In?. J . Cancer: 46, 394-398 (1990) 0 1990 Wiley-Liss, Inc.

Publication of the International Union Against Cancer Publication de I’Union lnternationale Contre 18 Cancer

PARATHYROID HORMONE-RELATED PROTEIN AND HYPERCALCEMIA IN PANCREATIC NEURO-ENDOCRINE TUMORS R. RIZZOLI~.~, A.P. S A P P I Nand ~ 1.-P. BONJOUR’ ‘Division of Clinical Pathophysiology and 2Division of Oncology, Depament of Medicine, University Hospital of Geneva, CH-1211 Geneva 4 . Switzerland. We investigated the possible involvement of parathyroid hormone-related protein (PTHrP) in 2 cases of metastatic pancreatic neuro-endocrine tumors associated with severe hypercalcemia. Both patients displayed biochemical alterations in renal tubular reabsorptionof calcium and phosphate, as well as in urinary CAMP excretion, similar to those encountered in primary hyperparathyroidism, although plasma levels of parathyroid hormone were within the normal range. Tumor protein extracts stimulated CAMP production, which was inhibited by the PTH-antagonist(&I6 Nle, 34 Tyr)bPTH(3-34)amide, in the PTH-responsive osteoblastic cell line UMR- 106. Northern blot analysis of tumor extracts revealed the presence of PTHrP mRNA transcripts, while PTH mRNA was undetectable. In contrast, neither PTHrP mRNA(s) nor CAMP-stimulating activity was detectable in other neuroendocrine tumors not accompanied by hypercalcemia. These results demonstrate that certain pancreatic neuroendocrine tumors associated with hypercalcemia can synthesize and release PTHrP.

Neuro-endocrine tumors are known to synthesize and release a large variety of biologically active substances or hormones, which may be responsible for different paraneoplastic syndromes (Friesen, 1982). However, hypercalcemia which is a frequent complication of many tumors has rarely been reported in the course of pancreatic neuro-endocrine tumors (Myers, 1960; DeWys et al., 1973; Singer et al., 1979; Fisken et al., 1980; Skrabanek et al., 1980; Friesen, 1982; Rasbach and Hammond, 1985; Kvols et al., 1987). Among factors implicated in the pathogenesis of malignant hypercalcemia, a parathyroid hormone-related protein (PTHrP) has been recently characterized (Moseley et al., 1987; Martin et al., 1988; Broadus et al., 1988; Goltzman et al., 1989). The aminoterminal portion of this substance, which is a product of a gene related, but distinct from that of PTH, shares structural and functional homology with the native hormone. Indeed, PTHrP displays a very similar spectrum of actions both in vitro and in vivo (Horiuchi et al., 1987; Kemp etal., 1987; Broadus et al., 1988; Martin et al., 1988; Pizurki et al., 1988; Rodan et al., 1988; Stewart e t a l . , 1988; Yates etal., 1988; Goltzman et al., 1989; Rizzoli et al., 1989). It can be synthesized not only by squamous-cell carcinomas, renal and breast cancers, but also by non-tumoral tissue such as keratinocytes, rat lactating mammary glands and brain (Merendino et al., 1986; Ikeda et al., 1988a,b; Thiede and Rodan, 1988; Danks et al., 1989; Weir et al., 1990). We now describe 2 cases of neuroendocrine tumors of the prancreas, associated with hypercalcemia, hypophosphatemia, increased tubular reabsorption of calcium and decreased tubular reabsorption of phosphate, features usually encountered in primary hyperparathyroidism. We demonstrate the expression of PTHrP mRNA(s) in both tumors, while PTH mRNA was undetectable. SUBJECTS AND METHODS

Patient history Case 1. Following a 6-month history of progressive fatigue and weight loss, a large abdominal mass was discovered in a 30-year-old man. A plasma calcium value of 2.75 m had been noticed 2 years earlier, during an episode of infectious diar-

