G Model

ARTICLE IN PRESS

BIOMAC 5042 1–7

International Journal of Biological Macromolecules xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Penicillin V acylase from Pectobacterium atrosepticum exhibits high specific activity and unique kinetics

1

2

V.S. Avinash, Sureshkumar Ramasamy, C.G. Suresh, Archana Pundle ∗

3

Q1

4

Q2 Biochemical Sciences Division, National Chemical Laboratory, Dr Homi Bhabha road, Pune – 411008, India

5

6 20

a r t i c l e

i n f o

a b s t r a c t

7 8 9 10 11 12

Article history: Received 11 December 2014 Received in revised form 7 April 2015 Accepted 9 April 2015 Available online xxx

13

19

Keywords: Penicillin V acylase Gram-negative Cooperative Enzyme kinetics Substrate inhibition

21

1. Introduction

14 15 16 17 18

Penicillin V acylases (PVAs, E.C.3.5.11) belong to the Ntn hydrolase super family of enzymes that catalyze the deacylation of the side chain from phenoxymethyl penicillin (penicillin V). Penicillin acylases find use in the pharmaceutical industry for the production of semi-synthetic antibiotics. PVAs employ the N-terminal cysteine residue as catalytic nucleophile and are structurally and evolutionarily related to bile salt hydrolases (BSHs). Here, we report the cloning and characterization of a PVA enzyme from the Gram-negative plant pathogen, Pectobacterium atrosepticum (PaPVA). The enzyme was cloned and expressed in Escherichia coli attaining a very high yield (250 mg/l) and a comparatively high specific activity (430 IU/mg). The enzyme showed marginally better pH and thermo-stability over PVAs characterized from Gram-positive bacteria. The enzyme also showed enhanced activity in presence of organic solvents and detergents. The enzyme kinetics turned out to be significantly different from that of previously reported PVAs, displaying positive cooperativity and substrate inhibition. The presence of bile salts had a modulating effect on PaPVA activity. Sequence analysis and characterization reveal the distinctive nature of these enzymes and underscore the need to study PVAs from Gram-negative bacteria. © 2015 Published by Elsevier B.V.

Q3 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Penicillin acylases (E.C.3.5.1.11) cleave the acyl side chain of the beta-lactam antibiotics (penicillins and cephalosporins) to generate pharmaceutical intermediates 6-amino penicillanic acid (6-APA) or 7-acetoxy cephalosporanic acid (7-ACA) respectively [1]. Penicillin acylases preferentially hydrolyze benzyl penicillin (Pen G) or phenoxymethyl penicillin (Pen V). Penicillin G acylase (PGA) from Escherichia coli (EcPGA) has been used in the pharmaceutical industry for production of semi-synthetic antibiotics, peptide synthesis and resolution of racemic mixtures [2]. Penicillin V acylases (PVAs) have been reported to be more stable in acidic pH range and effective with higher substrate concentrations [3] which makes them better suitable for industrial use. However, the use of PVA-Pen V combination in industry is limited by the slightly higher cost of substrate and due to the non-availability of large amount of active acylase enzyme preparations. Penicillin acylases are members of the Ntn hydrolase protein superfamily [4,5], characterized by a catalytic N-terminal residue and a common ␣␤␤␣-fold. Although most Ntn hydrolases have similar active site geometry, they share a fairly low sequence and

∗ Corresponding author. Tel.: +91 20 25902324. E-mail address: [email protected] (A. Pundle).

structural homology. For instance, PGAs possess a heterodimeric subunit organization, as do cephalosporin acylases and ␥-glutamyl transpeptidases [6]; while PVAs and bile salt hydrolases (BSH) share a homotetrameric structure [7]. Ntn hydrolases are often produced as proenzymes which undergo autocatalytic processing [8] to generate the catalytically active enzyme. PGAs are synthesized as a single polypeptide with a leading periplasmic signal peptide and the ␣ and ␤ chains separated by a spacer peptide, and the processing mechanism releases the N-terminal serine for catalysis [4]. The processing mechanism of PVAs is simpler [9]; the nucleophilic cysteine is exposed by the removal of the starting methionine or the MLG tripeptide as in the case of Bacillus sphaericus. Kovacikova et al. [10] have reported the occurrence of a periplasmic signal peptide in Gram-negative PVA homologues. Ntn hydrolases have also been known to act on a wide range of substrates [11], and often show cross-reactivity. For instance, penicillin acylases have recently been reported to hydrolyze acyl homoserine lactones involved in quorum sensing, albeit at a slower rate [12]. AHL acylases including AhlM from Streptomyces sp. [13] and PA0305 from Pseudomonas aeruginosa [14] show minimal activity on pen G and pen V, respectively. Although the concrete physiological role of penicillin acylases is not understood, their broad substrate spectrum has led to hypotheses on their involvement in bacterial cell signalling and nutrient scavenging [15].

http://dx.doi.org/10.1016/j.ijbiomac.2015.04.036 0141-8130/© 2015 Published by Elsevier B.V.

