Developmental and Comparative Immunology 44 (2014) 341–350

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Pellino protein from pacific white shrimp Litopenaeus vannamei positively regulates NF-jB activation Chaozheng Li a, Jiaoting Chai a, Haoyang Li a, Hongliang Zuo a, Sheng Wang a, Wei Qiu b, Shaoping Weng a, Jianguo He a,b,⇑, Xiaopeng Xu a,⇑ a b

MOE Key Laboratory of Aquatic Product Safety, State Key Laboratory for Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, PR China School of Marine Sciences, Sun Yat-sen University, Guangzhou, PR China

a r t i c l e

i n f o

Article history: Received 31 October 2013 Revised 13 January 2014 Accepted 14 January 2014 Available online 23 January 2014 Keywords: Toll-like receptor NF-jB Signaling pathway LvPellino Litopenaeus vannamei WSSV

a b s t r a c t Pellino, named after its property that binds Pelle (the Drosophila melanogaster homolog of IRAK1), is a highly conserved E3 class ubiquitin ligase in both vertebrates and invertebrates. Pellino interacts with phosphorylated IRAK1, causing polyubiquitination of IRAK1, and plays a critical upstream role in the toll-like receptor (TLR) pathway. In this study, we firstly cloned and identified a crustacean Pellino from pacific white shrimp Litopenaeus vannamei (LvPellino). LvPellino contains a putative N-terminal forkhead-associated (FHA) domain and a C-terminal ring finger (RING) domain with a potential E3 ubiquitin-protein ligase activity, and shows a high similarity with D. melanogaster Pellino. LvPellino could interact with L. vannamei Pelle (LvPelle) and over-expression of LvPellino could increase the activity of LvDorsal (a L. vannamei homolog of NF-jB) on promoters containing NF-jB binding motifs and enhance the expression of arthropod antimicrobial peptides (AMPs). The LvPellino protein was located in the cytoplasm and nucleus and LvPellino mRNA was detected in all the tissues examined and could be up-regulated after lipopolysaccharides, white spot syndrome virus (WSSV), Vibrio parahaemolyticus, and Staphylococcus aureus challenges, suggesting a stimulation response of LvPellino to bacterial and immune stimulant challenges. Knockdown of LvPellino in vivo could significantly decrease the expression of AMPs and increase the mortality of shrimps caused by V. parahaemolyticus challenge. However, suppression of the LvPellino expression could not change the mortality caused by WSSV infection, and dual-luciferase reporter assays demonstrated that over-expression of LvPellino could enhance the promoters of WSSV genes wsv069 (ie1), wsv303, and wsv371, indicating a complex role of LvPellino in WSSV pathogenesis and shrimp antiviral mechanisms. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Toll-like receptors (TLRs) play an important role in innate immunity against infectious agents in both vertebrates and invertebrates (Akira et al., 2001; O’Neill et al., 2013; Takeda and Akira, 2004). They function as primary sensors for conserved pathogenassociated molecular patterns (PAMPs) of invading pathogens (Akira et al., 2001; O’Neill et al., 2013; Takeda and Akira, 2004). Ten TLRs have been identified in humans and nine in Drosophila melanogaster, each representing a transmembrane protein with a ⇑ Corresponding authors. Addresses: School of Life Sciences, School of Marine Sciences, Sun Yat-sen University, Guangzhou 510275, PR China. Tel.: +86 20 39332988; fax: +86 20 84113229 (J. He). School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, PR China. Tel.: +86 20 84113793; fax: +86 20 84113229 (X. Xu). E-mail addresses: [email protected] (J. He), [email protected] (X. Xu). http://dx.doi.org/10.1016/j.dci.2014.01.012 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

cytoplasmic Toll/interleukin (IL)-1 receptor (TIR) domain and an ectodomain comprising leucine-rich repeats (Akira et al., 2001; O’Neill et al., 2013; Takeda and Akira, 2004; Roach et al., 2005; Blasius and Beutler, 2010). The engagement of TLR ectodomains by cognate ligands causes the recruitment of TIR-domain-containing adaptor molecule MyD88 to the cytoplasmic TIR domains of TLRs expect TLR3, leading to successive activation of IL-1 receptor-associated kinase 4 (IRAK4), IRAK1, and tumor necrosis factor receptor-associated factor 6 (TRAF6) Akira et al., 2001; Blasius and Beutler, 2010; Besse et al., 2007. The activated IRAK1/TRAF6 complex disassociates from the receptor complex and interacts with another complex consisting of transforming growth factor (TGF)-b activated kinase 1 (TAK1) and TAK1-binding protein (TAB)1, TAB2 and TAB3 (Besse et al., 2007; Mendoza et al., 2008). Pellino, a highly conserved E3 class ubiquitin ligase in both vertebrates and invertebrates, is an upstream mediator in the TLR pathway (Moynagh, 2009; Schauvliege et al., 2006, 2007). Pellino binds

