vitro cell toxicity, it is necessary to determine whether a specific p53 inhibitor or overexpression would generate any effects against stroke. Furthermore, the underlying mechanisms of the regulatory roles of p53 in cerebral ischemia injury, independent of apoptosis, remain poorly understood. The mammalian target of rapamycin (mTOR) signaling pathway plays a central role in the regulation of metabolism, cell growth, development, and cell survival. Research, including our recent work, has demonstrated its contribution to the neuroprotective effects and benefits to neuronal survival (Pastor et al., 2009; Xie et al., 2012, 2014a). Interestingly, recent reports have shown that p53, which usually plays a critical role in sensing genotoxic and other stresses, is also an important regulator of mTOR (Feng et al., 2005; Galluzzi et al., 2010). p53 can directly or indirectly control the activity of mTOR, and there is extensive cross talk between them. p53 may behave like another tumor suppressor, Phosphatase and tensin homolog (PTEN), which is a negative regulator of mTOR, to inhibit the mTOR pathway in human fibrosarcoma cells (Demidenko et al., 2010). In addition, p53 has been identified to suppress medullary thyroid cancer progression by inhibiting mTOR pathway activation (Akeno et al., 2015). The activation of p53 due to energy deprivation or other external stresses not only inhibits mTOR activity to shut down the pathway but also results in the transient phosphorylation of the p53 protein (Feng et al., 2005). Thus, p53 and mTOR signaling components exhibit cross talk and coordinately regulate cell growth, proliferation, and death (Feng et al., 2005). p53 inhibits the mTOR pathway in a cell type-dependent manner, the related mechanism for which is still under investigation, particularly for ischemic and reperfusion neuronal injuries. To further clarify the role of p53 and the mTOR signaling pathway in the ischemic-reperfusion injury in neurons, we used mouse primary mixed neuronal cultures and an oxygen glucose deprivation model to mimic an ischemic-reperfusion injury in vitro. In addition, a lentiviral system was included to inhibit or overexpress p53 to determine whether p53 alternation could protect against the OGD and reperfusion injury in primary mixed cultured neurons and to determine its potential mechanism.
2.
Results
2.1. Activated p53 suppresses the expression of mTOR in primary mixed cultured neurons after OGD and reperfusion injury As previously described (Xie et al., 2014b), we used conditions of 6 h OGD followed by 4 h of simulated reperfusion to induce
significant LDH release in primary cultured neurons from C57 mice. After OGD and reperfusion, the LDH release was significantly increased (Fig. 1A), The expression of p53 was also induced upon the stress of OGD and reperfusion (Fig. 1B). However, the total protein level of mTOR, one of the molecular targets of p53 and an important factor involved in ischemia and reperfusion injury (Xie et al., 2014b), was decreased (Fig. 1B). These findings suggest a possible role for the p53-mTOR pathway in the regulation of ischemia and reperfusion injury in neurons.
2.2. Inhibition of p53 has protective effects in primary mixed cultured neurons, while p53 overexpression showed a trend to exaggerate the detrimental effects To determine whether activated p53 plays a role in ischemiareperfusion injury in neurons, the p53 inhibitor pifithrin-α (PFH) was used to block the transcriptional activity of p53 (Komarov et al., 1999). Primary cultured neurons were pretreated with different concentrations of PFH 24 h prior to OGD. The results suggest that PFH pre-treatment reduced the OGD and reperfusion-induced injury to neurons in a dosedependent manner, with significant effects occurring at a dose of 8 and 16 mM (Fig. 2A). Furthermore, in a time-course experiment, the results indicate that a PFH pre-treatment could reduce the LDH release associated with all the examined OGD durations (2–12 h) (Fig. 2B). Based on these findings, we further investigated whether directly blocking the expression of p53 could also protect neurons against ischemia. For this purpose, we used a lentiviralmediated system encoding p53 shRNA to infect neurons. As shown in Fig. 3, the mRNA and protein levels of p53 were both significantly downregulated after the neurons were infected (Fig. 3A, B). Furthermore, the LDH release after OGD and reperfusion was significantly decreased after the infection in primary mixed cultured neurons (Fig. 4A). In contrast with p53 shRNA delivery, a lentiviral-mediated system to overexpress p53
Fig. 1 – OGD and reperfusion injury induced p53 expression in primary mixed cultured neurons. A. Mouse brain primary mixed neurons were exposed to 6 h of OGD followed by 4 h of simulated reperfusion. After OGD and reperfusion, the LDH release was significantly increased in the OGD vs. the control group. **po0.01; n ¼ 12–16 per group. B. Representative western blot showing protein bands for p-mTOR, mTOR and p53 from primary mixed neurons with or without OGD and reperfusion.
brain research 1605 (2015) 31–38
Fig. 2 – PFH, a p53 inhibitor, had protective effects against OGD and reperfusion injury in primary mixed cultured neuron. A. PFH pre-treatment 24 h prior to OGD had protective effects in the form of reducing the LDH release in a dose-dependent manner. The concentration of 8 lM had the highest protective effect. **po0.01, vs. NO OGD; ##po0.01, vs. 0 lM PFH treatment; n ¼ 12–16 per group. B. primary mixed neurons were exposed to various periods of OGD, followed by 4 h of simulated reperfusion with or without PFH-alpha (8 lM). LDH release was measured and indicated a reduced LDH release for all treatment durations (2–12 h OGD), but the results were only significant for the 6 and 8 h durations of OGD between the PFH treatment and control groups. *po0.05; n ¼ 6–8 per group.
in neurons (Fig. 3A, C) caused an increase in LDH release after OGD and reperfusion, although the results did not reach statistical significance (Fig. 4B).
2.3. The mTOR signaling pathway is required for the protective effects of p53 inhibition in primary mixed cultured neurons To investigate whether the mTOR signaling pathway is involved in the mechanism of p53, we examined the expression of phosphorylated mTOR using Western blot analysis of primary mixed neurons infected with a lentivirus encoding either p53 shRNA or the p53 protein. The results showed that the levels of pmTOR were significantly downregulated after OGD and reperfusion, and the inhibition of p53 could reverse this effect (Fig. 5A). In contrast, pmTOR levels were downregulated by p53 overexpression compared to controls, although the results did not reach statistical significance (Fig. 5B). These results
33
Fig. 3 – The effects of lentiviral expression of p53 shRNA or p53 in primary mixed cultured neurons. A. Representative western blot results showed protein bands of p53 from primary mixed cultured neurons transfected with or without lentivirus encoding p53 shRNA or p53 for 48 h; the scramble shRNA and GFP groups were used as experimental controls. B, C. Q-PCR results showing the mRNA levels after infection with lentivirus encoding p53 shRNA (B) or p53 (C). *po0.05; n ¼6–8 per group.
Fig. 4 – Effects of p53 inhibition or overexpression in primary mixed neurons after OGD and reperfusion injury. Primary mixed neurons were transfected with lentivirus encoding p53 shRNA (A) or p53 (B) for 48 h, followed by OGD and reperfusion; the scramble shRNA and GFP groups were used as experimental controls. A. The LDH release after OGD and reperfusion was significantly decreased by p53 inhibition compared with the scrambled group. **po0.01, vs. NO OGD; ##po0.01, vs. scramble; n ¼8–10 per group. B. The LDH release after OGD and reperfusion was slightly increased by overexpression of p53 compared with the GFP group, but the results did not reach statistical significance. **po0.01, vs. NO OGD; n ¼8–10 per group.
suggest that the protective effects of p53 inhibition against OGD and reperfusion injury are related to pmTOR expression. To further determine whether the effects of p53 inhibition are dependent on the mTOR signaling pathway during ischemic
34
brain research 1605 (2015) 31–38
and reperfusion injury, we used the mTOR inhibitor rapamycin to pre-treat the primary neurons 24 h prior to OGD. The results showed that rapamycin (100 nM) significantly reduced the protective effects of p53 inhibition. Consistent with these findings, western blot results indicated that p53 inhibition resulted in the phosphorylation of mTOR, S6K and 4EBP1, while rapamycin treatment significantly decreased these levels and attenuated the protective effects of p53 inhibition (Fig. 6A). In contrast, the levels of phosphorylated mTOR, S6K and 4EBP1 were further downregulated by the rapamycin pre-treatment combined with p53 overexpression, although the results were not statistically significant. These findings suggest that the mTOR signaling pathway is required for the protective effects of p53 inhibition against ischemia-reperfusion injury in primary mixed cultured neurons.
