Peptidylprolyl Isomerase Pin1 Directly Enhances the DNA Binding Functions of Estrogen Receptor α.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 290, NO. 22, pp. 13749 –13762, May 29, 2015 © 2015 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

Peptidylprolyl Isomerase Pin1 Directly Enhances the DNA Binding Functions of Estrogen Receptor ␣* Received for publication, November 13, 2014, and in revised form, April 2, 2015 Published, JBC Papers in Press, April 12, 2015, DOI 10.1074/jbc.M114.621698

Prashant Rajbhandari‡1, Mary Szatkowski Ozers‡1, Natalia M. Solodin‡, Christopher L. Warren§, and Elaine T. Alarid‡2 From the ‡McArdle Laboratories for Cancer Research, Department of Oncology and University of Wisconsin Carbone Comprehensive Cancer Center, University of Wisconsin, Madison, Wisconsin 53705 and §Proteovista LLC, Madison, Wisconsin 53719

The transcriptional activity of estrogen receptor ␣ (ER␣), the key driver of breast cancer proliferation, is enhanced by multiple cellular interactions, including phosphorylation-dependent interaction with Pin1, a proline isomerase, which mediates cistrans isomerization of the N-terminal Ser(P)118-Pro119 in the intrinsically disordered AF1 (activation function 1) domain of ER␣. Because both ER␣ and Pin1 have multiple cellular partners, it is unclear how Pin1 assists in the regulation of ER␣ transactivation mechanisms and whether the functional effects of Pin1 on ER␣ signaling are direct or indirect. Here, we tested the specific action of Pin1 on an essential step in ER␣ transactivation, binding to specific DNA sites. DNA binding analysis demonstrates that stable overexpression of Pin1 increases endogenous ER␣ DNA binding activity when activated by estrogen but not by tamoxifen or EGF. Increased DNA binding affinity is a direct effect of Pin1 on ER␣ because it is observed in solutionbased assays with purified components. Further, our data indicate that isomerization is required for Pin1-modulation of ER␣DNA interactions. In an unbiased in vitro DNA binding microarray with hundreds of thousands of permutations of ER␣-binding elements, Pin1 selectively enhances the binding affinity of ER␣ to consensus DNA elements. These studies reveal that Pin1 isomerization of phosphorylated ER␣ can directly regulate the function of the adjacent DNA binding domain, and this interaction is further modulated by ligand binding in the ligand-binding domain, providing evidence for Pin1-dependent allosteric regulation of ER␣ function.

* This work was supported, in whole or in part, by National Institutes of Health Grants CA159578 (to E. T. A.) and T32 CA009135 (to P. R.). This work was also supported by Department of Defense Concept Award W81XWH-09-10581 (to M. S. O.). M. S. O. is a founder of Proteovista LLC. 1 Both authors contributed equally to this work. 2 To whom correspondence should be addressed: Dept. of Oncology, University of Wisconsin Carbone Comprehensive Cancer Center, University of Wisconsin, 6151 Wisconsin Institute for Medical Research, 1111 Highland Ave., Madison, WI 53705. Tel.: 608-265-9319; Fax: 608-262-2824; E-mail: [email protected].

MAY 29, 2015 • VOLUME 290 • NUMBER 22

ER␣,3 a key driver of proliferation in breast cancer cells, is a member of the nuclear receptor (NR) superfamily of transcription factors and activates gene programs by interacting with transcriptional coregulators, components of the RNA polymerase II complex, and, importantly, DNA. ER␣ binds a palindromic DNA consensus sequence (5⬘-AGGTCANNNTGACCT-3⬘, where N is any nucleotide) known as an estrogen response element (ERE) (1–4). The centrally located DNA-binding domain (DBD) of ER␣ is flanked by two transactivation domains, AF1 in the N terminus and AF2 in the ligand-binding C-terminal domain (LBD) (5, 6). The ligand-dependent AF2 regulates ER␣ transcriptional function by acting as a hub for coregulator interactions, and these interactions can affect DNA binding capacity (7–9). On the other hand, AF1 resides in the N-terminal region of ER␣ and is predominantly governed via phosphorylation by multiple kinases (10 –16). Although sequences at the N terminus are important for both ligand-dependent and ligand-independent activation of ER␣, how signals originating from the N terminus translate into differences in ER␣ transactivation and DNA binding function remain poorly understood. Historically, NRs were thought to be composed of semiautonomous protein domains, such as the LBD and DBD, that independently carried out functions for ligand binding and DNA interactions, respectively. However, recent crystal and solution structural studies of full-length NRs highlight the signaling convergence of several NR domains via interactive protein surfaces (17, 18). These structures have confirmed an ever-growing body of work, indicating that the AF1, DBD, and LBD/AF2 serve as hubs of allosterically mediated intraprotein communication for several NRs. This complex interplay incor-