342

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

phosphorylated IRAK1, causing K63-linked polyubiquitination of IRAK1, which allows the interaction of the polyubiquitinated IRAK1 with the ubiquitin-binding domain of NF-jB essential modifier (NEMO, also known as IKKc) (Moynagh, 2009; Schauvliege et al., 2006, 2007). This brings the TAK1–TAB1–TAB2 complex and the NEMO–IKKa–IKKb complex into close proximity, resulting in TAK1-mediated phosphorylation and activation of the IKKs (Moynagh, 2009; Schauvliege et al., 2006, 2007). The activated IKKs phosphorylates the NF-jB cytoplasmic inhibitory protein IjB, leading to polyubiquitylation and degradation of IjB and release of NF-jB from the IjB/NF-jB complex (Moynagh, 2009; Schauvliege et al., 2006, 2007). NF-jB is subsequently translocated into the nucleus to promote expression of tailored genes for fighting against invading microbes (Moynagh, 2009; Schauvliege et al., 2006, 2007). Pellino was firstly identified in D. melanogaster and named after its property that binds D. melanogaster Pelle, the homolog of IRAK1 (Grosshans et al., 1999). Besides D. melanogaster, the TLR pathway of pacific white shrimp Litopenaeus vannamei has been well studied among arthropods (Li and Xiang, 2013). L. vannamei, belonging to the Penaeidae family of Crustacea, is the main aquaculture shrimp species in the world (Johnson et al., 1947; Lunz, 1935). Since in recent years the world shrimp aquaculture industry has been threatened by a wide range of pathogens such as parasites, fungi, bacteria, and viruses, more and more studies have been focus on the shrimp immune system (Li and Xiang, 2013). Up to now, three Toll receptors, two variants of MyD88, two isoforms of Tube (LvTube and LvTube-1, the orthologs of IRAK4), and the homolog of Pelle (LvPelle, the ortholog of IRAK1), Cactus (LvCactus, the ortholog of IjB) and Dorsal (LvDorsal, the ortholog of NF-jB) have been identified in L. vannamei (Li and Xiang, 2013; Huang et al., 2010; Li et al., 2012a, 2014; Wang et al., 2011, 2012; Yang et al., 2007; Zhang et al., 2012). These components of the L. vannamei TLR pathway play functional roles during immune responses against bacterial and viral infections. In this work, we studied the L. vannamei Pellino (LvPellino) gene, which is the first Pellino gene identified in crustaceans. Over-expression of LvPellino can increase the activity of promoters that contain NF-jB binding DNA motifs, such as the promoters of arthropod antimicrobial peptides (AMPs) and white spot syndrome virus (WSSV) genes wsv069, wsv303 and wsv371. The functions of LvPellino in vivo were further investigated using RNA interference (RNAi) strategy. We show here that L. vannamei Pellino acts as a positive regulator of Toll pathway, and the identification of LvPellino can help us better know the TLR signaling pathway in crustaceans.

NUP and LvPellino 3RACE2. The second PCR products were cloned into pMD-20T vector (TaKaRa, Japan) and 12 positive clones were selected and sequenced (ABI PRISM, Applied Biosystems, USA). 2.2. Bioinformatics analysis Protein sequences of Pellino homologs from other species were retrieved from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) databases using the BLAST program (basic local alignment search tool). Sequence alignments between LvPellino and Pellino homologs from other species were analyzed using Clustal X v2.0 program (Larkin et al., 2007). Phylogenetic trees were constructed based on the deduced amino acid sequences using MEGA 5.0 software, applying the amino acid substitution type and poisson model and bootstrapping procedure with a minimum of 1000 bootstraps (Tamura et al., 2011). Protein domains were predicted using the SMART program (http://smart.embl-heidelberg.de/) and InterPro Scan (http://www.ebi.ac.uk/ InterProScan/). 2.3. Plasmid constructions The open reading frames (ORFs) of LvPellino was cloned into the KpnI/ApaI sites of pAc5.1/V5-His A (Invitrogen, USA) and pAc5.1GFP vector (Li et al., 2012a) to generate pAc5.1-LvPellino-V5 and pAc5.1-LvPellino-GFP for expressing V5-tagged and GFP-tagged proteins, respectively. Several luciferase reporter vectors, PGL3Drs, PGL3-Mtk, PGL3-LvPEN4, PGL3-PmPEN411, PGL3-PmPEN536, PGL3-wsv069, PGL3-wsv303 and PGL3-wsv371, were constructed according to the previous studies by cloning the promoter sequences of the following NF-jB-activated genes: the D. melanogaster AMPs, Drosomycin (Drs) and Metchnikowin (Mtk); the L. vannamei AMP Penaeidin4 (LvPEN4); the Penaeus monodon AMP Penaeidin (PmPEN411 and PmPEN536); and three WSSV genes (wsv069 (ie1), wsv303 and wsv371) into the PGL3-basic vector (Promega, USA), respectively (Li et al., 2012a, 2014; Wang et al., 2011, 2012; Zhang et al., 2012; Ho and Song, 2009; O’Leary and Gross, 2006). NF-jB activating element luciferase reporter plasmid (named as PGL3-NF-jB) was constructed by inserting the transcriptional response element of shrimp NF-jB (AGGAATTTCC), which had been verified by electrophoretic mobility shift (EMSA) and luciferase reporter assays in a previous study (Huang et al., 2010; Chen et al., 2011), and the TATA box consensus sequences (TATAAA) into the PGL3-basic vector (Fig. 4A). 2.4. Confocal laser scanning microscopy

2. Materials and methods 2.1. Cloning of full length of LvPellino cDNA A sequence that is predicted to encode a Pellino homologs protein was retrieved from the L. vannamei transcriptome data analyzed by our lab (Li et al., 2012b), and was used to design specific primers for cloning the LvPellino gene (Table 1). Briefly, total RNA was extracted from L. vannamei gills with RNeasy Mini Kit (QIAGEN, Germany) according to the user manual. Rapid amplification cDNA ends (RACE) were then performed using the SMARTer™ RACE cDNA Amplification kit (Clontech, Japan) according to the manufacturer’s protocol. 50 -RACE PCR amplification was performed with Universal Primer A Mix (UPM) and LvPellino specific reverse primer 5RACE1. Nested PCR was subsequently performed with Nested Universal Primer A (NUP) and LvPellino 5RACE2 using the first-round PCR product as template. 30 -RACE-PCR was performed using UPM together with an LvPellino-specific forward primer 3RACE1, and the nested PCR was subsequently performed with

Drosophila Schneider 2 (S2) cells were transfected with pAc5.1LvPellino-GFP vector using Effectene Transfection Reagent (Qiagen, Germany). At 24 h post-transfection cells were stained with 2 lg/ ml Hochest 33258 (Sigma, USA) and visualized with confocal laser scanning microscope (Leica TCS-SP5, Germany). 2.5. Co-immunoprecipitation assays pAC-LvPellino-V5 was cotransfected with pAC-LvPelle-GFP (Li et al., 2014) and pAC5.1-GFP (as control) into S2 cells, respectively. After 72 h, cells were collected and lysed in NP-40 lysis buffer with a protease inhibitor cocktail (Sigma). Co-immunoprecipitation (CO-IP) and reciprocal CO-IP were carried out using anti-V5 affinity gel (Sigma) and anti-GFP agarose (MBL International), respectively. The precipitated protein was examined using western-blot with rabbit anti-GFP antibody or mouse anti-V5 antibody (Sigma) as primary antibody, and alkaline phosphatase-conjugated goat anti-rabbit or anti-mouse as secondary antibody (Sigma).