rhea, but was not further investigated. Clinical examination revealed an enlarged liver with splenomegaly . Computerized tomography examination demonstrated the presence of a tumoral mass of 8 cm diameter in the tail of the pancreas, with multiple liver metastases and portal hypertension. The bone scintigram was normal. Biochemical studies showed hypercalcemia and hypophosphatemia (Table I). The patient was treated with 2 infusions of the bone resorption inhibitor aminohydroxybutane diphosphonate (ABDP, 7.5 mg, kindly provided by Dr s. Rosini, Instituto Gentili, Pisa, Italy) at a 3-day interval (Bonjour et al., 1984; Rizzoli et al., 1988). The patient then underwent surgical exploration, and a subtotal splenopancreatectomy together with a partial hepatectomy were performed. The extent of the tumor prevented its complete removal. After surgery, a transient normalization of calcemia occurred (Fig. l), but hypercalcemia relapsed 6 weeks later. This responded to a second administration of diphosphonate. Immunohistochemistry performed on the pancreatic tumor and the liver metastases showed features of neuroendocrine differentiation i . e . , neurone-specific enolase and chromogranin A immunoreactivity . Case 2 . A 60-year-old woman was investigated for a large liver mass, accompanied by minimal general symptoms. An abdominal computerized tomography examination showed a large mass at the head of the pancreas, and several voluminous masses in the liver. Biopsy performed during a laparotomy revealed a neuro-endocrine tumor. On a bone scintigram, increased tracer uptake in the skull and sternum was noticed. Biochemical analysis showed severe hypercalcemia and signs of hyperosteolysis. Osteolysis was normalized by one 600-mg infusion of the diphosphonate clodronate; plasma Ca decreased, but remained above the normal range. A treatment of alpha interferon was introduced (3 million IU, 5 days per week) and maintained for 8 months, during which 4 episodes of hypercalcemia occurred, which responded to intravenous administration of ABDP. Plasma Ca increased progressively, despite a marked reduction in fasting urinary Ca excretion induced by several courses of ABDP. One of these treatments, which was given 11 months after the first diphosphonate infusion, is presented in Figure 1 and Table I. Hypercalcemia then became resistant to treatment and the patient died 1 year after the first episode of hypercalcemia and 7 weeks after the hypercalcemic episode presented in Figure 1. Post-mortem examination confirmed the presence of a pancreatic neuroendocrine tumor with multiple liver metastases, and showed bilateral nephrocalcinosis, as well as osteitis fibrosa. In neither case, was there any family history or biochemical feature suggestive of multiple endocrine neoplasia.

3To whom correspondence and reprint requests should be addressed. Abbreviations: F’THrP, parathyroid hormone-relatedprotein; PTH, parathyroid hormone; ABDP, aminohydroxybutane diphosphonate.

Received: March 29, 1990 and in revised form May 1 1 , 1990.

395

PTHrP IN PANCREATIC NEURO-ENDOCRINE TUMORS TABLE I - BIOCHEMICAL EVALUATION IN 2 PATIENTS WITH NEURO-ENDOCRINE TUMOR OF THE PANCREAS AND HYPERCALCEMIA

0 4 8' 0 5

Patient 1 Patient 2

3.52 0.6 95 2.88 0.5 92 2.20 ND 103 3.59 0.7 113 3.32 ND 102 2.25-2.62 0.80-1.30 53-115

Normal range

61 ND 63 75 ND 60-135

0.87 ND 1.37 ND ND 1-6

50.8

ND 15.9 22.9 ND 6-13.5

1.07 0.42

3.50 0.34 3.11 0.37 ND ND ND 2.80 2.98 0.38 0.99 3.30 ND 0.10-0.50 2.40-2.88 0.80-1.30

81.9 ND 41.4 115.4

ND 27-45

Plasma and urine were collected after overnight fast. The indices of tubular reabsolption were calculated as described in "Subjects and Methods". 'These values were collected 2 days after partial tumor resection (performed on day 6 after the fmst administration of ABDP). ND: not determined.-2Aminohydroxybutane diphosphonate. -3Tubular reabsorption of calcium inde~.-~Renal tubular phosphonrs threshold.

Plasma Ca

-1

2 E

+

3.0

Patient 1 Patient 2

v)

C 2.5

a

2

. -

0 5

1 -

3

.

,

-

1

.

,

.

1

, 3

.

, 5

.

, 7

.