3.
Discussion
For the present study, we examined the protective effects of p53 inhibition against OGD and reperfusion injury in cultured neurons via the mTOR pathway. In 1992, Chopp et al. first reported the expression of p53 in ischemic regions of brain; they found that p53 was expressed in brain regions of neuronal necrosis following a middle cerebral artery occlusion in rat and that the presence of p53 was associated with cell death after ischemia (Chopp et al., 1992). Furthermore, treatment with the p53 inhibitor PFH could also improve the
histological, motor and behavioral outcomes of ischemic stroke in mice (Leker et al., 2004). These studies provide evidence for a potential role of p53 in cerebral ischemic reperfusion injury. In this study, we used two different strategies to block the function of p53 in mixed cultured neurons, including the p53 inhibitor PFH and a lentivirus encoding for an shRNA against p53. Our results demonstrate that p53 inhibition provides protective effects against OGD and reperfusion injury in primary mixed cultured neurons. A number of apoptosis-related genes, including p21 and BAX, are transcriptionally regulated by p53. Several studies have also previously indicated that p53 regulates the process of ischemia reperfusion injury via apoptosis. Cheng et al. reported that inhibition of p53 and its downstream pro-apoptotic effectors is involved in the protective effects of activated protein C (APC) in hypoxic human brain endothelium (Cheng et al., 2003). The p53 inhibitor PFH may reduce the number of apoptotic cells in the ischemic brain by inhibiting the binding of p53 to its target DNA sites, as it reduced the expression of the p53-related gene p21 (WAF) (Leker et al., 2004). The activation of p53 has also been considered as one of the major inducers of apoptotic cell death after ischemic injury in renal cells (Dagher, 2004; Kelly et al., 2003). In addition to the regulation of apoptosis however, emerging evidence has suggested several apoptosis-independent functions for p53, including proliferation, cell survival, senescence, and other important functions (Di Giovanni and Rathore, 2012; Qian and Chen, 2013). The mTOR (mammalian target of rapamycin) protein kinase is one of the most important regulators of cell
Fig. 5 – p53 regulated mTOR expression in primary mixed neurons after OGD and reperfusion injury. Representative western blot results and bar graph of protein bands for mTOR from primary mixed neurons transfected with or without lentivirus encoding p53 shRNA (A) or p53 (B) for 48 h, followed with or without the indicated time of OGD and reperfusion. **po0.01, vs. NO OGD; ##po0.01, vs. scramble (p53 shRNA-); n ¼6–8 per group.
brain research 1605 (2015) 31–38
35
Fig. 6 – Rapamycin blocked the protective effects of p53 inhibition against OGD and reperfusion injury and showed a tendency to exacerbate the detrimental effects of p53 overexpression. Primary mixed neurons were infected with or without lentivirus encoding p53 shRNA (A, C) or p53 (B, D) for 48 h, with or without a pre-treatment of rapamycin for 24 h, followed with the indicated time of OGD and reperfusion. A. The rapamycin pre-treatment abolished the protective effects by p53 inhibition after OGD and reperfusion injury. **po0.01, vs. scramble (p53 shRNA); ##po0.01, vs. no rapamycin; n ¼6–8 per group. B. The rapamycin pre-treatment exaggerated the LDH release in mixed neurons with p53 overexpression after OGD and reperfusion injury, but the data did not reach statistical significance; n ¼ 6–8 per group. C,D. Representative western blot results and bar graph show protein bands for pmTOR, pS6K, and p4EBP1 in primary mixed neurons infected with or without lentivirus encoding p53 shRNA (C) or p53 (D) for 48 h, with or without a pre-treatment of rapamycin, followed by the indicated time of OGD and reperfusion. **po0.01, vs. scramble (p53 shRNA); ##po0.01, vs. p53 shRNA; n¼ 6–8 per group.
proliferation and survival. Our previous work has demonstrated that the mTOR signaling pathway plays an important role in the protective effects of post-conditioning (Xie et al., 2014b) and alpha-lipoic acid in ischemia reperfusion injury (Xie et al., 2012). Whether the protection of p53 inhibition against OGD and
reperfusion injury acts through the mTOR pathway in ischemia and reperfusion injury requires further investigation. mTOR is known as the central node of nutrient and growth factor signaling, while p53 plays a critical role in sensing genotoxic and other stresses. It has been reported
36
brain research 1605 (2015) 31–38
that p53 and mTOR signaling machineries exhibit cross talk that coordinately regulates cell growth, proliferation, and death. For example, Akeno demonstrated that the suppression of carcinoma progression by p53 occurred through inhibiting mTOR pathway activation (Akeno et al., 2015). Additionally, several p53 transcriptional targets, including AMPK, TSC2, PTEN, IGF-BP3 and sestrins, may inhibit the activation of the mTOR pathway. It should be noted that p53 may also cause the cleavage and/or inactivation of eIF4G, eIF4B, eIF4E, and eIF4F, thereby inhibiting protein synthesis downstream of mTOR signaling. Our results show that an in vitro OGD and reperfusion injury results in an increase in the expression of p53 and suppresses the phosphorylation of mTOR and its downstream effectors (S6K, 4EBP). The decrease in phosphorylated mTOR, S6K and 4EBP1 levels could be upregulated by p53 inhibition, and the protective effects of the p53 inhibition were abolished by rapamycin, a mTOR inhibitor. These results suggest that mTOR is required for the regulation of p53 in ischemia injury. Conversely, p53 overexpression tended to exacerbate the detrimental effects induced by OGD and reperfusion in primary neurons and downregulated the activity of the mTOR pathway. While the data did not reach statistical significance, a possible reason could be that the 6 h OGD followed by reperfusion had already induced a severe neuronal injury that could not be further promoted. The detrimental effects could become significant if the OGD and reperfusion duration is adjusted. Regardless, our results suggest that p53 overexpression enhances OGD and reperfusion injury and downregulates mTOR activity, in contrast with p53 inhibition. These data reveal the potential mechanism of p53 in ischemic and reperfusion injury in cultured neurons. In conclusion, the present study suggests that p53 inhibition provides pivotal protective effects against OGD and reperfusion injury in primary mixed cultured neurons and that mTOR is required for the protective effects of p53 inhibition. As depicted in Fig. 7, p53 and mTOR play coordinated roles in the process of ischemic and reperfusion neuronal injury, which may provide a promising target for stroke-related therapies.
4.
Experimental procedures
4.1.
Construction of lentiviral vectors
Fig. 7 – A diagram of the p53/mTOR signaling pathway in ischemic and reperfusion injury in neurons.
4.2.
We used a three plasmid system for lentiviral packaging as detailed in our previous study, which included the lentiviral transfer vector (pHR'tripCMV- IRES-eGFP) containing the coding region of the targeted genes or p53/scramble shRNA, the packaging plasmid (p-delta) that provides all vector proteins driven by the trip CMV promoter (except the envelope protein) and the envelope-encoding plasmid (p-VSVG) that encodes the heterologous vesicular stomatitis virus envelope protein VSVG (Hu et al., 2011). In brief, a mixture of 45 μg of the transfer vector, 30 μg of the packaging plasmid and 15 μg of the envelope-encoding plasmid were transiently transfected into three T175 flasks containing 1.5 107 HEK-293 T cells using the calcium phosphate precipitation (CPP) method. Supernatants were collected 72 h post-transfection and viral particles were concentrated by ultracentrifugation. Viruses were resuspended in phosphate-buffered saline (PBS) and kept at 80 1C until use. The virus particles were titered with the TCID50 method as previously described (Apolonia et al., 2007; Breckpot et al., 2003). Virus titers ranged from 1 108– 5 108 TU/ml and were diluted in PBS to a final concentration of 1 108 TU/ml before gene transfer was conducted.
4.3.