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

343

Table 1 Summary of primers in this study. Name RACE LvPellino 3RACE1 LvPellino 3RACE2 LvPellino 5RACE1 LvPellino 5RACE2 Real-time RT-PCR LvEF-1a LvPellino LvPEN4 LvALF1 LvALF2 LvCrustin Protein expression LvPellino dsRNA templates amplification DsRNA-LvPellino-T7-F DsRNA-LvPellino-R DsRNA-LvPellino-F DsRNA-LvPellino-T7-R DsRNA-eGFP-T7-F DsRNA-eGFP-R DsRNA-eGFP-F DsRNA-eGFP-T7-R *

Sequence (50 –30 ) AGGTGACCCAGGCTTTGTCCGACTC AACTGCGACTGAATTCCCTCCTGGC TTCGCACCACATAATGCCGAGCAGG TGGCGTCTGTGCAACACAAACTTGC F: TATGCTCCTTTTGGACGTTTTGC R: CCTTTTCTGCGGCCTTGGTAG F: GGTGACGCAGAGTACAATTAGCAG R: CGAATCGAAGCCAGCAGCATA F: ATGCTACGGAATTCCCTCCT R: ATCCTTGCAACGCATAGACC F: ATAGTCGGGTTGTGGCACTC R: GTCGTCCTCCGTGATGAGAT F: TGGCAACTGTATTCCAGGGTCG R: ATCTGCGTGTCGTTCTTCTTCG F: GGAGTAGGTGTTGGTGGTGGTT R: GCAGTCGCTTGTGCCAGTTC F*: GGGGTACCATCAAAATGCCCGACCCTCCTATAATTG R: TTGGGCCCGTCGCAGTTGTCTTGAAAAATGAG GGATCCTAATACGACTCACTATAGGAAGCGGTGATCGTGGAGTATC CATAGTAACGTAGCTCCACACAAGTC AAGCGGTGATCGTGGAGTATC GGATCCTAATACGACTCACTATAGGCATAGTAACGTAGCTCCACACAAGTC GGATCCTAATACGACTCACTATAGGCGACGTAAACGGCCACAAGTT ATGGGGGTGTTCTGCTGGTAG CGACGTAAACGGCCACAAGTT GGATCCTAATACGACTCACTATAGGATGGGGGTGTTCTGCTGGTAG

The D. melanogaster Kozak translation initiation sequence was underlined.

2.6. Dual-luciferase reporter assays S2 cells were cultured at 28 °C in D. melanogaster SDM (SerumFree Medium; Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen). For DNA transfection, cell plating and transfection were performed on the same day, and plasmids were transfected using Effectene Transfection Reagent (Qiagen). For dual-luciferase reporter assays, S2 cells in each well of a 96-well plate (TPP, Switzerland) were transfected with 0.05 lg reporter gene plasmids, 0.005 lg pRL-TK renilla luciferase plasmid (Promega), and 0.05 lg protein expression plasmids or empty pAc5.1/V5-His A plasmid (as control). The pRL-TK renilla luciferase plasmid was used here as an internal control. At 48 h post transfection, DualLuciferase Reporter Assays were performed to measure the firefly and renilla luciferase activities according to the manufacturer’s instructions. Each experiment was done at least three times.

group were sampled at 0, 4, 8, 12, 24, 36, 48, 72 h post injection (hpi), and each sample at each time point was collected and pooled from 15 shrimps. Total RNA was then isolated using TRIzol reagent and subsequently reverse transcribed to cDNA using PrimeScript RT Reagent Kit (Takara) according to the manufacturer’s instructions. Reactions were performed in the LightCycle 480 System (Roche, Germany) according to the manufacturer’s protocol. Real-time RT-PCR assays were performed at a volume of 10 ll comprised of 1 ll of 1:10 cDNA diluted with ddH2O, 5 ll of 2 SYBRGreen Master Mix (Takara), and 250 nM of each primer. The cycling parameters were 95 °C for 2 min to activate the polymerase, followed by 40 cycles of 95 °C for 15 s, 62 °C for 1 min, and 70 °C for 1 s. Cycling ended at 95 °C with 5 °C/s calefactive velocity to create the melting curve. Fluorescence measurements were taken at 70 °C for 1 s during each cycle. Expression levels of LvPellino were calculated using the Livak (244CT) method after normalization to EF-1a (GenBank accession No. GU136229). Primer sequences are listed in Table 1.

2.7. Immune challenge and real-time RT-PCR analysis Healthy L. vannamei (average 5 g) were obtained from Hengxing shrimp farm in Zhanjiang, China. The hepatopancreas, pyloric caecum, nerve, hemocyte, gill, stomach, eyestalk, intestine, epidermis, scape, muscle and heart tissues from 15 L. vannamei were sampled and pooled for tissue expression analysis. For challenge experiments, L. vannamei were cultured in freshwater tanks at room temperature (27 °C) at least 7 days for acclimation before experiments and divided into 5 experimental groups, in which L. vannamei was injected at the second abdominal segment with 2 lg/ll poly (I:C), 2 lg/ll lipopolysaccharides (LPS), 106 particles of Vibrio parahaemolyticus, 106 particles of Staphylococcus aureus, and 106 copies newly extracted WSSV particles in 50 ll DEPC-treated water prepared PBS solution (pH 7.4), respectively, as well as a control group injected with 50 ll PBS. Hemocytes of challenged shrimps in each

2.8. Knockdown of LvPellino expression by dsRNA-mediated RNA interference The dsRNAs targeted to the LvPellino and green fluorescent protein (GFP, as a control) genes were synthesized by in vitro transcription. The DNA templates for LvPellino dsRNA (designated as dsLvPellino) were prepared by PCR using the gene-specific primers for DsRNA-LvPellino-T7-F/DsRNA-LvPellino-R and DsRNA-LvPellino-F/DsRNA-LvPellino-T7-R (Table 1) and the products with T7 promoter were confirmed by sequencing. In vitro transcription was performed using 1 lg of DNA templates in a T7 RiboMAX™ Express Large Scale RNA Production System (Promega) according to the manufacturer’s instructions. The synthesis of double-stranded RNA of GFP (designated as dsGFP) was performed as well. The