,

~

9

Days

Fasting urinary Ca

I

\

+Patient 1 -a. Patient 2

centrifugation (Sappino et al., 1987). For Northern blot analysis, RNAs were denatured in glyoxal, electrophoresed in 1.5% agarose gels, and transferred overnight onto Gene Screen Plus membrane (NEN, Boston, MA). PTHrP (CGTCGCCTCTGAC CAAGTC GTCACCTCGCA) (Suva et al., 1987) and PTH (CGTAGTCGATGATTGTATGGAC TTGCTTCT) (Hendy et al., 1981) oligonucleotides, complementary to a pre-pro-sequence of both peptides, were synthesized by the P-cyanoethylamidite method (Pharmacia Gene Assembler, (speUppsala, Sweden). They were labelled with Y(~~P)-ATP cific activity 5000 Cilmmol) with 5 U of polynucleotide kinase (Sgaramella and Khorana, 1972; Berdoz et al., 1987). pSP65 alpha-actin, containing the 320 bp Ava 11-Bgl I1 fragment, was transcribed in vitro which hybridizes to all actin -As, using SP6 RNA polymerase, in the presence of 100 pCi Y(~~P)-GTP (400 Ci/mmol). For PTHrP, pre-hybridization and hybridization were performed at 56°C in 5 X SSC (SSC is standard saline citrate (0.15 M sodium chloride: 0.015 M sodium citrate, PH 7.4)). Post-hybridization washes were performed at 56°C in 3 X SSC and 1 X SSC in the presence of 20% SDS. The same procedure was followed for PTH, but at 54°C.

Adenylate-cyclase-stimulatingactivity in tumor extract Tumor tissues were extracted with 8 M urea, 0.2 N HCl, 0.1 M cysteine as described by Stewart et al. (1983). After over- 5 - 3 - 1 1 3 5 7 9 night dialysis against distilled water, tumor extracts were lyDays ophilized and taken up into the intact-cell adenylate cyclase FIGURE1 - Plasma Ca (upper panel) and fasting urinary Ca excre- assay buffer which contained 0.9 m~ Ca, 1 m~ Mg, 0.1% tion (lower panel) in response to an intravenous infusion of aminohy- glucose, 0.1% BSA, 20 m~ HEPES (PH 7.4) in Dulbecco's droxybutane diphosphonate. Shaded areas indicate normal ranges. modified phosphate-buffered saline. Adenylate-cyclasestimulating activity was analyzed by measuring the production of [3H]-cAMPin the osteoblast-like cell line UMR-106 (kindly Cases 3 , 4 , 5 . Three neuro-endocrine tumors of the pancreas provided by Dr T.J. Martin, Melbourne, Australia). Briefly, not accompanied with hypercalcemia were also studied. confluent UMR-106 cells, plated in 24-well culture dishes were incubated with [3H]-adenine (1.2 p,Ci/well) in minimal Biochemical investigations essential medium (MEM) with 2% FCS for 2 hr. The medium Plasma PTH was measured using a mid-region (Baxter, was discarded; the cells were washed with MEM and incubated Diidingen, Switzerland) and an intact-molecule (Nichols, with 150 c1.1 of 1 m~ isobutylmethylxanthine (IBMX) in the Geneva, Switzerland) assay (interassay variation was 7 and above mentioned buffer for 10 min at 37°C. Tumor extracts 11%, respectively). Plasma osteocalcin was determined by ra- (300 p1) with or without 0.5 W M of (8,18 Nle, 34 Tyr)bPTH(3dio-immunoassay using a kit from CIS-ORIS (Gif-sur-Yvette, 34)amide were then added to the cells for 10 min. The reaction France). Urinary CAMP was measured by radio-immunoassay was terminated by aspirating the medium, chilling the cell (Incstar, Stillwater, MN). Bone resorption was evaluated by layers and adding 2 X 0.5 m l 5 % TCA containing 2 m~ AMP, the Ca-to-creatinine ratio in fasting urine (Kanis er al., 1980). CAMP, ATP and adenosine. [3H]-cAMP was isolated with seTubular reabsorption of Ca was evaluated using an index quential chromatography on Dowex and alumina (Salomon, (TRCaI) relating fasting urinary excretion to plasma Ca (Bon- 1979). Recovery, measured by adding -3000 cpm [14C]jour et d . , 1988). Maximum tubular reabsorption of phosphate CAMP, was between 65 and 90%. (TmPilGFR) was determined according to Bijvoet el al. (1969). Chemicals RNA extraction and hybridization (8,18 Nle, 34Tyr)bPTH(3-34)amide was from Sigma (St. Total RNA was extracted from normal and tumoral tissues Louis, MO). Radioisotopes were from NEN. Culture media by the guanidine-thiocyanate method and CsCl gradient ultra- were from Gibco (Basel, Switzerland).

396

RIZZOLI ET A L .