3

The abbreviations used are: ER␣, estrogen receptor-␣; NR, nuclear receptor; DBD, DNA-binding domain; LBD, ligand-binding domain; ERE, estrogen response element; mERE, mutated ERE; E2, 17␤-estradiol; OHT, 4-hydroxytamoxifen; ID, intrinsically disordered; SNAP, specificity and affinity for protein; FP, fluorescence polarization; SSL, sequence specificity landscape; AF, activation function 1 and 2, respectively; Seq, sequence; TBP, TATA-binding protein; CREB, cAMP-response element-binding protein.

JOURNAL OF BIOLOGICAL CHEMISTRY

13749

Downloaded from http://www.jbc.org/ at NYU School of Medicine Library on July 21, 2015

Background: Estrogen receptor ␣ (ER␣) activity in breast cancer cells is increased by Pin1, an isomerase that alters protein conformation. Results: Pin1-mediated isomerization increases ER␣ DNA binding affinity. Conclusion: Pin1 allosterically regulates ER␣ DNA binding directly via isomerization of phosphorylated receptor. Significance: Pin1 regulation of ER␣ provides a framework for understanding regulation by intrinsically disordered domains on transcription factor function.

Regulation of ER␣ DNA Binding Activity by Pin1

13750 JOURNAL OF BIOLOGICAL CHEMISTRY

TABLE 1 Sequence for EMSA probes Probe name

Sequence

ERE sense ERE antisense mERE sense mERE antisense

AGCTTCGCGGCGGTCACAGTGACCCTGGAGCG CGCTCCAGGTCAC AGCTTCGAGGAGATCACAGTGATCTGGAGCG CGCTCCAGATCAC

ER␣ transcriptional regulation and describe a new approach for refined definition of components within large transcription factor complexes.

Experimental Procedures Cell Culture and Treatments—MCF7 cells and MCF7 cells stably overexpressing GFP-Pin1 and GFP (25) were maintained in DMEM (Life Technologies, Inc.), 10% fetal bovine serum (FBS; Hyclone), and 1% penicillin-streptomycin (Life Technologies) at 37 °C and 10% CO2. In experiments involving treatments with 0.1% EtOH (vehicle), 10 nM 17␤-estradiol (E2; Steraloids, Inc.), or 100 nM 4-hydrotamoxifen (OHT), cells were placed in estrogen-depleted phenol-red free medium consisting of 10% dextran-charcoal-stripped FBS for 3 days prior to the addition of hormone or vehicle. For EGF treatments, the medium was changed to phenol red-free DMEM or Opti-MEM (Life Technologies) overnight prior to treatment. The treatments were carried out for the times indicated in the figure legends. Western Blot and Antibodies—Western blot was performed as described (25). ER␣ antibody (Santa Cruz Biotechnology, Inc.) was used to detect purified and endogenous ER␣. Antibody directed against Ser(P)118 ER␣ (Cell Signaling) was used to detect Ser(P)118-ER␣. Pin1 antibody (Epitome) was used to detect purified and endogenous Pin1. Detection of actin with an anti-actin antibody (Sigma) was used as loading control. Electrophoretic Mobility Shift Assay (EMSA)—ERE and mutated ERE (mERE) probes listed in Table 1 were annealed as 32-mer sense (0.5 ␮g) and 13-mer antisense (0.2 ␮g) in solution containing 10⫻ Klenow buffer in 100 ␮l of H2O at 90 °C and slow cooled to room temperature. An extension reaction was then performed to fill the overhang in a 200-␮l reaction containing 100 ␮l of annealed oligonucleotide, 4 ␮l of 10 mM dNTP (2.5 mM concentration of each: dATP, dCTP, dGTP, and dTTP), 10 ␮l of 10⫻ Klenow buffer, 5 ␮l of Klenow polymerase (New England Biolabs), and H2O. This mixture was incubated at 16 °C overnight. Unincorporated dNTPs were removed by passing the mixture through a G-50 column twice. To end-label probes with radioactive 32P, 20 ng of reannealed oligonucleotides were mixed with 2 ␮l of 10⫻ T3 PNK buffer, 1 ␮l of 0.1 M DTT, 1 ␮l of T4 PNK (New England Biolabs), and the final volume was brought up to 18 ␮l by adding H2O. Two ␮l of [␥-32P]ATP (6,000 Ci/mmol) was then added to the reaction and incubated for 4 h at 37 °C. Unincorporated 32P was removed by passing the reaction through a G-50 column twice. Afterward, TE buffer (10 mM Tris-Cl, pH 8.0, 1 mM EDTA) was added to the purified reaction to a final volume of 50 –100 ␮l and stored at ⫺20 °C. University of Wisconsin (Madison, WI) radioactive safety guidelines were strictly followed during these procedures. VOLUME 290 • NUMBER 22 • MAY 29, 2015