344

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

Fig. 1. mRNA and deduced amino acid sequences of LvPellino. The ORF of the nucleotide sequence is shown in upper-case letters, while the 50 and 30 -UTRs sequences are shown in lowercase. Nucleotides and amino acids are numbered on the left of the sequences. Amino acid sequence is represented with one-letter codes above the nucleotide sequence. The forkhead-associated (FHA) domain in the N-terminal is shown with red box, and the ring finger (RING) domain in the C-terminal is underlined with black line. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

quality and amount of dsRNAs was verified by agarose gel electrophoresis and NanoDrop 2000 spectrophotometer (Thermo). The length of LvPellino and GFP dsRNA are 549 and 554 bp, respectively. The experimental group was intramuscularly injected with LvPellino dsRNA (1 lg/g shrimp in 50 ll PBS), while the control groups were injected with GFP dsRNA and PBS, respectively. Real-time RT-PCR was used to investigate the RNA interference efficiency. Total RNAs were extracted from hemocytes sampled from experimental and control groups on various days before injection (designed as 0 dpi) and post injection (0.5, 1, 2, 3, 4, 5 and 7 dpi) and subsequently reverse transcribed into cDNA using PrimeScript RT Reagent Kit (TaKaRa). EF1-a (Elongation factor 1 alpha) was used as internal control. Reactions were performed in the LightCycle 480 System (Roche, Germany) according to the manufacturer’s protocol. Expression levels of LvPellino, and L. vannamei AMP genes, anti-lipopolysaccharide factor 1 (ALF1, GenBank accession No. EW713395.1), ALF2 (EW713396.1), crustin (AY488496.1), and penaeidin4 (PEN4, AF390147.1), at various days post injection

were normalized to that of 0 dpi, which was set as 1.0. Primer sequences were listed in Table 1.

2.9. Cumulative mortality after WSSV, V. parahaemolyticus and PBS challenges in LvPellino-knockdown shrimp Healthy L. vannamei (average 5 g and n = 40 in each group) were injected at the second abdominal segment with 5 lg (1 lg/g shrimp in 50 ll PBS) of dsRNA (LvPellino dsRNA or GFP dsRNA) or PBS. Forty-eight hours later, shrimps were injected again with 106 particles of V. parahaemolyticus, 106 copies of WSSV particles, and mock-challenged with PBS as a control, respectively (Ai et al., 2008). Shrimps were kept in culture flasks for about 6 days following infection. Cumulative mortality was recorded every 4 h. Differences in mortality between the experimental groups (LvPellino dsRNA injected groups) and the GFP dsRNA injected groups (as a control group) were tested for statistical significance using

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

Fig. 2. Phylogenetic tree analysis of the full-length amino acid sequences of Pellino proteins from various species (LvPellino was marked with underlined) using MEGA 5.0 software. LvPellino is underlined with black line. Proteins analyzed list below: LvPellino, Litopenaeus vannamei Pellino (Accession No. KC346863); AcPellino, Anolis carolinensis Pellino (Accession No. XP_003215234.1); AePellino, Acromyrmex echinatior Pellino (Accession No. EGI69887.1); AmPellino Apis mellifera Pellino (Accession No. XP_392595.4); BtPellino, Bos taurus Pellino (Accession No. XP_002690998.1); CfPellino, Camponotus floridanus Pellino (Accession No. EFN68970.1); DmPellino, D. melanogaster melanogaster Pellino (Accession No. NP_524466.1); DpPellino, Daphnia pulex Pellino (Accession No. EFX74603.1); EcPellino, Equus caballus Pellino (Accession No. XP_001493996.1); GgPellino, Gallus gallus Pellino (Accession No. XP_001234988.1); HsPellino1, Homo sapiens Pellino1 (Accession No. NP_065702.2); HsPellino2, Homo sapiens Pellino2 (Accession No. NP_067078.1); HsPellino3a, Homo sapiens Pellino3a (Accession No. NP_659502.2); HsPellino3b, Homo sapiens Pellino3b (Accession No. NP_001091980.1); HsPellino3c, Homo sapiens Pellino3c (Accession No. NP_001230064.1); HsPellino3d, Homo sapiens Pellino3d (Accession No. NP_001230065.1); MmPellino, Mus musculus Pellino (Accession No. NP_291080.2); PtPellino, Pan troglodytes Pellino (Accession No. XP_522860.2); RnPellino, Rattus norvegicus Pellino (Accession No. NP_001100729.1); TgPellino, Taeniopy giaguttata Pellino (Accession No. XP_002199682.1); XlPellino, Xenopus laevis Pellino (Accession No. NP_001085528.1).

345

Fig. 3. Interaction between LvPellino and LvPelle. Co-immunoprecipitation assays were performed on S2 cells co-expressing V5-tagged LvPellino together with GFPtagged LvPelle or control GFP protein using either anti-V5 or anti-GFP antibody, respectively. The precipitated protein were examined by western-blot using antiV5 or anti-GFP antibody. Approximate molecular sizes: LvPellino-V5, 48 kDa; LvPelle-GFP, 133 kDa; GFP, 28 kDa. Input: western-blot analysis of the input cell lysates (3%) before immunoprecipitation.

the vertebrates group and invertebrates group and LvPellino was mostly clustered to the subtree of Arthropoda Pellino proteins. Multiple sequence alignment showed that the full lengths of LvPellino was similar to D. melanogaster Pellino (DmPellino) (66% identity), Camponotus floridanus Pellino (CfPellino) (66% identity), Acromyrmex echinatior Pellino (AePellino) (63% identity), and Apis mellifera Pellino (AmPellino) (63% identity) (Fig. S1). The identities of Pellino proteins across vertebrates and invertebrates in this study are from 41% to 99%, confirming that the Pellino proteins are highly conserved among different species (Fig. S2). 3.3. Interaction between LvPellino and LvPelle

the Kaplan–Meier plot (log-rank v2 test) (Alberti et al., 2005; Ziegler et al., 2007). 3. Results 3.1. Sequence analysis of LvPellino The LvPellino mRNA is 1961 bp long, with a 90-bp 50 -untranslated region (UTR), a 572-bp 30 -untranslated region including a poly (A) tail, and an 1299-bp open reading frame (ORF) encoding a 432 amino acids protein with a calculated molecular weight of 47.3 kDa (Genbank Accession No. KC346863). The LvPellino protein sequence contains a forkhead-associated (FHA) domain in the Nterminal 118–188 residues and a ring finger (RING) domain in the C-terminal 299–350 residues with a potential E3 ubiquitinprotein ligase activity (Fig. 1). 3.2. Phylogenetic analysis The full lengths of the LvPellino protein and its homologs from other species were phylogenetically analyzed by the neighborjoining (NJ) method. According to the NJ phylogenetic tree (Fig. 2), the Pellino proteins used in this study were clustered to