Statistics Results are expressed as mean -+ SEM. Significance of differences was evaluated using a 2-tailed t-test. RESULTS

As shown in Table I, patients 1 and 2 presented biochemical features of primary hyperparathyroidism. Indeed, before any specific anti-osteolytic therapy, but after full rehydration, hypercalcemia and hypophosphatemia were associated with increased bone resorption and typical changes in the renal tubular reabsorption of Ca and Pi. Tubular reabsorption of Ca, evaluated by the index TRCaI, was increased, and TmPi/GFR was decreased. Serum osteocalcin, a marker of bone turnover known to be increased in primary hyperparathyroidism, was also high (Delmas et al., 1986). However, in spite of marked enhancement of urinary CAMP excretion, serum parathyroid hormone levels were low. The response to administration of the bone resorption inhibitor aminohydroxybutane diphosphonate (ABDP) is presented in Figure 1. ABDP was given intravenously over a 4-hr period on day 0 (arrow, Fig. 1). Patient 1 received 7.5 mg on days 0 and 3, whereas patient 2 received 25 mg on day 0. Fasting urinary Ca excretion, taken as a reflection of net bone resorption, was normalized (patient 1) or markedly decreased (patient 2) after ABDP treatment. However, plasma Ca remained far above the upper limit of the normal range (day 3 to 5 after the first ABDP infusion). This response strongly suggested an increase in renal tubular reabsorption of Ca, which was confirmed by an elevation in TRCaI. The humoral origin of this syndrome was further supported by the fall in plasma Ca and in urinary cAMP excretion after resection of a large piece of tumor in patient 1, performed on day 6 after ABDP administration (Table I). We then assessed whether tumor protein extracts contained any factor(s) stimulating cAMP production in the PTHresponsive osteoblast-like cell line UMR- 106. Tumor extracts from patients 1 and 2 stimulated CAMPproduction, through a mechanism involving FTH-receptors, since the stimulation was blunted by the specific PTH-antagonist (8,18 Nle, 34Tyr)bPTH(3-34)amide (Table 11). In contrast, tumor extracts from two eucalcemic patients, 3 and 4, did not contain any adenylate cyclase stimulating activity. Tumoral tissues were explored for the presence of the newly described PTHrP. Total RNA(s) extracted from tumoral tissues were analyzed with a specific PTHrP oligonucleotide probe (Fig. 2, middle panel) which revealed the presence of hybridizing transcripts, establishing the expression of PTHrP mRNA(s) in both tumors. In contrast, PTHrP transcripts could not be detected in the total RNA(s) extracted from 3 other pancreatic neuro-endocrine tumors not accompanied by hypercalcemia. Interestingly, abundant PTHrP mRNA(s) were found in a parathyroid adenoma, but not in parathyroid hyperplasia, as already reported (Ikeda et al., 19886). PTH mRNA was detected in both parathyroid tissues, but not in the other tu-

FIGURE2 - Northern blot analysis of total RNA. Arrows represent the position of the 18 S rRNAs. Lane L, normal bronchial tissue; lane H, parathyroid hyperplasia; lane A, parathyroid adenoma; lane B, BEN cells; lane P, normal pancreatic tissue; lane 1, patient 1; lane 2 , patient 2; lane 3, patient 3; lane 4,patient 4;lane 5 , patient 5 .

moral or non-tumoral specimens (Fig. 2, upper panel). This confirmed the specificity of our hybridizations. Similar results were obtained with a specific human PTHrP cRNA probe (data not shown). Finally, the pattern of actin hybridization confirmed the integrity of the RNAs analyzed (Fig. 2, lower panel). DISCUSSION

Both pancreatic tumors displayed features of neuro-endocrine differentiation as indicated by conventional histology, positive neuron-specific enolase and chromogranin A immunostaining. Patients 1 and 2 presented a biochemical syndrome similar to primary hyperparathyroidism. Moreover, as in primary hyperparathyroidism, increased renal tubular reabsorption of Ca played a prominent role in the pathogenesis of the hypercalcemia, as demonstrated by the elevated TRCaI and the partial hypocalcemic response to the administration of a specific bone-resorption inhibitor. However, serum levels of PTH were not increased, and the search for PTH mRNA in tumor extracts remained negative. Similar biochemical features have been reproduced in animals bearing a PTHrP-producing tumor or infused with PTHrP itself (Rizzoli er al., 1986, 1989). Finally, tumor extracts of the 2 hypercalcemic patients contained PTHrP transcripts. One or more hybridizing transcripts were