Please cite this article in press as: V.S. Avinash, et al., Int. J. Biol. Macromol. (2015), http://dx.doi.org/10.1016/j.ijbiomac.2015.04.036

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

G Model BIOMAC 5042 1–7

V.S. Avinash et al. / International Journal of Biological Macromolecules xxx (2015) xxx–xxx

2 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96

97

98

99 100 101 102 103 104 105 106 107 108 109 110

111

112 113 114 115 116 117 118 119 120 121 122 123 124 125

ARTICLE IN PRESS

Pen V acylases share common evolutionary ancestry with bile salt hydrolases (BSH); together, they make up the cholylglycine hydrolase group [7]. BSHs occur mostly in intestinal microbiota and confer resistance against the anti-microbial activity of bile; they are also implicated in the virulence of certain pathogens [16,17]. PVAs possess longer loop elements surrounding the active site, restricting its size to better bind the smaller pen V molecule, as opposed to the bulky steroid groups of bile salts [7]. Biophysical and structural characterization of PVAs and BSHs has been so far restricted to Gram-positive bacteria. Structures are available for PVAs from B. sphaericus (BspPVA) [5] and Bacillus subtilis (BsuPVA) [18]. BspPVA can also hydrolyze bile salts like glycodeoxycholate (GDCA) to a small extent (20% of pen Vhydrolyzing activity), while BsuPVA is specific for pen V [7]. When trying to classify enzymes of cholylglycine hydrolase group based on substrate preference, Lambert et al. [19] and Panigrahi et al. [20] have noted the low sequence homology between those from Gram-positive, Gram-negative bacteria and Archaea, even though they carry out similar reactions. Such studies raise the possibility that PVA homologues from Gram-negative bacteria might show different biochemical and structural characteristics from their counterparts from Bacillus sp. We had previously modelled a PVA (PaPVA) from the Gram-negative plant pathogen, Pectobacterium atrosepticum [21] and reported its exclusive substrate specificity towards Pen V and inhibition by bile salts. In this paper, we report its cloning, over-expression and detailed biochemical characterization. The enzyme displayed unusually high expression in soluble form, and exhibited many fold higher specific activity than that of any known PVA reported till date. Characterization of PaPVA and other Gram-negative homologues would help both in industrial application of PVAs and understanding their substrate spectrum. 2. Materials and methods 2.1. Materials Bile salts, guanidine hydrochloride (Gd HCl), Pen V (potassium salt), phenoxy acetic acid (POAA) and HIS-Select matrix were procured from Sigma (USA). ENrichTM SEC 650 column and molecular weight markers were from BioRad. The synthetic substrate 2-nitro 5-(phenoxyacetamido)-benzoic acid (NIPOAB) was synthesized using the method of Kerr [22] using the Schotten–Baumann reaction from 2-nitrobenzoic acid and phenoxyacetyl chloride (Sigma). Guanidine hydrochloride (GdHCl) prepared as 8 M stock was filtered before use. All DNA manipulation enzymes were procured from New England Biolabs (NEB). DNA isolation and purification kits, cloning plasmids and E. coli strains were from Invitrogen (USA). P. atrosepticum was obtained from DSMZ, Germany (DSM 30186). 2.2. Cloning of pva gene from P. atrosepticum The pva gene from P. atrosepticum (annotated as cholylglycine hydrolase) was amplified from genomic DNA using the primers (restriction sites in italics) – PatF (ggctagacatgtgtacgcggttcgtttatctggatcc) and PatR (caatatctcgagccccgcgaattcaaacg). PCR was performed in a gradient thermocycler using conditions: 94 ◦ C/5 min, 30 cycles of [94 ◦ C/30 s, 52 ◦ C/30 s, 68 ◦ C/60 s] and final extension 68 ◦ C/10 min. Restriction digestion was carried out using NcoI and XhoI for plasmid pET 28b and PciI and XhoI for insert DNA to generate compatible ends. After 4 h at 37 ◦ C, the DNA was eluted from 1% agarose gel and ligated at 16 ◦ C for 12 h. The ligation mixture was transformed into E. coli DH5␣ cells and selected on LB agar containing 35 ␮g/ml kanamycin. Colonies were screened for recombinant plasmids using colony PCR and the gene was sequenced using T7