We used lentiviral vectors containing p53 shRNA (p53shRNA: 12089, Addgene, Cambridge, MA) to inhibit p53 expression, and a scrambled shRNA (Scramble shRNA: 1864, Addgene, Cambridge, MA) as a control. For overexpression, the p53 cDNA was cloned from the plasmid (p53: 12136, Addgene, Cambridge, MA) into the lentiviral backbone plasmid, pHR'tripCMV-IRES-eGFP, which contains a CMV promoter and an IRES sequence between its multiple cloning site (MCS) and eGFP as previously described (Xie et al., 2013). The IRES sequence enables independent expression of both the target gene and the eGFP simultaneously. A lentiviral plasmid backbone containing only eGFP was used as a control vector.
Lentiviral vector generation and titration
Cell culture
Primary mixed neuronal cultures were prepared using timedpregnant C57 mice (E18, Model Animal Research Center of Nanjing University, China). Briefly, mice were anesthetized with isoflurane and the E18 embryos were removed. The cortical region of the fetal brains was dissected in warm media and pooled together. The cortices were titrated and incubated in papain solution (10 U/ml, Sigma, St. Louis, MO, USA) for 20 min at 37 1C, then centrifuged at 1500 rpm for 5 min at room temperature (RT). The cells were resuspended in minimal essential medium (MEM) (Gibco, Grand Island, NY, USA) containing 10% fetal horse serum (Hyclone, Logan, UT, USA), 2 mmol/L glutamine (Gibco), 25 mM glucose, 1% penicillin/streptomycin (Gibco). Cells were plated onto poly-D-lysine-coated tissue
37
brain research 1605 (2015) 31–38
culture plates at 7.5 105 cells/ml. Media was completely changed after 24 h. One-half medium changes were performed at day 4. Cultures were incubated at 37 1C in a 5% CO2 incubator and experiments were performed day 9–11.
4.4. In vitro drug delivery, gene transfer, oxygen glucose deprivation (OGD) model and cell viability assay The p53 inhibitor pifithrin-α (PFH) (Sigma) or rapamycin (Calbiochem, Billerica, MA, USA) were added to the cell cultures at the indicated concentrations, and the same amount of vehicle was added as a control 24 h before OGD induction. A control group without OGD was also included. To study the effects of p53 shRNA and p53 cDNA vectors on neuronal injury, the lentiviral vectors, diluted with PBS to 5 ml for 24-well plates and to 10 ml for 6-well plates were directly added into the medium of 9 day primary mixed neuron cultures, with the multiplicity of infection (MOI) at 1:5 (cells: virus units). The same amount of PBS was also added to the medium as an experimental control. The cells were then incubated at 37 1C in a 5% CO2 incubator for another 2 days before OGD was conducted. To induce in vitro ischemia, primary mixed neuron cultures were washed twice with glucose-free balanced salt solution (BSS0, pH 7.4) and the plates were transferred to a modular hypoxic chamber filled with mixed gases of 5% CO2 and 95% N2. The oxygen level was maintained at o0.02% at 37 1C. The cells were kept in the hypoxic chamber for 6 h. Cultures were then restored with glucose to a final concentration of 5.5 mM (BSS5.5, pH 7.4) and recovered at normoxic conditions (37 1C, 5% CO2) for 18 h (OGD restoration). The control group without OGD was washed twice with 5.5 mM glucose in balanced salt solution (BSS5.5, pH 7.4). Cell viability was quantified by measuring lactate dehydrogenase (LDH) release at 18 h after OGD restoration using a previously described colorimetric assay (Dugan et al., 1995). Briefly, 100 μl of cell-free supernatant was transferred to 96well plates. The supernatant was incubated with 150 μl of NADH/phosphate buffer (0.15 mg/mL) for 10 min. Then, 30 μl of sodium pyruvate (2.97 mg/mL) was added, and the absorbance wavelength was measured at 340 nm using a microplate reader. Background absorbance was subtracted and the percentage of LDH release was calculated based on an LDH standard curve.
0.5 μg total RNA by reverse transcription using an ImProm-II reverse transcription kit (Promega) with random hexamer primers. Quantitative real-time PCR was performed using the SYBR Green QPCR system (Qiagen) with specific primers for p53 (forward: 50 ACTGCATGGACGATCTGTTG 30 ; reverse 50 GTGACAGGGTCCTGTGCTG 30 ). The PCR reactions were performed using an Applied Biosystems Prism 7000 sequence detection system. The level of target gene expression was normalized against the GAPDH gene.
4.6.
Western blot analysis
The mixed neuronal cultures were grown in 6-well plates and harvested 48 h after the indicated treatments, and proteins were extracted for Western blotting. The cells were harvested 48 h after gene transfer and homogenized in the cold cell extraction buffer containing 1 mM PMSF (Sigma) and the protease inhibitor cocktail (Sigma). The homogenate was centrifuged at 13000 rpm for 20 min at 4 1C, and the supernatant was removed for protein detection. Protein concentrations were measured using the Bradford assay (Sigma). For the western blot, 20 mg of protein in each lane was subjected to SDS-PAGE using 4–15% Ready Gel (catalog #L050505A2; Bio-Rad, Hercules, CA) at 200 V for 45 min. Protein bands were transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA) at 100 V for 2 h. The membranes were incubated with primary antibodies overnight at 4 1C followed by Alexa Fluor 488 donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5000, Invitrogen, Eugene, OR, USA) for 1 h in the dark room. The manufacturers, catalog numbers, and applications for all primary antibodies are listed in Table 1. The membranes were scanned using a Typhoon trio imager (GE Healthcare). The optical densities of all protein bands were analyzed using IMAGEQUANT 5.2 software (GE Healthcare).
4.7.
Statistical analysis
Statistical Analysis GraphPad Prism 5.0 software was used for statistical analyses. The results were analyzed using a one way or two way ANOVA followed by the Fisher least significant difference post hoc test. Tests were considered significant at P values o0.05. Data are presented as the mean7SEM.
Author contributions 4.5.
Quantitative real-time PCR
Total RNA was extracted from primary mixed neurons using TRIzol reagent (Invitrogen), and cDNA was synthesized from
R.L. and X.L. designed the research; X.L., S.G., Y.L., C.S., X.C., and R.X. performed experiments; X.L., S.G., and R.X. analyzed the data; R.X. and X.L. wrote the paper.
Table 1 – Antibodies, concentrations and manufacturers used. Antibodies
Source
Dilutions
Manufacturer
Catalog#
p53 P-mTOR (Ser2448) mTOR P-S6K p70 (Ser371) P-4EBP1 β-actin
mouse Rabbit Rabbit Rabbit Rabbit Mouse
1:2500 1:200 1:1000 1:500 1:500 1:3000
Cell signaling Cell signaling Cell signaling Cell signaling Cell signaling Sigma
2524 2971 2983 9208 9456 A-5441
38
brain research 1605 (2015) 31–38
Conflict of interest The authors declare no conflicts of interest.
Funding This study was fully supported by the following grants: National Natural Science Foundation of China (81200890, R.X.), Scientific Research Foundation of Shanghai Municipal Commission of Health and Family Planning (20134238, R.X.), Natural Science Foundation of Shanghai (15ZR1406600, X.L.).