TABLE U - ADENYLATE-CYCLASE-STIMULATINGACTIVITY IN TUMOR EXTRACTS cAMP production in U M R 106 cells (% of basal activity)

(8,18Nle,34Tyr)bPTH(3-34)A (0.5 pmoV1) -

+ ~~~~

Controls

Patient 1

Patient 2

100 ? 5 115 f 4

550 k 23’ 260 t lo2

820 2 21’ 530 t 212

Patient 3

Patient 4

97

109 2 5

? 4 99 t 3

106

*4

~

The values are means 5 SEM of quadruplicate determinations (n = 8-12 for the controls). Tumors were extracted as described in “Subjects and Methods”. Lyophilized material was taken up into the buffer assay. UMR 106 cells were incubated with this extract at 37°C for 10 min in the presence of 1 m~ IBMX.-’p < 0.001 as compared with controls.-’p < 0.001 as compared with tumor-exbact-induced stimulation.

PTHrP IN PANCREATIC NEURO-ENDOCRINE TUMORS

visualized in patients 1 and 2 , which were compatible with the size of the 2 major PTHrP transcripts identified in the squamous-cell carcinoma BEN cell line (Fig. 2, lane B), from which PTHrP was first isolated (Moseley et al., 1987; Suva et al., 1987) and in other cells (Mangin et al., 1988; Thiede et al., 1988). The low intensity of the signal, which could be attributed to the heterogeneity of the tumoral tissue and/or to the fact that total RNA(s) was analyzed, precluded a more detailed analysis. PTHrP mRNA(s) appeared to be translated into bioactive molecule(s) since PTH-like bioactivity was found in tumor extracts as evaluated by the stimulation of CAMPproduction in osteoblast-like cells. The inhibition by the antagonist strongly suggested an interaction with the PTH receptor. Indeed, PTHrP has been shown to share the same receptor in bone and kidney cells. The presence of the newly described PTHrP has been demonstrated in a variety of solid tumors as well as in leukemic cells (Broadus et al., 1988; Ikeda et al., 1988a,b; Martin et al., 1988; Motokura et al., 1988, 1989; Fukumoto et al., 1989; Goltzman et al., 1989). However, an association between hypercalcemia and PTHrP in pancreatic neuro-endocrine tumors has not yet been reported, although PTHrP mRNA(s) and the secretion of bioactive PTHlike material have been demonstrated in neuro-endocrine tumor cell lines (Deftos et al., 1989, Lu et al., 1989). Evidence for the expression of the PTHrP gene in endocrine pancreas as well as in pancrealk endocrine tumors has been provided (Drucker

397

et al., 1989). However, none of the patients studied was hy-

percalcemic . On the other hand, hypercalcemia has been reported in one case of pheochromocytoma (Stewart et al., 1985) and one case of islet carcinoma (Stewart et al., 1986). In both cases, plasma Ca was normalized after tumor resection. Tumor extracts were found to contain bioactive PTH-like material, but the presence of PTHrP was not demonstrated. In conclusion, we have shown the expression of PTHrP mRNA(s) and detected PTH-like bioactivity in tumoral tissue of 2 patients with pancreatic neuro-endocrine tumors and hypercalcemia. The results support a causative link between PTHrP and the biological expression of hyperparathyroidism observed in this type of malignancy. ACKNOWLEDGEMENTS

This work was supported by grants from the Swiss National Science Foundation (3.954.0.85 and 32.26.941.89) and by the Geneva League against Cancer, Switzerland. R.R. is the recipient of a Max Cloetta career development award. We thank Dr. A.F. Miiller who allowed us to study his patients, and Dr. M.A. Thiede, West Point, PA, who kindly provided the cRNA probe. Mrs. D. Ducrest and Mrs. M. Sudan are thanked for their skillful technical assistance, and Mrs. M. Rosnoblet for typing the manuscript.