promoter and confirmed to be in-frame to the vector. The plasmid pET28b-PaPVA was then re-transformed into E. coli BL21 star cells for expression using standard calcium transformation procedures [23]. 2.3. Expression and purification of PaPVA E. coli BL21 star cells containing pET28b-PaPVA were grown in LB medium containing 35 ␮g/ml kanamycin at 37 ◦ C and 200 rpm for 2–3 h. At O.D. ∼ 0.6, protein production was induced by adding 0.2 mM IPTG and culture was transferred to 27 ◦ C for overnight incubation (14 h). The cells were harvested and sonicated in lysis buffer containing 25 mM TrisCl pH 7.0, 300 mM NaCl, 10 mM MgCl2 and 2 mM ␤-mercaptoethanol. The expression of PaPVA enzyme in soluble fraction was confirmed using SDS–PAGE and PVA activity assay. For purification, 1 g E. coli-PaPVA cells were sonicated in binding buffer and the clarified supernatant was loaded on a HIS-Select Ni2+ -affinity column equilibrated with the same buffer. After washing unbound proteins, PaPVA was eluted using 250 mM imidazole. The eluted protein fractions were dialyzed extensively against 20 mM acetate buffer pH 5.2 containing 100 mM NaCl and 1 mM DTT and stored at 4 ◦ C. Protein concentrations were determined using Bradford method [24] and purity was confirmed using SDS–PAGE [25]. 2.4. Determination of molecular weight The protein was subjected to SDS–PAGE on a 12% polyacrylamide gel with molecular weight markers (BioRad) and stained using Coomassie Brilliant Blue. The subunit molecular weight was ascertained using Matrix-associated laser desorption ionization-mass spectrometry (MALDI, Perkin-Elmer) using a sinapinic acid matrix. To determine the native molecular weight of PaPVA, 200 ␮l of protein (7 mg/ml) was run on size exclusion chromatography column (ENrichTM SEC column, 10 × 300 mm) using a BioRad NGCTM 10 Medium-pressure chromatography system. A similar experiment was used to test the effect of 1 M Guanidine hydrochloride (GdHCl) on the enzyme. 2.5. Sequence analysis The sequence of PaPVA gene was retrieved from the full genome sequence of P. atrosepticum in GenBank database (Eca3205, NCBI Gene ID: 2881437). Multiple sequence alignment with other reported cholylglycine hydrolase sequences was carried out using Clustal W [26]. 2.6. Enzyme activity assay PVA activity was determined by measuring the amount of 6aminopenicillanic acid (6-APA) formed from Penicillin V using pdimethyl amino benzaldehyde [27]. The reaction was carried out for 5 min with 1.2 ␮M enzyme and 50 mM pen V in 100 mM acetate buffer pH 5.0 at 45 ◦ C. One unit (IU) of PVA activity was defined as the amount of enzyme required to liberate 1 ␮mol of 6-APA per min under the mentioned assay conditions. In the case of NIPOAB used as substrate, the enzyme was added to 1 ml of 2 mM substrate (2% DMSO effective concentration). 2.7. Effect of pH, temperature and GdHCl on PaPVA activity and stability The PVA activity was assayed (as detailed above) at different pH values from 4.0 to 9.0 and temperatures (20–70 ◦ C) to ascertain the optimum conditions for enzyme activity.

Please cite this article in press as: V.S. Avinash, et al., Int. J. Biol. Macromol. (2015), http://dx.doi.org/10.1016/j.ijbiomac.2015.04.036

126 127 128 129

130

131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148

149

150 151 152 153 154 155 156 157 158 159 160

161

162 163 164 165 166

167

168 169 170 171 172 173 174 175 176

177 178

179 180 181

G Model

ARTICLE IN PRESS

BIOMAC 5042 1–7

V.S. Avinash et al. / International Journal of Biological Macromolecules xxx (2015) xxx–xxx 182 183 184 185 186 187 188 189 190 191 192 193 194

195

196 197 198 199 200 201 202 203 204 205

206

PaPVA stability was studied by incubating the protein in 20 mM acetate buffer pH 5.0 for 2 h at different temperatures from 30 to 90 ◦ C, and assaying for activity at 45 ◦ C after different time intervals. Effect of pH on enzyme stability was studied by incubating the protein in 100 mM buffers of different pH (1–11) for 4 h at 25 ◦ C and assaying the residual activity. Buffers used were: HCl-KCl (pH 1–2), acetate (3–6), phosphate (7–8), Tris (8–9) and carbonatebicarbonate (10–11). All buffers were freshly prepared with pH adjusted at room temperature and filtered before use. The enzyme was also incubated with increasing concentrations of GdHCl for 4 h to study its unfolding effect. Renaturation experiments were conducted by diluting the GdHCl concentration 10 times and incubating for 1 h at 25 ◦ C before checking the activity.

2.8. Effect of protein modifiers on enzyme activity PaPVA was extensively dialyzed to remove additives and incubated (20 ␮g) with reducing agent DTT and metal-chelating agent ethylene diamine tetraacetic acid (EDTA) in a 100 ␮l reaction mixture for 30 min at 25 ◦ C. Enzyme activity was assayed after incubation; untreated enzyme served as control. The effect of divalent metal ions and detergents was studied using similar experiments. Solvents were incorporated at different concentrations into the assay mixture to study their effect on enzyme activity. All experiments were performed independently in triplicates and results expressed as averages with