references
Akeno, N., Miller, A.L., Ma, X., Wikenheiser-Brokamp, K.A., 2015. p53 suppresses carcinoma progression by inhibiting mTOR pathway activation. Oncogene 34 (5), 589–599. Apolonia, L., Waddington, S.N., Fernandes, C., Ward, N.J., Bouma, G., Blundell, M.P., Thrasher, A.J., Collins, M.K., Philpott, N.J., 2007. Stable gene transfer to muscle using non-integrating lentiviral vectors. Mol. Ther. 15, 1947–1954. Breckpot, K., Dullaers, M., Bonehill, A., van Meirvenne, S., Heirman, C., de Greef, C., van der Bruggen, P., Thielemans, K., 2003. Lentivirally transduced dendritic cells as a tool for cancer immunotherapy. J. Gene Med. 5, 654–667. Cheng, T., Liu, D., Griffin, J.H., Fernandez, J.A., Castellino, F., Rosen, E.D., Fukudome, K., Zlokovic, B.V., 2003. Activated protein C blocks p53-mediated apoptosis in ischemic human brain endothelium and is neuroprotective. Nat. Med. 9, 338–342. Chopp, M., Li, Y., Zhang, Z.G., Freytag, S.O., 1992. p53 expression in brain after middle cerebral artery occlusion in the rat. Biochem. Biophys. Res. Commun. 182, 1201–1207. Crumrine, R.C., Thomas, A.L., Morgan, P.F., 1994. Attenuation of p53 expression protects against focal ischemic damage in transgenic mice. J. Cereb. Blood Flow Metab. 14, 887–891. Culmsee, C., Zhu, X., Yu, Q.S., Chan, S.L., Camandola, S., Guo, Z., Greig, N.H., Mattson, M.P., 2001. A synthetic inhibitor of p53 protects neurons against death induced by ischemic and excitotoxic insults, and amyloid beta-peptide. J. Neurochem. 77, 220–228. Dagher, P.C., 2004. Apoptosis in ischemic renal injury: roles of GTP depletion and p53. Kidney Int. 66, 506–509. Demidenko, Z.N., Korotchkina, L.G., Gudkov, A.V., Blagosklonny, M.V., 2010. Paradoxical suppression of cellular senescence by p53. Proc. Natl. Acad. Sci. USA 107, 9660–9664. Di Giovanni, S., Rathore, K., 2012. p53-Dependent pathways in neurite outgrowth and axonal regeneration. Cell Tissue Res. 349, 87–95. Dugan, L.L., Bruno, V.M., Amagasu, S.M., Giffard, R.G., 1995. Glia modulate the response of murine cortical neurons to excitotoxicity: glia exacerbate AMPA neurotoxicity. J. Neurosci. 15, 4545–4555. Feng, Z., Zhang, H., Levine, A.J., Jin, S., 2005. The coordinate regulation of the p53 and mTOR pathways in cells. Proc. Natl. Acad. Sci. USA 102, 8204–8209.
Galluzzi, L., Kepp, O., Kroemer, G., 2010. TP53 and MTOR crosstalk to regulate cellular senescence. Aging 2, 535–537. Hoshino, A., Ariyoshi, M., Okawa, Y., Kaimoto, S., Uchihashi, M., Fukai, K., Iwai-Kanai, E., Ikeda, K., Ueyama, T., Ogata, T., Matoba, S., 2014. Inhibition of p53 preserves Parkin-mediated mitophagy and pancreatic beta-cell function in diabetes. Proc. Natl. Acad. Sci. USA 111, 3116–3121. Hu, Q., Chen, C., Khatibi, N.H., Li, L., Yang, L., Wang, K., Han, J., Duan, W., Zhang, J.H., Zhou, C., 2011. Lentivirus-mediated transfer of MMP-9 shRNA provides neuroprotection following focal ischemic brain injury in rats. Brain Res. 1367, 347–359. Kelly, K.J., Plotkin, Z., Vulgamott, S.L., Dagher, P.C., 2003. P53 mediates the apoptotic response to GTP depletion after renal ischemia-reperfusion: protective role of a p53 inhibitor. J. Am. Soc. Nephrol. 14, 128–138. Kodama, T., Takehara, T., Hikita, H., Shimizu, S., Shigekawa, M., Tsunematsu, H., Li, W., Miyagi, T., Hosui, A., Tatsumi, T., Ishida, H., Kanto, T., Hiramatsu, N., Kubota, S., Takigawa, M., Tomimaru, Y., Tomokuni, A., Nagano, H., Doki, Y., Mori, M., Hayashi, N., 2011. Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice. J. Clin. Invest. 121, 3343–3356. Komarov, P.G., Komarova, E.A., Kondratov, R.V., Christov-Tselkov, K., Coon, J.S., Chernov, M.V., Gudkov, A.V., 1999. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science 285, 1733–1737. Leker, R.R., Aharonowiz, M., Greig, N.H., Ovadia, H., 2004. The role of p53-induced apoptosis in cerebral ischemia: effects of the p53 inhibitor pifithrin alpha. Exp. Neurol. 187, 478–486. Nagaich, A.K., Appella, E., Harrington, R.E., 1997. DNA bending is essential for the site-specific recognition of DNA response elements by the DNA binding domain of the tumor suppressor protein p53. J. Biol. Chem. 272, 14842–14849. Pastor, M.D., Garcia-Yebenes, I., Fradejas, N., Perez-Ortiz, J.M., Mora-Lee, S., Tranque, P., Moro, M.A., Pende, M., Calvo, S., 2009. mTOR/S6 kinase pathway contributes to astrocyte survival during ischemia. J. Biol. Chem. 284, 22067–22078. Qian, Y., Chen, X., 2013. Senescence regulation by the p53 protein family. Methods Mol. Biol. 965, 37–61. Shimizu, I., Yoshida, Y., Katsuno, T., Tateno, K., Okada, S., Moriya, J., Yokoyama, M., Nojima, A., Ito, T., Zechner, R., Komuro, I., Kobayashi, Y., Minamino, T., 2012. p53-induced adipose tissue inflammation is critically involved in the development of insulin resistance in heart failure. Cell Metab. 15, 51–64. Xie, L., Sun, F., Wang, J., Mao, X., Xie, L., Yang, S.H., Su, D.M., Simpkins, J.W., Greenberg, D.A., Jin, K., 2014a. mTOR signaling inhibition modulates macrophage/microglia-mediated neuroinflammation and secondary injury via regulatory T cells after focal ischemia. J. Immunol. 192, 6009–6019. Xie, R., Li, X., Ling, Y., Shen, C., Wu, X., Xu, W., Gao, X., 2012. Alpha-lipoic acid pre- and post-treatments provide protection against in vitro ischemia-reperfusion injury in cerebral endothelial cells via Akt/mTOR signaling. Brain Res. 1482, 81–90. Xie, R., Cheng, M., Li, M., Xiong, X., Daadi, M., Sapolsky, R.M., Zhao, H., 2013. Akt isoforms differentially protect against stroke-induced neuronal injury by regulating mTOR activities. J. Cereb. Blood. Flow Metab. 33, 1875–1885. Xie, R., Wang, P., Cheng, M., Sapolsky, R., Ji, X., Zhao, H., 2014b. Mammalian target of rapamycin cell signaling pathway contributes to the protective effects of ischemic postconditioning against stroke. Stroke 45, 2769–2776.
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research Report
p53 inhibition provides a pivotal protective effect against ischemia-reperfusion injury in vitro via mTOR signaling Xiaomu Lia,1, Shixin Gub,1, Yan Linga, Chao Shenb, Xiaoyun Caob, Rong Xieb,n a
Department of Endocrinology, Zhongshan Hospital, Fudan University, Shanghai 200032, China Department of Neurosurgery, Huashan Hospital, Fudan University, 12 Middle Wulumuqi Road, Shanghai 200040, China
b
art i cle i nfo
ab st rac t
Article history:
Tumor suppressor p53 has recently been reported to have numerous functions independent of
Accepted 5 February 2015
tumorigenesis, including neuronal survival during ischemia. The mammalian target of
Available online 12 February 2015
rapamycin (mTOR) signaling pathway plays a central role in the regulation of metabolism, cell
Keywords:
growth, development, and cell survival. Our recent work has demonstrated the neuroprotective
p53
effects of the mTOR pathway. Considering that p53 is also an important regulator of mTOR, to
mTOR
further clarify the role of p53 and the mTOR signaling pathway in neuronal ischemic-
OGD
reperfusion injury, we used mouse primary mixed cultured neurons with an oxygen glucose
Ischemic reperfusion injury
deprivation (OGD) model to mimic an ischemic-reperfusion injury in vitro. A lentiviral system was also used to inhibit or overexpress p53 to determine whether p53 alteration affects OGD and reperfusion injury. Our results show that activated p53 was induced and it suppressed mTOR expression in primary mixed cultured neurons after OGD and reperfusion. Inhibiting p53, using either a chemical inhibitor or lentiviral-mediated shRNA, exhibited neuroprotective effects in primary cultured neurons against OGD and reperfusion injury through the upregulation of mTOR activity. Such protective effects could be reversed by rapamycin, an mTOR inhibitor. Conversely, p53 overexpression tended to exacerbate the detrimental effects of OGD injury by downregulating mTOR activity. These results suggest that p53 inhibition has a pivotal protective effect against an in vitro ischemia-reperfusion injury via mTOR signaling and provides a potential and promising therapeutic target for stroke treatment. & 2015 Elsevier B.V. All rights reserved.