REFERENCES A.M., DAYER,J.M., I R L ~C, . , BERDOZ,J . , GORSKI,J . , TERMIJTELEN, D. and MACH.B . . Constitutive and induced exmession of the SCHENDEL. individual HLA-DR and chain'loci in different cell types. J.?mmunol., 39, 13361341 (1987). BIJVOET, O.L,.BA., MORGAN,D.B. and FOURMAN, P., The assessment of phosphate reabsorption. Clin. chim. Acta, 26, 15-24 (1969). BONJOUR, J.P., PHILIPPE, J . , GUELPA,G., BISETTI,A . and RIZZOLI,R . , Bone and renal components in hypercalcemia of malignancy and responses to a single infusion of clodronate. Bone, 9, 123-130 (1988). BONJOUR, J.P., RIZZOLI,R. and JUNG, A,, Diphosphonate therapy in hypercalcemia of malignancy and tumoral osteolysis. TiPS, 5 , 509-51 1 (1984). BROADUS,A.E., MANGIN,M . , IKEDA,K . , INSOGNA, K.L., WEIR,E.C., BURTIS,W.J. and STEWART,A.F., Humoral hypercalcemia of cancer: identification of a novel parathyroid hormone-like peptide. N . Engl. J . Med., 319, 556-563 (1988). DANKS,J . A . ,E.BELING, P.R., HAYMAN, J . , CHOU,S.T., MOSELEY, J.M., DUNLOP,I . , KEMP,B.E. and MARTIN,T.J., Parathyroid-related protein: immunohistochemical localization in cancers and in normal skin. J . Bone Min. Res., 4, 273-278 (1989). DEFTOS,L.J., GAZDAR,A.F., IKEDA,K. and BROADUS, A.E., The parathyroid hormone-related protein associated with malignancy is secreted by neuroendocrine tumors. Mol. Endocrinol., 3, 503-508 (1989). DELMAS, P.D., DEMIAUX, B . , MALAVAL, L., CHAPUY,M.C., EDOUARD, C. and MEUNIER,P.J., Serum bone gamma-carboxyglutamic-acidcontaining protein in primary hyperparathyroidism and in malignant hypercalcemia. J . clin. Invest., 77, 985-991 (1986). DEWYS.W.D.. STOLL.R.. Au. W.Y. and SALISNJAK. M.M.. Effects of streptozotocin on an islet-cell carcinoma with hypercalcemia: Amer. J . Med., 55, 671-476 (1973). DRUCKER,J.L., ASA, S.L., HENDERSON, J. and GOLTZMAN, D . , The parathyroid hormone-like peptide gene is expressed in the normal and neoplastic human endocrine pancreas. Mol. Endocrinol., 3, 1589-1595 ( 1989). FISKEN, R.A., HEATH,D . A . and BOLD,A.M., Hypercalcemia-a hospital survey. Quart. J . Med., 196, 405418 (1980). FRIESEN, S.R., Tumor of the endocrine pancreas. New Engl. J . Med., 306, 580-590 (1982). FUKUMOTO, S., MATSUMOTO, T., WATANABE, T., TAKAHASHI, H., MIYOSHI, I. and OGATA,E., Secretion of parathyroid hormone-like activity from human 'T-cell lymphotrophic-virus-type-I-infectedlymphocytes. Cancer Res., 49, 3849-3852 (1989). GOLTZMAN, D., HENDY,G.N. and BANVILLE, D., Parathyroid hormone-

like peptide: molecular characterization and biological properties. TIEM, 1, 3 9 4 4 (1989). HENDY,G . N . , KRONENBERG, H . M . , POTTS,J.T., JR. and RICH,A . , Nucleotide sequence of cloned cDNAs encoding human preproparathyroid hormone. Proc. nut. Acad. Sci. (Wash.), 78, 7365-7369 (1981). HORIUCHI, N . , CAULFIELD, M.P., FISHER,J.E., GOLDMAN,M.E. and MCKEE,R.L., Similarity of synthetic peptide from human tumor to parathyroid hormone in vivo and in vitro. Science, 238, 15661568 (1987). IKEDA,K., MANGIN,M . , DREYER,B.E., WEBB, A.C. and POSILLICO, J.T., Identification of transcripts encoding a parathyroid hormone-like peptide in messenger RNAS from a variety of human and animal tumors associated with humoral hypercalcemia of malignancy. J . clin. Invest., 81, 201&2014 (1988a). IKEDA, K., WEIR,E.C., MANGIN,M., DANNIES,P.S. and KINDER,B., Expression of messenger ribonucleic acids encoding a parathyroid hormone-like peptide in normal human and animal tissues with abnormal expression in human parathyroid adenomas. Mol. Endocrinol., 2, 12301236 (19886). KANIS,J.A., CUNDY,T., HEYNEN,G . andRussELL, R.G.G., The pathophysiology of hypercalcemia. Metab. Bone Dis. Rel. Res., 2, 151-159 (1980). KEMP,B.E., MOSELEY,J.M., RODDA,C.P., EBELING,P.R. and WETTENHALL, R.E.H., Parathyroid hormone-related protein of malignancy: active synthetic fragments. Science, 238, 1568-1570 (1987). KVOLS,L.K., BUCK, M . , MOERTEL,C.G., SCHUTT,A.J., RUBIN,J., O'CONNELL,J. and HAHN,R.G., Treatment of metastatic islet-cell carcinoma with a somatostatin analogue (SMS 201-995). Ann. intern. Med., 107, 162-168 (1987). Lu, C., IKEDA, K., DEFTOS,L.J., GAZDAR,A.F., MANGIN,M. and BROADUS, A.F., Glucocorticoid regulation of parathyroid hormone-related peptide gene transcription in a human neuroendocrine cell line. Mol. Endocrinol., 3 , 2034-2040 (1989). MANGIN,M., WEBB,A.C., DREYER,B.E., POSILLICO, J.T., IKEDA,K., WEIR,E.C., STEWART, A . F . , BANDER,N.H., MILSTONE, L., BARTON, D.E., FRANCKE,U. and BROADUS,A.E., Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy. Proc. nut. Acad. Sci. (Wash.), 85, 597-601 (1988). MARTIN,T.J., RODDA,C.P., EBELING,P.R., RODDA,C.P. and KEMP, B.E., Humoral hypercalcemia of malignancy: involvement of a novel hormone. Austr. NZ. J . Med., 18, 287-295 (1988). MERENDINO, J. J . , JR., INSOGNA, K.L., MILSTONE, L.M., BROADUS, A.E. and STEWART, A.F., A parathyroid hormone-like protein from cultured human keratinocytes. Science, 231, 388-390 (1986).

398

RIZZOLI ET AL.

MOSELEY,J.M., KUBOTA,M., DIEFENBACH-JAGGER, H., WETTENHALL, gene for an alanine transfer RNA from yeast. Enzymic joining of the R.E.H. and KEMP, B.E., Parathyroid hormone-related protein purified chemically synthesized polydeoxynucleotides to form the DNA duplex from a human lung-cancer cell line. Proc. nat. Acad. Sci. (Wash.), 84, representing nucleotide sequence 1 to 20. J. mol. Biol., 72, 4 2 7 4 l 4 5048-5052 (1987). (1972). MOTOKURA, T., FUKUMOTO, S., MATSUMOTO, T., TAKAHASHI, S., FuSINGER,F.R., SHARP,C.F., JR. and RUDE,R.K., Pathogenesis of hyperJITA,A , , YAMASHITA, T., IGARASHI, T. and OGATA,E., Parathyroid hor- calcemia in malignancy. Min. Electrolyte Metub., 2, 161-178 (1979). mone-related protein in adult T-cell leukemia-lymphoma. Ann. intern. J. and POWELL,D., Tumor hypercalcemia SKRABANEK, P., MCPARTLIN, Med., 111,484-488 (1989). and “ectopic” hyperparathyroidism. Medicine, 59, 262-282 (1980). MOTOKURA, T., FUKUMOTO, S., TAKAHASHI, S., WATANABE, T., MATJ.L., MALLETTE,L.E., SEGRE,G.V., AMAA.F., HOECKER, SUMOTO, T., IGARASHI, T. and OGATA,E., Expression of parathyroid STEWART, hormone-related protein in a human T-cell lymphotrophic-virus-type- TRuDA, T.T., JR. and VIGNERY,A,, Hypercalcemia in pheochromocytoma. Ann. intern. Med., 102, 7 7 6 7 7 9 (1985). I-infected T cell line. Biochem. biophys. Res. Cornm., 154, 1182-1188 (1988). A., Wu, STEWART, A.F., INSOGNA, K.L., BURTIS,W.J., AMINIAFSHAR, A.E., Frequency and partial characterizaMYERS,W.P.L., Hypercalcemia in neoplastic disease. Arch. Surg., 80, T., WEIR,E.C. and BROADUS, tion of adenylate cyclase-stimulating activity in tumors associated with 308-318 (1960). hypercalcemia of malignancy. J . Bone Min. Res., 1, 267-276 PIZURKI, L., RIZZOLI,R., MOSELEY,J., MARTIN,T.J., CAVERZASIO, J. humoral