Pellino was firstly identified as an interacting protein of D. melanogaster Pelle (Grosshans et al., 1999). To confirm the newly identified Pellino protein in L. vannamei, the interaction between LvPellino and LvPelle was investigated. CO-IP and reciprocal COIP assays demonstrated that the two proteins were co-precipitated with each other during immunoprecipitation, suggesting LvPellino is a binding partner of LvPelle (Fig. 3). 3.4. LvPellino activates shrimp NF-jB The L. vannamei NF-jB family contains LvDorsal and LvRelish, which are the key components of the TLR pathway and the IMD pathway (Huang et al., 2009, 2010). In this study, dual-luciferase reporter assays that were performed on S2 cells showed that over-expression of LvPellino could up-regulate the activity of NFjB on artificial promoters containing NF-jB binding motifs by 11.36-fold compared with control (Fig. 4B). It has been reported that the expression of wsv069 (ie1), wsv303, and wsv371 genes from WSSV could be up-regulated by activation of LvDorsal (Wang et al., 2011). In this study, dual-luciferase reporter assays also demonstrated that compared with control, over-expression of LvPellino could activate promoter activities of WSSV genes, wsv069 (ie1) (5.71-fold increase), wsv303 (4.25-fold increase), and wsv371 (15.03-fold increase) (Fig. 4C). Moreover, LvPellino over-expression

346

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

Fig. 4. Dual luciferase reporter assays on S2 cells. (A) Schematic representation of the architecture of PGL3-NF-jB. The PGL3-NF-jB plasmid contains four tandem repeats of Transcriptional Response Element of L. vannamei NF-jB and a TATA box followed by a firefly luciferase gene (Firefly LUC). (B) Effects of LvPellino on the activity of L. vannamei NF-jB. The L. vannamei NF-jB was activated by LvPellino over-expression. (C) Effects of LvPellino on promoters of three WSSV genes, wsv069 (ie1), wsv303 and wsv371. (D) Effects of LvPellino on promoters of D. melanogaster AMP genes, Drs, Mtk and shrimp antimicrobial peptide (AMP) genes, LvPEN4, PmPEN411 and PmPEN536. The bars indicate the mean ± SD of the luciferase activities (n = 3). The statistical significance was calculated by the Student’s t-test (⁄p < 0.05, ⁄⁄p < 0.01).

could up-regulate promoter activities of AMP genes including the D. melanogaster AMPs Drs. (4.48-fold), Mtk (4.07-fold), the P. monodon AMPs PmPEN411 (5.04-fold) and PmPEN536 (5.26-fold) and the L. vannamei AMP LvPEN4 (4.08-fold) (Fig. 4D), suggesting that LvPellino can activate AMP responses.

3.5. Cellular location and tissue distribution of LvPellino Analysis of the subcellular localization is important for indepth studies of protein biological functions involved in a range of cellular processes and interactions. The GFP-tagged LvPellino protein was visualized in plasmid transfected S2 cells using confocal laser scanning microscope. The results showed that LvPellino was dispersedly present in the cytoplasm and the nuclear areas, suggesting that LvPellino is both cytoplasm- and nuclearlocalized (Fig. 5). To identify the tissue location of LvPellino, shrimp tissues were sampled and subjected to realtime RT-PCR analyses. The mRNA of LvPellino could be detected in all the tissues examined. The relative expression levels of LvPellino in other tissues were normalized to that in hepatopancreas, which was set as baseline (1.0). The results showed that the expression of LvPellino is low in hepatopancreas and epithelium, pyloric caecum, scape, moderate in most tested tissues including the important immune tissue gill and high in intestine and hemocyte with levels 4.18-fold and 4.19-fold over the baseline, respectively (Fig. 6A).

3.6. Expression of LvPellino in hemocytes of pathogen- and stimulantchallenged shrimp In response to LPS, LvPellino abruptly increased and reached a peak of 2.60-fold at 4 hpi (Fig. 6B). In the V. parahemolyticus-challenged L. vannamei hemocytes, LvPellino showed a periodic expression profile with two peaks at 8 hpi (2.33-fold increase) and 48 hpi (1.89-fold increase), respectively (Fig. 6C). In the S. aureus infection, the LvPellino expression was down-regulated during 4–8 h and reached a bottom value at 8 h (0.67-fold decrease), up-regulated at 12–36 h with a peak at 36 h (1.89-fold increase), and dramatically down-regulated during 48–72 h (Fig. 6D). In response to WSSV infection, the LvPellino expression increased after 0 hpi, maintained a high level during 4–24 h with a peak value at 4 hpi (2.89-fold increase), backed to the base line during 36–48 h, and finally slightly increased at 72 h a (Fig. 6E). During the poly (I:C) challenge, the level of LvPellino changed moderately with a expression profile of down-regulation at 4 h, up-regulation at 8–12 h, and again decreasing at 24–72 h (Fig. 6F). The control group injected by PBS did not show obvious change of LvPellino expression. 3.7. Suppression of LvPellino expression in vivo The ability of LvPellino dsRNA to specifically suppress LvPellino was tested using real-time RT-PCR. The mRNA level of LvPellino was remarkably down-regulated with 64.3–80.9 percent decrease during 1–7 days post injection and there was no

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

347

Fig. 5. Subcellular localization of LvPellino-GFP fusion protein in D. melanogaster S2 cell. S2 cells were transfected with pAc5.1-Pellino-GFP, treated with Hochest 33258 to counterstain nuclei (blue), and observed with confocal laser scanning microscope. The LvPellino-GFP fusion protein (green) was detected within the cytoplasm and nucleus.