porates kinase and protein-protein interactions via the AF1 domain, ligand binding and coregulator interactions at the LBD, and DNA interactions at the DBD. The AF1 domain of ER␣ is an intrinsically disordered (ID) domain. Although ID domains lack a specific identifying motif or secondary structure, they play key roles in post-translational modifications, protein-protein interactions, and allosteric control (19 –21). By virtue of their unstructured characteristics, ID domains are difficult to study, yet AF1 has been shown to provide an interaction surface for coregulator proteins (10, 22–25). An understanding of the interactions in ID domains could provide a mechanistic window to better understand the allosteric role of unstructured domains in transcriptional signaling (26). Pin1 is a peptidylprolyl isomerase that binds to Ser(P)/ Thr(P)-Pro through its WW domains and catalyzes the cis/ trans-isomerization of the Ser(P)/Thr(P)-Pro bond through its prolyl isomerase domain (27–29). Phosphorylation-dependent isomerization by Pin1 affects diverse cellular processes, such as protein-protein interactions, subcellular localization, dephosphorylation, and transcription (30). We previously identified cis-trans isomerization of the Ser(P)118–Pro119 bond in AF1 by Pin1 as a novel post-translational modification regulating ER␣ conformation, protein stability, and transcriptional function (25, 31). Ser118 in the AF1 region of ER␣ is a major site of phosphorylation by proline-directed kinases in response to estrogen, growth factors, and anti-estrogens, such as tamoxifen (11– 15). Ser118 phosphorylation (Ser(P)118) also plays an important role in ER␣ transcriptional function (12, 25, 32, 33). Our studies indicate that high levels of Pin1 expression are associated with worse outcomes in ER␣⫹ breast tumors as well as increased ER␣ signaling and transcriptional activity (25, 31). Pin1 is recruited to phosphorylated ER␣ at Ser118 in response to estrogen, tamoxifen, and EGF (25). Pin1 enhances ER␣-mediated transcription induced by estrogen and tamoxifen and increases ER␣ dimerization. These previous studies also showed that the Pin1-mediated increase in ER␣ transcriptional activity was mediated through the AF1 domain (25). Collectively, these studies establish Pin1 as an AF1 binding partner that enhances ER␣ transcriptional function. Multiple potential mechanisms have been proposed to describe Pin1 regulation of ER␣ transcriptional function, highlighting the complexity of Pin1 activity on ER␣ signaling. Like ER␣, Pin1 binds multiple components of transcriptional complexes, including RNA polymerase II, histones, general transcription factors, and ER␣ coactivators and corepressors (34 – 38). Moreover, Pin1 alters signaling in breast cancer cells that can indirectly influence ER␣ activity (34, 36, 39 – 41). Hence, traditional cell-based approaches to elucidate Pin1 activity on ER␣-mediated transcription are confounded by the potential for both direct and indirect effects. Therefore, to focus specifically on direct effects of Pin1 on ER␣ function, we examined how Pin1 binding and isomerization might affect ER␣ DNA binding activity. To enable direct analysis of DNA binding affinity and sequence specificity, we used purified proteins and an unbiased approach on the scale of 385,000 DNA sequences, providing a mechanistic readout of Pin1-mediated effects on ER␣ DNA binding in the process. Together, the data provide novel insights into the roles of phosphorylation and Pin1 on