1.
Introduction
The molecular mechanisms that underlie neuronal survival following stroke are important for the development of effective neuroprotective strategies. Under the conditions of ischemiareperfusion, the mechanisms of neuronal survival involve n
Corresponding author. Fax: þ86 216248999. E-mail address: [email protected] (R. Xie). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.brainres.2015.02.009 0006-8993/& 2015 Elsevier B.V. All rights reserved.
factors related to apoptosis, necrosis, and proliferation; the underlying molecular signaling pathways still need to be fully clarified and investigated. Tumor suppressor p53 is a well-documented transcription factor, which can bind to its response element (RE) and control the expression of target genes (Nagaich et al., 1997).
32
brain research 1605 (2015) 31–38
It has recently been reported that p53 possesses numerous novel functions independent of tumorigenesis. In addition to its effects on the metabolic regulation of adipocytes (Shimizu et al., 2012), liver (Kodama et al., 2011), beta cells (Hoshino et al., 2014), and other tissues, p53 has also been reported to be involved in cerebral ischemia (Chopp et al., 1992). Inhibition of p53 by p53 inhibitors may protect against cerebral ischemic-reperfusion injury (Crumrine et al., 1994; Culmsee et al., 2001). Considering the multiple and non-specific effects of p53 inhibitors, including their direct activity on subsequent downstream targets of p53, causing G0/G1 cell cycle arrest, and generating in vitro cell toxicity, it is necessary to determine whether a specific p53 inhibitor or overexpression would generate any effects against stroke. Furthermore, the underlying mechanisms of the regulatory roles of p53 in cerebral ischemia injury, independent of apoptosis, remain poorly understood. The mammalian target of rapamycin (mTOR) signaling pathway plays a central role in the regulation of metabolism, cell growth, development, and cell survival. Research, including our recent work, has demonstrated its contribution to the neuroprotective effects and benefits to neuronal survival (Pastor et al., 2009; Xie et al., 2012, 2014a). Interestingly, recent reports have shown that p53, which usually plays a critical role in sensing genotoxic and other stresses, is also an important regulator of mTOR (Feng et al., 2005; Galluzzi et al., 2010). p53 can directly or indirectly control the activity of mTOR, and there is extensive cross talk between them. p53 may behave like another tumor suppressor, Phosphatase and tensin homolog (PTEN), which is a negative regulator of mTOR, to inhibit the mTOR pathway in human fibrosarcoma cells (Demidenko et al., 2010). In addition, p53 has been identified to suppress medullary thyroid cancer progression by inhibiting mTOR pathway activation (Akeno et al., 2015). The activation of p53 due to energy deprivation or other external stresses not only inhibits mTOR activity to shut down the pathway but also results in the transient phosphorylation of the p53 protein (Feng et al., 2005). Thus, p53 and mTOR signaling components exhibit cross talk and coordinately regulate cell growth, proliferation, and death (Feng et al., 2005). p53 inhibits the mTOR pathway in a cell type-dependent manner, the related mechanism for which is still under investigation, particularly for ischemic and reperfusion neuronal injuries. To further clarify the role of p53 and the mTOR signaling pathway in the ischemic-reperfusion injury in neurons, we used mouse primary mixed neuronal cultures and an oxygen glucose deprivation model to mimic an ischemic-reperfusion injury in vitro. In addition, a lentiviral system was included to inhibit or overexpress p53 to determine whether p53 alternation could protect against the OGD and reperfusion injury in primary mixed cultured neurons and to determine its potential mechanism.
2.
Results
2.1. Activated p53 suppresses the expression of mTOR in primary mixed cultured neurons after OGD and reperfusion injury As previously described (Xie et al., 2014b), we used conditions of 6 h OGD followed by 4 h of simulated reperfusion to induce
significant LDH release in primary cultured neurons from C57 mice. After OGD and reperfusion, the LDH release was significantly increased (Fig. 1A), The expression of p53 was also induced upon the stress of OGD and reperfusion (Fig. 1B). However, the total protein level of mTOR, one of the molecular targets of p53 and an important factor involved in ischemia and reperfusion injury (Xie et al., 2014b), was decreased (Fig. 1B). These findings suggest a possible role for the p53-mTOR pathway in the regulation of ischemia and reperfusion injury in neurons.
2.2. Inhibition of p53 has protective effects in primary mixed cultured neurons, while p53 overexpression showed a trend to exaggerate the detrimental effects To determine whether activated p53 plays a role in ischemiareperfusion injury in neurons, the p53 inhibitor pifithrin-α (PFH) was used to block the transcriptional activity of p53 (Komarov et al., 1999). Primary cultured neurons were pretreated with different concentrations of PFH 24 h prior to OGD. The results suggest that PFH pre-treatment reduced the OGD and reperfusion-induced injury to neurons in a dosedependent manner, with significant effects occurring at a dose of 8 and 16 mM (Fig. 2A). Furthermore, in a time-course experiment, the results indicate that a PFH pre-treatment could reduce the LDH release associated with all the examined OGD durations (2–12 h) (Fig. 2B). Based on these findings, we further investigated whether directly blocking the expression of p53 could also protect neurons against ischemia. For this purpose, we used a lentiviralmediated system encoding p53 shRNA to infect neurons. As shown in Fig. 3, the mRNA and protein levels of p53 were both significantly downregulated after the neurons were infected (Fig. 3A, B). Furthermore, the LDH release after OGD and reperfusion was significantly decreased after the infection in primary mixed cultured neurons (Fig. 4A). In contrast with p53 shRNA delivery, a lentiviral-mediated system to overexpress p53
Fig. 1 – OGD and reperfusion injury induced p53 expression in primary mixed cultured neurons. A. Mouse brain primary mixed neurons were exposed to 6 h of OGD followed by 4 h of simulated reperfusion. After OGD and reperfusion, the LDH release was significantly increased in the OGD vs. the control group. **po0.01; n ¼ 12–16 per group. B. Representative western blot showing protein bands for p-mTOR, mTOR and p53 from primary mixed neurons with or without OGD and reperfusion.
brain research 1605 (2015) 31–38
Fig. 2 – PFH, a p53 inhibitor, had protective effects against OGD and reperfusion injury in primary mixed cultured neuron. A. PFH pre-treatment 24 h prior to OGD had protective effects in the form of reducing the LDH release in a dose-dependent manner. The concentration of 8 lM had the highest protective effect. **po0.01, vs. NO OGD; ##po0.01, vs. 0 lM PFH treatment; n ¼ 12–16 per group. B. primary mixed neurons were exposed to various periods of OGD, followed by 4 h of simulated reperfusion with or without PFH-alpha (8 lM). LDH release was measured and indicated a reduced LDH release for all treatment durations (2–12 h OGD), but the results were only significant for the 6 and 8 h durations of OGD between the PFH treatment and control groups. *po0.05; n ¼ 6–8 per group.
in neurons (Fig. 3A, C) caused an increase in LDH release after OGD and reperfusion, although the results did not reach statistical significance (Fig. 4B).
2.3. The mTOR signaling pathway is required for the protective effects of p53 inhibition in primary mixed cultured neurons To investigate whether the mTOR signaling pathway is involved in the mechanism of p53, we examined the expression of phosphorylated mTOR using Western blot analysis of primary mixed neurons infected with a lentivirus encoding either p53 shRNA or the p53 protein. The results showed that the levels of pmTOR were significantly downregulated after OGD and reperfusion, and the inhibition of p53 could reverse this effect (Fig. 5A). In contrast, pmTOR levels were downregulated by p53 overexpression compared to controls, although the results did not reach statistical significance (Fig. 5B). These results
33
Fig. 3 – The effects of lentiviral expression of p53 shRNA or p53 in primary mixed cultured neurons. A. Representative western blot results showed protein bands of p53 from primary mixed cultured neurons transfected with or without lentivirus encoding p53 shRNA or p53 for 48 h; the scramble shRNA and GFP groups were used as experimental controls. B, C. Q-PCR results showing the mRNA levels after infection with lentivirus encoding p53 shRNA (B) or p53 (C). *po0.05; n ¼6–8 per group.