Fig. 6. Tissue distribution of LvPellino mRNA in healthy L. vannamei and its expression profiles in hemocytes from pathogens or stimulants challenged L. vannamei. Real-time RT-PCR was performed in triplicate for each sample. Expression values were normalized to those of LvEF-1a using the Livak (244CT) method and the data were provided as the mean fold changes (means ± SE, n = 3) relative to the control group (*p < 0.05, **p < 0.01). (A) Transcription levels of LvPellino in different tissues of healthy L. vannamei. Expression level in the hepatopancreas was used as control and set to 1.0. (B–F) Expression profiles of LvPellino in hemocytes from LPS, V. parahemolyticus, S. aureus, WSSV and poly (I:C) challenged shrimps. Expression level detected at 0 h post injection of each group was set as 1.0.

suppressive effect on LvPellino in the GFP dsRNA and PBS injection groups (Fig. 7A). AMPs are important downstream responsive genes of the NF-jB pathway (Huang et al., 2009, 2010; Wang et al., 2013). We also observed that compared with the control GFP dsRNA, LvPellino dsRNA could significantly attenuate the expression of AMPs in shrimps. The expression of the four detected AMP genes started to be decreased at 1 day post dsRNA injection. During the next 6 days investigation period, the mRNA levels of ALF1, ALF2, crustin and PEN4 in LvPellino dsRNA treated shrimps decreased to 48.6–70.3%, 31.9–68.8%, 26.7–48.8%, and 19.8–65.1% of those in the control GFP dsRNA treated shrimps, respectively (Fig. 7B). These confirmed that LvPellino play a positive role in the NF-jB pathway.

Experimental shrimps were challenged with V. Parahemolyticus or WSSV at 2 days post dsRNA injection in the following experiments. During V. parahemolyticus infection (Fig. 7C), the cumulative mortality of the LvPellino dsRNA group increased rapidly from 8 h post V. parahemolyticus challenge until 40 hpi. Cumulative mortality in the LvPellino dsRNA group was significantly higher than in the GFP dsRNA group (Kaplan–Meier log-rank v2: 4.071, p < 0.05). Final mortality rates were 75.61%, 45.71% and 42.86% for the LvPellino dsRNA, GFP dsRNA and PBS groups, respectively. These results suggest that LvPellino may play an important protective role against V. Parahemolyticus. The LvPellino-silenced shrimp were systemically challenged with WSSV at 48 h after LvPellino dsRNA injection, and the

348

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

Fig. 7. Shrimp cumulative mortality following treatment with dsRNAs and experimental infection with V. parahemolyticus or WSSV. (A and B) Real-time RT-PCR analysis of gene expression of LvPellino (A) and L. vannamei AMP genes, ALF1, ALF2, crustin, and PEN4 (B). Samples were taken various times (0, 0.5, 1, 2, 3, 5, and 7 days) after injection with indicated dsRNA (*p < 0.05, **p < 0.01); (C and D) Shrimp (n = 40) were injected intramuscularly with PBS, dsLvPellino or dsGFP. At 48 h after the initial injection, animals were infected with V. parahemolyticus (C) or WSSV (D) and the PBS as the negative control. Cumulative mortality was recorded every 4 h. Differences in cumulative mortality levels between treatments were analyzed by Kaplan–Meier log-rank v2 tests.

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

mortality rate was recorded for a period of 128 h at every 4 h after challenge. At 64 h post-WSSV challenge, the cumulative mortality was lower in the LvPellino-silenced shrimp compared to the two control groups, and delayed to reach 100%, but the difference had no statistical significance (Fig. 7D).

4. Discussion In mammalian, three Pellino proteins, Pellino-1, Pellino-2 and Pellino-3, have been identified and functional characterized (Moynagh, 2009; Jiang et al., 2003; Butler et al., 2005). As E3 ubiquitin ligases, Pellino-1 and Pellino-2 have been proposed to function as positive regulators of TAK1-mediated activation of NF-jB (Moynagh, 2009; Schauvliege et al., 2006, 2007; Jiang et al., 2003). Interestingly, although Pellino-3 also has E3 ligase activity that can catalyze polyubiquitylation of IRAK1 as do Pellino-1 and Pellino-2, it acts as a negative regulator to suppress the activation of the NF-jB pathway (Xiao et al., 2008). In D. melanogaster, only one Pellino, which is most homologous to mammalian Pellino-2, has been identified and proved to activate the NF-jB pathway (Grosshans et al., 1999; Haghayeghi et al., 2010). The novel identified L. vannamei Pellino showed a high similarity with D. melanogaster Pellino and was clustered to the subtree of Arthropoda Pellino proteins, indicating a similar function of LvPellino with D. melanogaster Pellino. It has been reported that the C-terminal region of pellino could serve as the functional RING-like domain that confers E3 ubiquitin ligase activity and an ability to promote polyubiquitylation of IRAK-1, and the N-terminal FHA domain could facilitate interaction with phosphorylated IRAK1/Pelle (Moynagh, 2009). In this study, bioinformatics analyses also showed that LvPellino contains the RING-like domain and the FHA domain, suggesting a possible regulatory function of LvPellino in the shrimp NF-jB pathway. This was confirmed by dual-luciferase reporter assays, which demonstrated that over-expression of LvPellino could significantly up-regulate the activity of promoters containing NFjB-binding DNA motifs, particularly the AMPs promoters. The expression of LvPellino was also up-regulated during challenges with bacteria, LPS and WSSV, indicating LvPellino could involve in the activation of the shrimp TLR/NF-jB pathway. In D. melanogaster, Pellino is required for innate immunity, and mutation of Pellino could cause high susceptibility to bacterial infection in vivo (Haghayeghi et al., 2010). In this study, we also observed that knockdown of LvPellino could obviously attenuate the expression of shrimp AMPs. These suggest that LvPellino could play a positive role during immune responses against pathogen invasion. The shrimp hemocytes construct an important immune tissue and play important roles in immune defense. We observed that in hemocytes the expression of LvPellino was up-regulated during LPS, V. parahemolyticus, S. aureus, and WSSV challenges, suggesting LvPellino could be activated during immune responses. Interestingly, the shapes of the expression curves of LvPellino in responses to different pathogens or immune stimulants were different, which could reflect different levels of LvPellino activation during different pathogen infections. These were accordant with our previous finding that invertebrate TLR/NF-jB pathway has various regulatory patterns of signal transduction in response to different pathogen invasions (Li et al., 2014). Moreover, the responses of LvPellino to the challenge of the nucleic acid mimic poly (I:C) was moderate compared with other stimulants. Although the exact TLR that recognizes external nucleic acids has not been identified, it has been reported that shrimp may possess nucleic acid-induced antiviral immunity (Wang et al., 2013). The exact function of LvPellino during nucleic acid-induced antiviral immunity and its difference from those during immune responses against other stimulants requires further investigation.