Arrays were performed in duplicate. The data from the arrays were extracted using NimbleScan 2.4 (Roche Applied Science), and the data were processed as described previously (44, 45). Fluorescence Polarization (FP)—SNAP microarray results were verified using individual DNA sequences in FP assays. Dilutions of ER␣, either alone or with a 10-fold molar excess of Pin1 or Pin1 starting concentration, as noted in the legend, were preincubated at 30 °C for 20 min in a 96-well plate (Corning 3676). Fluorescein-labeled, hairpinned DNA (IDT Technologies; core sequences shown in Fig. 5) was added to a final concentration of 1 nM, and the plate was incubated for an additional 10 min at 30 °C. To avoid quenching of the fluorescein label by the 5⬘G of the array DNA probe, a T nucleotide was included at the 5⬘-end of the 53-mer DNA sequences (Seq1, Seq2, and Seq3). The mERE had the sequence, 5⬘-TGCGGTGAGACACAGGGTTTCGCTGCGGAGCAGCGAAACCCTGTGTCTCACCGC-3⬘, where the mutated ERE is in boldface type. The core sequence that was altered between different probes is underlined within the adjacent backbone separated by a GGA loop in the hairpin. FP was measured using a Safire2 plate reader (Tecan), and the data were analyzed by sigmoidal dose response (variable slope) using Prism (GraphPad) to yield the dissociation constant (Kd). Chromatin Immunoprecipitation (ChIP)—MCF7 cells overexpressing Pin1 or vector were treated with E2 for the indicated times periods, followed by chromatin cross-linking, lysis, fragmentation, immunoprecipitation, and quantitative real-time RT-PCR as described previously (33, 46). ER␣ was immunoprecipitated using ER␣ (HC-20, SC-543) antibody (Santa Cruz Biotechnology). Quantitative real-time RT-PCR was carried out with 1 ␮l of input or 4 ␮l of immunoprecipitated sample and 200 nM forward and reverse primers (primer sequences available upon request). Data are calculated as percentage of input by the ⌬⌬Ct method. Protein Purification—GST-tagged Pin1 and K63A Pin1-expressing plasmids (gifts from Dr. Kun Ping Lu, Harvard Medical School) were transformed into Escherichia coli BL21 (pLysS) cells (Novagen). Proteins were purified as described previously (29). To cleave the GST tag, proteins were incubated with thrombin (Sigma) solution overnight at 4 °C. The eluted fractions were combined and buffer-exchanged with 50 mM TrisCl, pH 8.0, 200 mM NaCl, and 10% glycerol using 10,000 kDa cut-off centrifugal filters (Millipore). The level of protein purity was assessed using SDS-PAGE stained with Coomassie Brilliant Blue (Bio-Rad). In Vitro Dephosphorylation Assay—This assay was carried out as described previously with modifications (25). Purified ER␣ (Life Technologies) was incubated with 50 ng of purified trans-specific PP2A holoenzyme (a gift from Dr. Yongna Xing, University of Wisconsin (Madison, WI)) and 1 ␮g of purified BSA (control) or Pin1 in dephosphorylation buffer (50 mM TrisCl, pH 7.5, 50 mM NaCl, 50 ␮M MnCl2) at 30 °C for 0 –90 min. The reaction was terminated with 2⫻ SDS sample buffer at the indicated times, and phosphorylation was assessed by Western blot using Ser(P)118 ER␣-specific antibody. Equivalent loading was confirmed by reprobing with ER␣-specific antibody. Statistical Analysis—Student’s paired t tests and analysis of variance were performed using GraphPad Prism (GraphPad JOURNAL OF BIOLOGICAL CHEMISTRY