and BONJOUR,J.P., Effect of synthetic tumoral parathyroid hormone- (1986). related peptide on CAMP production and sodium-dependent phosphate STEWART, A.F., INSOGNA,K.L., GOLTZMAN, D. and BROADUS, A.E., transport in cultured renal epithelial cells. Amer. J . Physiol., 24, F957Identification of adenylate cyclase-stimulating activity and cytochemical F961 (1988). glucose-6-phosphate dehydrogenase-stimulating activity in extracts of tuRASBACH, D.A. and HAMMOND, J.M., Pancreatic islet-cell carcinoma with mors from patients with humoral hypercalcemia of malignancy. Proc. nat. hypercalcemia. Primary hyperparathyroidism or humoral hypercalcemia of Acad. Sci. (Wash.), 80, 1454-1458 (1983). malignancy. Amer. J . Med., 78, 337-342 (1985). STEWART, A.F., MANGIN,M., W u , T., GOUMAS, D. and INSOGNA, K.L., RIZZOLI,R., CAVERZASIO, J., FLEISCH,H. and BONJOUR,J.P., Parathy- Synthetic human parathyroid hormone-like protein stimulates bone resorproid hormone-like changes in renal calcium and phosphate reabsorption tion and causes hypercalcemia in rats. J. clin. Invest., 81,596600 (1988). induced by Leydig cell tumor in thyroparathyroidectomized rats. Endocri- SUVA,L.J., WINSLOW,G.A., WETTENHALL, R.G. R.E.H., HAMMONDS, nology, 119, 1004-1009 (1986). and MOSELEY, J.M., A parathyroid hormone-related protein implicated in RIZZOLI,R., BUCHS,B., FROIDEVAUX, P., BISETTI,A. and BONJOUR, malignant hypercalcemia: cloning and expression. Science, 237, 893-896 J.P., A randomized study comparing the new diphosphonate, aminohy- (1987). droxybutanediphosphonate (ABDP) to dichloromethylenediphosphonate THIEDE,M.A. and RODAN,G.A., Expression of a calcium-mobilizing (C12MDP) in hypercalcemia of malignancy (HM). J. Bone Min. Res., 3, parathyroid hormone-like peptide in lactating mammary tissue. Science, Suppl. 1, S128 (1988). 242, 278-280 (1988). RIZZOLI,R., CAVERZASIO, J., CHAPUY, M.C., MARTIN,T.J. and BON- THIEDE,M.A., STREWLER, G.J., NISSENSON, R.A., ROSENBLATT, M. and JOUR,J.P., Role of bone and kidney in parathyroid hormone-related pepG.A., Human renal carcinoma expresses two messages encoding tide-induced hypercalcemia in rats. J. Bone Min. Res., 4,759-766 (1989). RODAN, a parathyroid hormone-like peptide: evidence for the alternative splicing of RODAN,S.B., NODA, M., WESOLOWSKI, G., ROSENBLATT, M. and a single-copy gene. Proc. nut. Acad. Sci. (Wash.),85,4605-4609 (1988). RODAN,G.A.. Comparison of postreceptor effects of 1-34 human hypercalcemia factor and 1-34 human parathyroid hormone in rat osteosarcoma WEIR,E.C., BRINES,M.L., IKEDA,K., BURTIS,W.J., BROADUS,A.E. and ROBBINS, R.J., Parathyroid hormone-related peptide gene is expressed cells. J . clin. Invest., 81, 924-927 (1988). in the mammalian central nervous system. Proc. nat. Acad. Sci. (Wash.), SALOMON, Y., Adenylate cyclase assay. Adv. Cyclic Nucleotide Res., 10, 87, 108-112 (1990). 35-55 (1979). YATES,A.J.P., GUTIERREZ, G.E., SMOLENS, P., TRAVIS,P.S. and KATZ, SAPPINO,A.P., Busso, N., BELIN,D. and VASSALLI,J.D., Increase of M.S., Effects of a synthetic peptide of a parathyroid hormone-related urokinase-type plasminogen activator gene expression in human lung and protein on calcium homeostasis, renal tubular calcium reabsorption, and breast carcinomas. Cancer Res., 47,40434046 (1987). bone metabolism in vivo and in vitro in rodents. J . d i n . Invest., 81, SGARAMELLA, V. and KHORANA, H.G., Total synthesis of the structural 932-938 (1988).