349

It has been reported that the WSSV replication is dependent on the activation of the NF-jB pathway (Li et al., 2014; Wang et al., 2011; Huang et al., 2010). LvDorsal could directly act on the promoters of many WSSV genes, such as wsv069, wsv303 and wsv371 (Huang et al., 2010; Wang et al., 2011; Alberti et al., 2005). In this study, we also observed that over-expression of LvPellino could significantly stimulate the promoters of these viral genes. To further determine the function of LvPellino during WSSV infection, LvPellino was silenced by RNA interference strategy and the result showed that suppression of the expression of LvPellino could not reduce the mortality caused by WSSV infection, indicating that LvPellino may play a complex role in WSSV pathogenesis and shrimp antiviral responses. LvPellino could increase the expression of WSSV genes through activating the NF-jB pathway, while on the other hand the activated NF-jB pathway could also activate the anti-pathogen immune response of shrimps, which may inhibit the WSSV infection. Given the complex role of LvPellino in WSSV infection, the interaction between LvPellino and WSSV needs further investigations. Pellino-mediated polyubiquitylation of IRAK1 plays a key role in TLR signal transduction cascades (Zhang et al., 2012; Ho and Song, 2009; O’Leary and Gross, 2006). Besides IRAK1/Pelle, Pellino proteins can also interact with other TLR pathway components, such as TRAF6 and TAK1 (Zhang et al., 2012; Ho and Song, 2009; O’Leary and Gross, 2006). Moreover, it has been reported that Pellino could also involve in the activation of the p38, ERK1/2 and JNK MAPK pathways (Besse et al., 2007). These suggest a complex role of Pellino in immune response. As LvPellino is the first identified Pellino in crustaceans, our study advances the understanding of the crustacean TLR pathway. Further studies should be performed to investigate the function of LvPellino in shrimp immune system, including the E3 ubiquitin ligase activity of LvPellino, and the activity of LvPellino in regulating other shrimp MAPK pathways. Moreover, as an E3 class ubiquitin ligase involved in the cytoplasmic signal transduction of the TLR pathway, LvPellino could work in the cytoplasm. Interestingly, in this study we observed that besides the cytoplasm, LvPellino was also present in the nucleus. To our knowledge, it is the first report of the cellular localization of Pellino in animals. A very recent study has reported that Pellino1 interacts with Deformed Epidermal Autoregulatory Factor 1 (DEAF1) and the interaction is independent of the E3 ligase activity of Pellino1 (Ordureau et al., 2013). It has been reported that DEAF1 was exclusively located in the nucleus and functioned as a transcription factor to regulate the promoters of D. melanogaster AMPs and human interferon (IFN)-b (Huggenvik et al., 1998; Reed et al., 2008). These indicate that the nucleus could be also a workplace for Pellino, which accords with our finding in this study. The function of LvPellino in the nucleus is worthy of in-depth study.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2014.01.012.

References Ai, H.S., Huang, Y.C., Li, S.D., Weng, S.P., Yu, X.Q., He, J.G., 2008. Characterization of a prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is down-regulated by white spot syndrome virus. Fish Shellfish Immunol. 25, 28– 39. Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Alberti, C., Timsit, J.F., Chevret, S., 2005. Survival analysis – the log rank test. Rev. Mal. Respir. 22, 829–832. Besse, A., Lamothe, B., Campos, A.D., Webster, W.K., Maddineni, U., Lin, S.C., et al., 2007. TAK1-dependent signaling requires functional interaction with TAB2/ TAB3. J. Biol. Chem. 282, 3918–3928.