13751


Cells were treated as indicated in the figure legends and harvested. Cells were pelleted and resuspended in 100 ␮l of buffer A (10 mM HEPES, pH 7.8, 10 mM KCl, 1.5 mM MgCl2) supplemented freshly with 0.5 mM PMSF, 10 ␮g/ml aprotinin, 0.1% Nonidet P-40, and 1 mM DTT. Cells were then incubated on ice for 30 min and spun down for 1 min at 13,000 rpm and 4 °C. The supernatant (cytoplasmic fraction) was moved to a new tube. For nuclei lysis, the pellet was dissolved in 50 ␮l of buffer C (20 mM HEPES, pH 7.8, 450 mM NaCl, 0.2 mM EDTA, 1.5 mM MgCl2, 25% glycerol) supplemented with 0.5 mM PMSF, 10 ␮g/ml aprotinin, and 0.5 mM DTT. The lysis reaction was incubated on ice for 30 min and spun down for 10 min at 13,000 rpm and 4 °C. Supernatants were transferred to new tubes, and protein concentrations were measured by Bradford assay (Bio-Rad). The EMSA was performed using fresh nuclear extracts or purified proteins. For cell studies, 10 ␮g of nuclear extract was incubated with 2 ␮l of 5⫻ binding buffer (375 mM NaCl, 75 mM Tris-Cl, pH 7.5, 7.5 mM EDTA, 20% glycerol, 100 ␮g/ml BSA), 1.5 mM DTT, 1 ␮l of poly(dI-dC) (Sigma), and H2O was added up to a volume of 9 ␮l on ice. ER␣ supershifts were performed with 2– 4 ␮l of ER␣ antibody Ab712 (42). For in vitro EMSA, purified ER␣ (Life Technologies or Pierce) was used in the presence and absence of Pin1, Pin1 K63A, or juglone (Sigma) and incubated at 30 °C for 30 min. One ␮l of 32P-end-labeled probe was added to the reaction and further incubated at room temperature for 20 min. Afterward, samples were loaded onto a native 4% acrylamide gel composed of 8 ml of 30% acrylamide, 2% bis, 1.5 ml of TBE, 600 ␮l of 10% APS, and 60 ␮l of TEMED and electrophoresed at 200 V for 1.5 h in 0.25⫻ TBE. The gel was then placed on Whatman paper, dried in a gel dryer (BioRad) for 45 min, and exposed to x-ray film (Eastman Kodak Co.) at ⫺80 °C for 1–7 days, depending upon the signal. Bands were quantified by exposing the dried gel to a phosphoscreen (Eastman Kodak Co.) and quantified by a PhosphorImager (GE Healthcare). Specificity and Affinity for Protein (SNAP) Array—A customdesigned DNA array known as the SNAP array (Proteovista LLC) was synthesized using maskless array technology (Roche Nimblegen). ERE variations were tested within the sequence, 5⬘-GCGGTAGGTCA(N9)GCTGCGGAGCAGC(N9)⬘TGACCTACCGC-3⬘, where N is any nucleotide, N⬘ is the reverse complement, and the 15-mer core sequence is in boldface type. Control probes included response elements for androgen receptor and glucocorticoid receptor as well as mutated EREs. DNA hairpins were induced on an array, as described previously (43). A hybridization chamber was applied over the array, and the array was hydrated twice with deionized water. The array was then blocked with 2.5% milk for 1 h at room temperature on a rotator (2–3 rpm). After the blocking solution was removed from the array, the transcription factor binding buffer (Proteovista LLC) was used to rinse the array. Purified ER␣ (Life Technologies), preincubated with or without a 10-fold molar excess of Pin1, was applied to the array in buffer plus 1 ␮M E2, incubated for 1 h with rotation, and detected with an Alexa Fluor 647-labeled anti-ER␣ antibody (Santa Cruz Biotechnology). After incubation, the array was rinsed briefly, dried, and scanned using a GenePix 4000B scanner (Molecular Devices).


Software). p values of less than 0.05 were considered significant and are indicated by asterisks in the figures.

Results Pin1 Enhances the DNA Binding Activity of ER␣ from MCF7 Breast Cancer Cells in the Presence of Estrogen—Our previous studies indicated that Pin1 catalyzed conformational shifts in the ER␣ N-terminal AF1 domain, leading to enhanced transcriptional activity (25). Phosphorylation can also functionally alter the DBD and LBD of ER␣ (16, 47). Thus, we hypothesized that Pin1-induced changes in AF1 may alter receptor transcrip-


tional activity through other functional domains. We chose to focus on the DBD, which is immediately adjacent to the AF1 domain. ER␣ is maximally phosphorylated within 30 min by E2 treatment in our MCF7 model system (Fig. 1A). To evaluate the role of Pin1 in endogenous ER␣ DNA binding function, MCF7 breast cancer cells stably expressing GFP-Pin1 or GFP alone (vector) were stimulated with E2 for 30 min. EMSA with nuclear extracts showed that Pin1 overexpression increased ER␣ DNA binding activity in the presence of ligand by ⬃5-fold (Fig. 1, B and C). The Pin1-induced increase in DNA binding affinity concurs with increased transcriptional activity of liganded ER␣ VOLUME 290 • NUMBER 22 • MAY 29, 2015