Fig. 4 – Effects of p53 inhibition or overexpression in primary mixed neurons after OGD and reperfusion injury. Primary mixed neurons were transfected with lentivirus encoding p53 shRNA (A) or p53 (B) for 48 h, followed by OGD and reperfusion; the scramble shRNA and GFP groups were used as experimental controls. A. The LDH release after OGD and reperfusion was significantly decreased by p53 inhibition compared with the scrambled group. **po0.01, vs. NO OGD; ##po0.01, vs. scramble; n ¼8–10 per group. B. The LDH release after OGD and reperfusion was slightly increased by overexpression of p53 compared with the GFP group, but the results did not reach statistical significance. **po0.01, vs. NO OGD; n ¼8–10 per group.
suggest that the protective effects of p53 inhibition against OGD and reperfusion injury are related to pmTOR expression. To further determine whether the effects of p53 inhibition are dependent on the mTOR signaling pathway during ischemic
34
brain research 1605 (2015) 31–38
and reperfusion injury, we used the mTOR inhibitor rapamycin to pre-treat the primary neurons 24 h prior to OGD. The results showed that rapamycin (100 nM) significantly reduced the protective effects of p53 inhibition. Consistent with these findings, western blot results indicated that p53 inhibition resulted in the phosphorylation of mTOR, S6K and 4EBP1, while rapamycin treatment significantly decreased these levels and attenuated the protective effects of p53 inhibition (Fig. 6A). In contrast, the levels of phosphorylated mTOR, S6K and 4EBP1 were further downregulated by the rapamycin pre-treatment combined with p53 overexpression, although the results were not statistically significant. These findings suggest that the mTOR signaling pathway is required for the protective effects of p53 inhibition against ischemia-reperfusion injury in primary mixed cultured neurons.
3.
Discussion
For the present study, we examined the protective effects of p53 inhibition against OGD and reperfusion injury in cultured neurons via the mTOR pathway. In 1992, Chopp et al. first reported the expression of p53 in ischemic regions of brain; they found that p53 was expressed in brain regions of neuronal necrosis following a middle cerebral artery occlusion in rat and that the presence of p53 was associated with cell death after ischemia (Chopp et al., 1992). Furthermore, treatment with the p53 inhibitor PFH could also improve the
histological, motor and behavioral outcomes of ischemic stroke in mice (Leker et al., 2004). These studies provide evidence for a potential role of p53 in cerebral ischemic reperfusion injury. In this study, we used two different strategies to block the function of p53 in mixed cultured neurons, including the p53 inhibitor PFH and a lentivirus encoding for an shRNA against p53. Our results demonstrate that p53 inhibition provides protective effects against OGD and reperfusion injury in primary mixed cultured neurons. A number of apoptosis-related genes, including p21 and BAX, are transcriptionally regulated by p53. Several studies have also previously indicated that p53 regulates the process of ischemia reperfusion injury via apoptosis. Cheng et al. reported that inhibition of p53 and its downstream pro-apoptotic effectors is involved in the protective effects of activated protein C (APC) in hypoxic human brain endothelium (Cheng et al., 2003). The p53 inhibitor PFH may reduce the number of apoptotic cells in the ischemic brain by inhibiting the binding of p53 to its target DNA sites, as it reduced the expression of the p53-related gene p21 (WAF) (Leker et al., 2004). The activation of p53 has also been considered as one of the major inducers of apoptotic cell death after ischemic injury in renal cells (Dagher, 2004; Kelly et al., 2003). In addition to the regulation of apoptosis however, emerging evidence has suggested several apoptosis-independent functions for p53, including proliferation, cell survival, senescence, and other important functions (Di Giovanni and Rathore, 2012; Qian and Chen, 2013). The mTOR (mammalian target of rapamycin) protein kinase is one of the most important regulators of cell
Fig. 5 – p53 regulated mTOR expression in primary mixed neurons after OGD and reperfusion injury. Representative western blot results and bar graph of protein bands for mTOR from primary mixed neurons transfected with or without lentivirus encoding p53 shRNA (A) or p53 (B) for 48 h, followed with or without the indicated time of OGD and reperfusion. **po0.01, vs. NO OGD; ##po0.01, vs. scramble (p53 shRNA-); n ¼6–8 per group.
brain research 1605 (2015) 31–38
35
Fig. 6 – Rapamycin blocked the protective effects of p53 inhibition against OGD and reperfusion injury and showed a tendency to exacerbate the detrimental effects of p53 overexpression. Primary mixed neurons were infected with or without lentivirus encoding p53 shRNA (A, C) or p53 (B, D) for 48 h, with or without a pre-treatment of rapamycin for 24 h, followed with the indicated time of OGD and reperfusion. A. The rapamycin pre-treatment abolished the protective effects by p53 inhibition after OGD and reperfusion injury. **po0.01, vs. scramble (p53 shRNA); ##po0.01, vs. no rapamycin; n ¼6–8 per group. B. The rapamycin pre-treatment exaggerated the LDH release in mixed neurons with p53 overexpression after OGD and reperfusion injury, but the data did not reach statistical significance; n ¼ 6–8 per group. C,D. Representative western blot results and bar graph show protein bands for pmTOR, pS6K, and p4EBP1 in primary mixed neurons infected with or without lentivirus encoding p53 shRNA (C) or p53 (D) for 48 h, with or without a pre-treatment of rapamycin, followed by the indicated time of OGD and reperfusion. **po0.01, vs. scramble (p53 shRNA); ##po0.01, vs. p53 shRNA; n¼ 6–8 per group.
proliferation and survival. Our previous work has demonstrated that the mTOR signaling pathway plays an important role in the protective effects of post-conditioning (Xie et al., 2014b) and alpha-lipoic acid in ischemia reperfusion injury (Xie et al., 2012). Whether the protection of p53 inhibition against OGD and
reperfusion injury acts through the mTOR pathway in ischemia and reperfusion injury requires further investigation. mTOR is known as the central node of nutrient and growth factor signaling, while p53 plays a critical role in sensing genotoxic and other stresses. It has been reported
36
brain research 1605 (2015) 31–38
that p53 and mTOR signaling machineries exhibit cross talk that coordinately regulates cell growth, proliferation, and death. For example, Akeno demonstrated that the suppression of carcinoma progression by p53 occurred through inhibiting mTOR pathway activation (Akeno et al., 2015). Additionally, several p53 transcriptional targets, including AMPK, TSC2, PTEN, IGF-BP3 and sestrins, may inhibit the activation of the mTOR pathway. It should be noted that p53 may also cause the cleavage and/or inactivation of eIF4G, eIF4B, eIF4E, and eIF4F, thereby inhibiting protein synthesis downstream of mTOR signaling. Our results show that an in vitro OGD and reperfusion injury results in an increase in the expression of p53 and suppresses the phosphorylation of mTOR and its downstream effectors (S6K, 4EBP). The decrease in phosphorylated mTOR, S6K and 4EBP1 levels could be upregulated by p53 inhibition, and the protective effects of the p53 inhibition were abolished by rapamycin, a mTOR inhibitor. These results suggest that mTOR is required for the regulation of p53 in ischemia injury. Conversely, p53 overexpression tended to exacerbate the detrimental effects induced by OGD and reperfusion in primary neurons and downregulated the activity of the mTOR pathway. While the data did not reach statistical significance, a possible reason could be that the 6 h OGD followed by reperfusion had already induced a severe neuronal injury that could not be further promoted. The detrimental effects could become significant if the OGD and reperfusion duration is adjusted. Regardless, our results suggest that p53 overexpression enhances OGD and reperfusion injury and downregulates mTOR activity, in contrast with p53 inhibition. These data reveal the potential mechanism of p53 in ischemic and reperfusion injury in cultured neurons. In conclusion, the present study suggests that p53 inhibition provides pivotal protective effects against OGD and reperfusion injury in primary mixed cultured neurons and that mTOR is required for the protective effects of p53 inhibition. As depicted in Fig. 7, p53 and mTOR play coordinated roles in the process of ischemic and reperfusion neuronal injury, which may provide a promising target for stroke-related therapies.