350

C. Li et al. / Developmental and Comparative Immunology 44 (2014) 341–350

Blasius, A.L., Beutler, B., 2010. Intracellular toll-like receptors. Immunity 32, 305– 315. Butler, M.P., Hanly, J.A., Moynagh, P.N., 2005. Pellino3 is a novel upstream regulator of p38 MAPK and activates CREB in a p38-dependent manner. J. Biol. Chem. 280, 27759–27768. Chen, Y.H., Jia, X.T., Huang, X.D., Zhang, S., Li, M., Xie, J.F., et al., 2011. Two Litopenaeus vannamei HMGB proteins interact with transcription factors LvSTAT and LvDorsal to activate the promoter of white spot syndrome virus immediateearly gene ie1. Mol. Immunol. 48, 793–799. Grosshans, J., Schnorrer, F., Nusslein-Volhard, C., 1999. Oligomerisation of Tube and Pelle leads to nuclear localisation of dorsal. Mech. Dev. 81, 127–138. Haghayeghi, A., Sarac, A., Czerniecki, S., Grosshans, J., Schock, F., 2010. Pellino enhances innate immunity in Drosophila. Mech. Dev. 127, 301–307. Ho, S.H., Song, Y.L., 2009. Cloning of penaeidin gene promoter in tiger shrimp (Penaeus monodon). Fish Shellfish Immunol. 27, 73–77. Huang, X.D., Yin, Z.X., Liao, J.X., Wang, P.H., Yang, L.S., Ai, H.S., et al., 2009. Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immunol. 27, 230–238. Huang, X.D., Yin, Z.X., Jia, X.T., Liang, J.P., Ai, H.S., Yang, L.S., et al., 2010. Identification and functional study of a shrimp Dorsal homologue. Dev. Comp. Immunol. 34, 107–113. Huang, X.D., Zhao, L., Zhang, H.Q., Xu, X.P., Jia, X.T., Chen, Y.H., et al., 2010. Shrimp NF-kappaB binds to the immediate-early gene ie1 promoter of white spot syndrome virus and upregulates its activity. Virology 406, 176–180. Huggenvik, J.I., Michelson, R.J., Collard, M.W., Ziemba, A.J., Gurley, P., Mowen, K.A., 1998. Characterization of a nuclear deformed epidermal autoregulatory factor-1 (DEAF-1)-related (NUDR) transcriptional regulator protein. Mol. Endocrinol. 12, 1619–1639. Jiang, Z., Johnson, H.J., Nie, H., Qin, J., Bird, T.A., Li, X., 2003. Pellino 1 is required for interleukin-1 (IL-1)-mediated signaling through its interaction with the IL-1 receptor-associated kinase 4 (IRAK4)-IRAK-tumor necrosis factor receptorassociated factor 6 (TRAF6) complex. J. Biol. Chem. 278, 10952–10956. Johnson, M.W., Everest, F.A., Young, R.W., 1947. The role of snapping shrimp (Crangon and Synalpheus) in the production of underwater noise in the sea. Biol. Bull. 93, 122–138. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., et al., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947– 2948. Li, F., Xiang, J., 2013. Recent advances in researches on the innate immunity of shrimp in China. Dev. Comp. Immunol. 39, 11–26. Li, C., Chen, Y.X., Zhang, S., Lu, L., Chen, Y.H., Chai, J., et al., 2012a. Identification, characterization, and function analysis of the Cactus gene from Litopenaeus vannamei. PLoS One 7, e49711. Li, C., Weng, S., Chen, Y., Yu, X., Lu, L., Zhang, H., et al., 2012b. Analysis of Litopenaeus vannamei transcriptome using the next-generation DNA sequencing technique. PLoS One 7, e47442. Li, C., Chen, Y., Weng, S., Li, S., Zuo, H., Yu, X., et al., 2014. Presence of Tube isoforms in Litopenaeus vannamei suggests various regulatory patterns of signal transduction in invertebrate NF-kappaB pathway. Dev. Comp. Immunol. 42, 174–185. Lunz Jr., G.R., 1935. Notes on the common shrimp. Science 81, 436. Mendoza, H., Campbell, D.G., Burness, K., Hastie, J., Ronkina, N., Shim, J.H., et al., 2008. Roles for TAB1 in regulating the IL-1-dependent phosphorylation of the

TAB3 regulatory subunit and activity of the TAK1 complex. Biochem. J. 409, 711–722. Moynagh, P.N., 2009. The Pellino family: IRAK E3 ligases with emerging roles in innate immune signalling. Trends Immunol. 30, 33–42. O’Leary, N.A., Gross, P.S., 2006. Genomic structure and transcriptional regulation of the penaeidin gene family from Litopenaeus vannamei. Gene 371, 75–83. O’Neill, L.A., Golenbock, D., Bowie, A.G., 2013. The history of toll-like receptors – redefining innate immunity. Nat. Rev. Immunol. 13, 453–460. Ordureau, A., Enesa, K., Nanda, S., Le Francois, B., Peggie, M., Prescott, A., et al., 2013. DEAF1 is a Pellino1-interacting protein required for interferon production by Sendai virus and double-stranded RNA. J. Biol. Chem. 288, 24569–24580. Reed, D.E., Huang, X.M., Wohlschlegel, J.A., Levine, M.S., Senger, K., 2008. DEAF-1 regulates immunity gene expression in Drosophila. Proc. Natl. Acad. Sci. USA 105, 8351–8356. Roach, J.C., Glusman, G., Rowen, L., Kaur, A., Purcell, M.K., Smith, K.D., et al., 2005. The evolution of vertebrate toll-like receptors. Proc. Natl. Acad. Sci. USA 102, 9577–9582. Schauvliege, R., Janssens, S., Beyaert, R., 2006. Pellino proteins are more than scaffold proteins in TLR/IL-1R signalling: a role as novel RING E3-ubiquitinligases. FEBS Lett. 580, 4697–4702. Schauvliege, R., Janssens, S., Beyaert, R., 2007. Pellino proteins: novel players in TLR and IL-1R signalling. J. Cell. Mol. Med. 11, 453–461. Takeda, K., Akira, S., 2004. TLR signaling pathways. Semin. Immunol. 16, 3–9. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Wang, P.H., Gu, Z.H., Wan, D.H., Zhang, M.Y., Weng, S.P., Yu, X.Q., et al., 2011. The shrimp NF-kappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371. PLoS One 6, e24773. Wang, P.H., Liang, J.P., Gu, Z.H., Wan, D.H., Weng, S.P., Yu, X.Q., et al., 2012. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev. Comp. Immunol. 36, 359–371. Wang, P.H., Wan, D.H., Gu, Z.H., Qiu, W., Chen, Y.G., Weng, S.P., et al., 2013. Analysis of expression, cellular localization, and function of three inhibitors of apoptosis (IAPs) from Litopenaeus vannamei during WSSV infection and in regulation of antimicrobial peptide genes (AMPs). PLoS One 8, e72592. Wang, P.H., Yang, L.S., Gu, Z.H., Weng, S.P., Yu, X.Q., He, J.G., 2013. Nucleic acidinduced antiviral immunity in shrimp. Antiviral Res. 99, 270–280. Xiao, H., Qian, W., Staschke, K., Qian, Y., Cui, G., Deng, L., et al., 2008. Pellino 3b negatively regulates interleukin-1-induced TAK1-dependent NF kappaB activation. J. Biol. Chem. 283, 14654–14664. Yang, L.S., Yin, Z.X., Liao, J.X., Huang, X.D., Guo, C.J., Weng, S.P., et al., 2007. A Toll receptor in shrimp. Mol. Immunol. 44, 1999–2008. Zhang, S., Li, C.Z., Yan, H., Qiu, W., Chen, Y.G., Wang, P.H., et al., 2012. Identification and function of myeloid differentiation factor 88 (MyD88) in Litopenaeus vannamei. PLoS One 7, e47038. Ziegler, A., Lange, S., Bender, R., 2007. Survival analysis: log rank test. Dtsch. Med. Wochenschr. 132 (Suppl. 1), e39–e41.