FIGURE 1. Pin1 overexpression increases ER␣-ERE interaction in breast cancer cells. A, purified recombinant ER␣ (rER␣; 0.075– 0.3 pmol, 5–20 nM) and MCF-7 cell extracts treated with EtOH or 10 nM E2 (0 – 480 min) were separated by SDS-PAGE, and Western blot was performed for Ser(P)118-ER␣, ER␣, and actin using appropriate antibodies. B, nuclear extracts from MCF7 cells stably overexpressing GFP (vector (V)) or GFP-Pin1 (Pin1) treated without (⫺) and with 10 nM E2 (E2) were incubated with 32P-labeled ERE followed by gel electrophoresis and autoradiography. SS, ER␣ supershift using anti-ER␣ antibody. ERE represents unbound free probe. C, EMSA autoradiography was quantified using a PhosphorImager, and data are represented as means ⫾ S.E. (error bars) for at least three independent experiments. *, p ⬍ 0.05 comparing E2-treated vector and Pin1-expressing cells. Data were normalized to vehicle-treated vector-expressing cells. D, Western blot analysis was performed for ER␣ and Pin1 on 10-␮g nuclear extracts of E2-treated and untreated MCF7 cells stably overexpressing GFP (vector (V)) or GFP-Pin1 (Pin1) using appropriate antibodies. E, EMSA was performed as in B in vector- or Pin1-expressing cells treated with (⫹) or without (⫺) 100 nM OHT. F, EMSA for E was quantified as in C, and data are represented as means ⫾ S.E. for at least three independent experiments. n.s., not significant comparing OHT-treated vector and Pin1-expressing cells. Data were normalized to vehicle-treated vector-expressing cells.


induced by Pin1 overexpression in MCF7 (25). Because Pin1 can regulate ER␣ protein abundance levels (31), Western blot analysis was performed to confirm that ER␣ protein levels were equivalent in lysates used in EMSAs (Fig. 1D). These data indicate that Pin1 can increase DNA binding independent of its activity on receptor protein levels. The increase in DNA binding in E2-treated cells implicates a role for ligand and the LBD. Hence, similar experiments were conducted in MCF7 cells treated with OHT (Fig. 1, E and F). In contrast to E2, Pin1 did not significantly enhance the ER␣-DNA interaction in the presence of OHT. Together, these data indicate that Pin1 regulates ER␣ DNA binding in a ligand-specific manner, independent of effects on ER␣ protein levels. EGF activates ER␣ by kinase-mediated phosphorylation of the AF1 domain and promotes Pin1 binding to the receptor (12, 25, 48). To further explore the specificity of Pin1 regulation on ER␣ DNA binding, EMSA was conducted with EGF-treated cells. EGF-induced phosphorylation occurs on a different time scale than E2, and maximal Ser118 phosphorylation occurred within 5 min of stimulation (Fig. 2A). Thus, MCF7-GFP and MCF7-Pin1 GFP cells were treated with EGF for 5 min, and nuclear extracts were prepared. EMSAs showed that Pin1 increased DNA binding activity in the absence of stimulation (Fig. 2, B and C). However, EGF treatment resulted in no further enhancement of the Pin1 effect on ER␣ DNA binding function. Because previous studies showed that EGF treatment was sufficient to promote Pin1 binding to ER␣ (25), these data suggest that EGF-induced phosphorylation and recruitment of Pin1 to ER␣ is not sufficient for Pin1-mediated effects on ER␣ DNA binding activity. MAY 29, 2015 • VOLUME 290 • NUMBER 22