4.
Experimental procedures
4.1.
Construction of lentiviral vectors
Fig. 7 – A diagram of the p53/mTOR signaling pathway in ischemic and reperfusion injury in neurons.
4.2.
We used a three plasmid system for lentiviral packaging as detailed in our previous study, which included the lentiviral transfer vector (pHR'tripCMV- IRES-eGFP) containing the coding region of the targeted genes or p53/scramble shRNA, the packaging plasmid (p-delta) that provides all vector proteins driven by the trip CMV promoter (except the envelope protein) and the envelope-encoding plasmid (p-VSVG) that encodes the heterologous vesicular stomatitis virus envelope protein VSVG (Hu et al., 2011). In brief, a mixture of 45 μg of the transfer vector, 30 μg of the packaging plasmid and 15 μg of the envelope-encoding plasmid were transiently transfected into three T175 flasks containing 1.5 107 HEK-293 T cells using the calcium phosphate precipitation (CPP) method. Supernatants were collected 72 h post-transfection and viral particles were concentrated by ultracentrifugation. Viruses were resuspended in phosphate-buffered saline (PBS) and kept at 80 1C until use. The virus particles were titered with the TCID50 method as previously described (Apolonia et al., 2007; Breckpot et al., 2003). Virus titers ranged from 1 108– 5 108 TU/ml and were diluted in PBS to a final concentration of 1 108 TU/ml before gene transfer was conducted.
4.3.
We used lentiviral vectors containing p53 shRNA (p53shRNA: 12089, Addgene, Cambridge, MA) to inhibit p53 expression, and a scrambled shRNA (Scramble shRNA: 1864, Addgene, Cambridge, MA) as a control. For overexpression, the p53 cDNA was cloned from the plasmid (p53: 12136, Addgene, Cambridge, MA) into the lentiviral backbone plasmid, pHR'tripCMV-IRES-eGFP, which contains a CMV promoter and an IRES sequence between its multiple cloning site (MCS) and eGFP as previously described (Xie et al., 2013). The IRES sequence enables independent expression of both the target gene and the eGFP simultaneously. A lentiviral plasmid backbone containing only eGFP was used as a control vector.
Lentiviral vector generation and titration
Cell culture
Primary mixed neuronal cultures were prepared using timedpregnant C57 mice (E18, Model Animal Research Center of Nanjing University, China). Briefly, mice were anesthetized with isoflurane and the E18 embryos were removed. The cortical region of the fetal brains was dissected in warm media and pooled together. The cortices were titrated and incubated in papain solution (10 U/ml, Sigma, St. Louis, MO, USA) for 20 min at 37 1C, then centrifuged at 1500 rpm for 5 min at room temperature (RT). The cells were resuspended in minimal essential medium (MEM) (Gibco, Grand Island, NY, USA) containing 10% fetal horse serum (Hyclone, Logan, UT, USA), 2 mmol/L glutamine (Gibco), 25 mM glucose, 1% penicillin/streptomycin (Gibco). Cells were plated onto poly-D-lysine-coated tissue
37
brain research 1605 (2015) 31–38
culture plates at 7.5 105 cells/ml. Media was completely changed after 24 h. One-half medium changes were performed at day 4. Cultures were incubated at 37 1C in a 5% CO2 incubator and experiments were performed day 9–11.
4.4. In vitro drug delivery, gene transfer, oxygen glucose deprivation (OGD) model and cell viability assay The p53 inhibitor pifithrin-α (PFH) (Sigma) or rapamycin (Calbiochem, Billerica, MA, USA) were added to the cell cultures at the indicated concentrations, and the same amount of vehicle was added as a control 24 h before OGD induction. A control group without OGD was also included. To study the effects of p53 shRNA and p53 cDNA vectors on neuronal injury, the lentiviral vectors, diluted with PBS to 5 ml for 24-well plates and to 10 ml for 6-well plates were directly added into the medium of 9 day primary mixed neuron cultures, with the multiplicity of infection (MOI) at 1:5 (cells: virus units). The same amount of PBS was also added to the medium as an experimental control. The cells were then incubated at 37 1C in a 5% CO2 incubator for another 2 days before OGD was conducted. To induce in vitro ischemia, primary mixed neuron cultures were washed twice with glucose-free balanced salt solution (BSS0, pH 7.4) and the plates were transferred to a modular hypoxic chamber filled with mixed gases of 5% CO2 and 95% N2. The oxygen level was maintained at o0.02% at 37 1C. The cells were kept in the hypoxic chamber for 6 h. Cultures were then restored with glucose to a final concentration of 5.5 mM (BSS5.5, pH 7.4) and recovered at normoxic conditions (37 1C, 5% CO2) for 18 h (OGD restoration). The control group without OGD was washed twice with 5.5 mM glucose in balanced salt solution (BSS5.5, pH 7.4). Cell viability was quantified by measuring lactate dehydrogenase (LDH) release at 18 h after OGD restoration using a previously described colorimetric assay (Dugan et al., 1995). Briefly, 100 μl of cell-free supernatant was transferred to 96well plates. The supernatant was incubated with 150 μl of NADH/phosphate buffer (0.15 mg/mL) for 10 min. Then, 30 μl of sodium pyruvate (2.97 mg/mL) was added, and the absorbance wavelength was measured at 340 nm using a microplate reader. Background absorbance was subtracted and the percentage of LDH release was calculated based on an LDH standard curve.
0.5 μg total RNA by reverse transcription using an ImProm-II reverse transcription kit (Promega) with random hexamer primers. Quantitative real-time PCR was performed using the SYBR Green QPCR system (Qiagen) with specific primers for p53 (forward: 50 ACTGCATGGACGATCTGTTG 30 ; reverse 50 GTGACAGGGTCCTGTGCTG 30 ). The PCR reactions were performed using an Applied Biosystems Prism 7000 sequence detection system. The level of target gene expression was normalized against the GAPDH gene.
4.6.
Western blot analysis
The mixed neuronal cultures were grown in 6-well plates and harvested 48 h after the indicated treatments, and proteins were extracted for Western blotting. The cells were harvested 48 h after gene transfer and homogenized in the cold cell extraction buffer containing 1 mM PMSF (Sigma) and the protease inhibitor cocktail (Sigma). The homogenate was centrifuged at 13000 rpm for 20 min at 4 1C, and the supernatant was removed for protein detection. Protein concentrations were measured using the Bradford assay (Sigma). For the western blot, 20 mg of protein in each lane was subjected to SDS-PAGE using 4–15% Ready Gel (catalog #L050505A2; Bio-Rad, Hercules, CA) at 200 V for 45 min. Protein bands were transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA) at 100 V for 2 h. The membranes were incubated with primary antibodies overnight at 4 1C followed by Alexa Fluor 488 donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5000, Invitrogen, Eugene, OR, USA) for 1 h in the dark room. The manufacturers, catalog numbers, and applications for all primary antibodies are listed in Table 1. The membranes were scanned using a Typhoon trio imager (GE Healthcare). The optical densities of all protein bands were analyzed using IMAGEQUANT 5.2 software (GE Healthcare).
4.7.
Statistical analysis
Statistical Analysis GraphPad Prism 5.0 software was used for statistical analyses. The results were analyzed using a one way or two way ANOVA followed by the Fisher least significant difference post hoc test. Tests were considered significant at P values o0.05. Data are presented as the mean7SEM.
Author contributions 4.5.
Quantitative real-time PCR
Total RNA was extracted from primary mixed neurons using TRIzol reagent (Invitrogen), and cDNA was synthesized from
R.L. and X.L. designed the research; X.L., S.G., Y.L., C.S., X.C., and R.X. performed experiments; X.L., S.G., and R.X. analyzed the data; R.X. and X.L. wrote the paper.
Table 1 – Antibodies, concentrations and manufacturers used. Antibodies
Source
Dilutions
Manufacturer
Catalog#
p53 P-mTOR (Ser2448) mTOR P-S6K p70 (Ser371) P-4EBP1 β-actin
mouse Rabbit Rabbit Rabbit Rabbit Mouse
1:2500 1:200 1:1000 1:500 1:500 1:3000
Cell signaling Cell signaling Cell signaling Cell signaling Cell signaling Sigma
2524 2971 2983 9208 9456 A-5441
38
brain research 1605 (2015) 31–38
Conflict of interest The authors declare no conflicts of interest.
Funding This study was fully supported by the following grants: National Natural Science Foundation of China (81200890, R.X.), Scientific Research Foundation of Shanghai Municipal Commission of Health and Family Planning (20134238, R.X.), Natural Science Foundation of Shanghai (15ZR1406600, X.L.).
references
Akeno, N., Miller, A.L., Ma, X., Wikenheiser-Brokamp, K.A., 2015. p53 suppresses carcinoma progression by inhibiting mTOR pathway activation. Oncogene 34 (5), 589–599. Apolonia, L., Waddington, S.N., Fernandes, C., Ward, N.J., Bouma, G., Blundell, M.P., Thrasher, A.J., Collins, M.K., Philpott, N.J., 2007. Stable gene transfer to muscle using non-integrating lentiviral vectors. Mol. Ther. 15, 1947–1954. Breckpot, K., Dullaers, M., Bonehill, A., van Meirvenne, S., Heirman, C., de Greef, C., van der Bruggen, P., Thielemans, K., 2003. Lentivirally transduced dendritic cells as a tool for cancer immunotherapy. J. Gene Med. 5, 654–667. Cheng, T., Liu, D., Griffin, J.H., Fernandez, J.A., Castellino, F., Rosen, E.D., Fukudome, K., Zlokovic, B.V., 2003. Activated protein C blocks p53-mediated apoptosis in ischemic human brain endothelium and is neuroprotective. Nat. Med. 9, 338–342. Chopp, M., Li, Y., Zhang, Z.G., Freytag, S.O., 1992. p53 expression in brain after middle cerebral artery occlusion in the rat. Biochem. Biophys. Res. Commun. 182, 1201–1207. Crumrine, R.C., Thomas, A.L., Morgan, P.F., 1994. Attenuation of p53 expression protects against focal ischemic damage in transgenic mice. J. Cereb. Blood Flow Metab. 14, 887–891. Culmsee, C., Zhu, X., Yu, Q.S., Chan, S.L., Camandola, S., Guo, Z., Greig, N.H., Mattson, M.P., 2001. A synthetic inhibitor of p53 protects neurons against death induced by ischemic and excitotoxic insults, and amyloid beta-peptide. J. Neurochem. 77, 220–228. Dagher, P.C., 2004. Apoptosis in ischemic renal injury: roles of GTP depletion and p53. Kidney Int. 66, 506–509. Demidenko, Z.N., Korotchkina, L.G., Gudkov, A.V., Blagosklonny, M.V., 2010. Paradoxical suppression of cellular senescence by p53. Proc. Natl. Acad. Sci. USA 107, 9660–9664. Di Giovanni, S., Rathore, K., 2012. p53-Dependent pathways in neurite outgrowth and axonal regeneration. Cell Tissue Res. 349, 87–95. Dugan, L.L., Bruno, V.M., Amagasu, S.M., Giffard, R.G., 1995. Glia modulate the response of murine cortical neurons to excitotoxicity: glia exacerbate AMPA neurotoxicity. J. Neurosci. 15, 4545–4555. Feng, Z., Zhang, H., Levine, A.J., Jin, S., 2005. The coordinate regulation of the p53 and mTOR pathways in cells. Proc. Natl. Acad. Sci. USA 102, 8204–8209.
Galluzzi, L., Kepp, O., Kroemer, G., 2010. TP53 and MTOR crosstalk to regulate cellular senescence. Aging 2, 535–537. Hoshino, A., Ariyoshi, M., Okawa, Y., Kaimoto, S., Uchihashi, M., Fukai, K., Iwai-Kanai, E., Ikeda, K., Ueyama, T., Ogata, T., Matoba, S., 2014. Inhibition of p53 preserves Parkin-mediated mitophagy and pancreatic beta-cell function in diabetes. Proc. Natl. Acad. Sci. USA 111, 3116–3121. Hu, Q., Chen, C., Khatibi, N.H., Li, L., Yang, L., Wang, K., Han, J., Duan, W., Zhang, J.H., Zhou, C., 2011. Lentivirus-mediated transfer of MMP-9 shRNA provides neuroprotection following focal ischemic brain injury in rats. Brain Res. 1367, 347–359. Kelly, K.J., Plotkin, Z., Vulgamott, S.L., Dagher, P.C., 2003. P53 mediates the apoptotic response to GTP depletion after renal ischemia-reperfusion: protective role of a p53 inhibitor. J. Am. Soc. Nephrol. 14, 128–138. Kodama, T., Takehara, T., Hikita, H., Shimizu, S., Shigekawa, M., Tsunematsu, H., Li, W., Miyagi, T., Hosui, A., Tatsumi, T., Ishida, H., Kanto, T., Hiramatsu, N., Kubota, S., Takigawa, M., Tomimaru, Y., Tomokuni, A., Nagano, H., Doki, Y., Mori, M., Hayashi, N., 2011. Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice. J. Clin. Invest. 121, 3343–3356. Komarov, P.G., Komarova, E.A., Kondratov, R.V., Christov-Tselkov, K., Coon, J.S., Chernov, M.V., Gudkov, A.V., 1999. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science 285, 1733–1737. Leker, R.R., Aharonowiz, M., Greig, N.H., Ovadia, H., 2004. The role of p53-induced apoptosis in cerebral ischemia: effects of the p53 inhibitor pifithrin alpha. Exp. Neurol. 187, 478–486. Nagaich, A.K., Appella, E., Harrington, R.E., 1997. DNA bending is essential for the site-specific recognition of DNA response elements by the DNA binding domain of the tumor suppressor protein p53. J. Biol. Chem. 272, 14842–14849. Pastor, M.D., Garcia-Yebenes, I., Fradejas, N., Perez-Ortiz, J.M., Mora-Lee, S., Tranque, P., Moro, M.A., Pende, M., Calvo, S., 2009. mTOR/S6 kinase pathway contributes to astrocyte survival during ischemia. J. Biol. Chem. 284, 22067–22078. Qian, Y., Chen, X., 2013. Senescence regulation by the p53 protein family. Methods Mol. Biol. 965, 37–61. Shimizu, I., Yoshida, Y., Katsuno, T., Tateno, K., Okada, S., Moriya, J., Yokoyama, M., Nojima, A., Ito, T., Zechner, R., Komuro, I., Kobayashi, Y., Minamino, T., 2012. p53-induced adipose tissue inflammation is critically involved in the development of insulin resistance in heart failure. Cell Metab. 15, 51–64. Xie, L., Sun, F., Wang, J., Mao, X., Xie, L., Yang, S.H., Su, D.M., Simpkins, J.W., Greenberg, D.A., Jin, K., 2014a. mTOR signaling inhibition modulates macrophage/microglia-mediated neuroinflammation and secondary injury via regulatory T cells after focal ischemia. J. Immunol. 192, 6009–6019. Xie, R., Li, X., Ling, Y., Shen, C., Wu, X., Xu, W., Gao, X., 2012. Alpha-lipoic acid pre- and post-treatments provide protection against in vitro ischemia-reperfusion injury in cerebral endothelial cells via Akt/mTOR signaling. Brain Res. 1482, 81–90. Xie, R., Cheng, M., Li, M., Xiong, X., Daadi, M., Sapolsky, R.M., Zhao, H., 2013. Akt isoforms differentially protect against stroke-induced neuronal injury by regulating mTOR activities. J. Cereb. Blood. Flow Metab. 33, 1875–1885. Xie, R., Wang, P., Cheng, M., Sapolsky, R., Ji, X., Zhao, H., 2014b. Mammalian target of rapamycin cell signaling pathway contributes to the protective effects of ischemic postconditioning against stroke. Stroke 45, 2769–2776.