Pin1 cis/trans-Isomerase Activity Is Required to Increase ER␣ DNA Binding Function—To better define Pin1 activity on ER␣ DNA binding, solution-based DNA binding assays using purified components were conducted. We used commercially purified ER␣ that is phosphorylated at Ser118 (Fig. 1A). Recombinant ER␣ binds to a perfect ERE but not to the mERE in EMSAs, providing evidence of specific binding. Furthermore, competition binding with cold ERE and mERE confirmed that this interaction was specific to the wild-type response element (Fig. 3A). Purified recombinant Pin1 used in our assays is catalytically active and causes cis/trans-isomerization of the Ser(P)118– Pro119 bond of purified ER␣, as determined by increased sensitivity to dephosphorylation by trans-specific PP2A (Fig. 3B) (25). FP using a DNA probe consisting of a consensus ERE was used to quantitatively determine the Kd of ER␣ DNA binding in the presence and absence of Pin1. The consensus ERE used for the FP assays consisted of the core AGGTCA-CCGTGACCT flanked by constant regions that formed a hairpin DNA. Pin1 significantly improved the Kd of the ER-ERE interaction by at least 2-fold (4.0 ⫾ 1.6 nM versus 2.0 ⫾ 0.6 nM, p ⫽ 0.003), and a representative experiment is shown in Fig. 3C. Similar to findings with EMSAs, there was undetectable binding of ER␣ to mERE in FP experiments under all conditions tested. Dose-response curves indicated that Pin1 regulation of ER␣ DNA binding occurs within a broad range of Pin1 concentrations (Fig. 3, D and E). EMSA analysis indicated that Pin1 increased ER␣ binding affinity at doses ranging from 0.060 to 12 ␮M, with maximal binding occurring at 1.5 ␮M, and higher doses of Pin1 showed a diminution of ER␣-DNA binding. In JOURNAL OF BIOLOGICAL CHEMISTRY

13753


FIGURE 2. Phosphorylation by EGF is insufficient to enhance Pin1-mediated effects on ER␣-DNA binding. A, Western blot of ER␣ phosphorylated at Ser118 in response to 100 ng/ml of EGF at the indicated time points. NS, nonspecific band for loading control. B, nuclear extracts (10 ␮g) from MCF7 cells stably overexpressing GFP (vector (V)) or GFP-Pin1 (Pin1) treated with (EGF) and without (⫺) 100 ng/ml EGF were incubated with ERE followed by gel electrophoresis and autoradiography. The ER␣-ERE complex was competed with unlabeled ERE or mERE. SS, ER␣ supershift using anti-ER␣ antibody. ERE represents unbound free probe. Bands in the oval box were quantified. C, EMSA autoradiography (B) was quantified using a PhosphorImager, and data are represented as means ⫾ S.E. (error bars) for at least three independent experiments. No statistically significant differences were observed (p ⬎ 0.05).




VOLUME 290 • NUMBER 22 • MAY 29, 2015

Regulation of ER␣ DNA Binding Activity by Pin1 ever, when SSL analysis was employed to display the binding intensity from all 9-mer core sequences (underlined) using the dual core-motif AGGTCA-NNNTGACCT and AGGTCATGACCTNNN, Pin1-induced differences in ER␣ binding to DNA were revealed. In SSLs, intensities for each DNA sequence from the array are plotted on a series of concentric rings, where each array sequence in the center ring contains a subsequence that perfectly matches the motif, sequences in the second ring contain a subsequence with one mismatch to the consensus, sequences in the third ring contain a subsequence with two mismatches to the consensus, and so forth. The height of the peak corresponds to intensity and is proportional to binding affinity (Ka). Results indicate that the affinity of ER␣ binding to DNA, in particular to DNA sequences bearing the consensus ERE AGGTCANNNTGACCT (Fig. 5A), were enhanced in the presence of Pin1. Pin1 affected ER␣ binding to the AGGTCA presented within the context of a palindromic sequence (Groups D, I, and L as examples; Table 2 and Fig. 5B) but not with a simple AGGTCA halfsite (Groups R and FF; Table 2 and Fig. 5B). Moreover, DNA sequences bearing inverted repeats were preferred over direct repeats. These findings are observed in the SSLs, in which the sequences in the central ring (perfect match to the SSL consensus; shown by arrows) of the ER␣ ⫹ Pin1 landscape are of significantly higher intensity than the central ring of the ER␣alone landscape. Comparison of the SSLs showed several Pin1-induced high intensity peaks in the outer rings, and these sequences correspond to AGGTCA direct repeats of 0 and 3 spacers, which are known ER␣ targets (53). A ridge of higher intensity peaks radiating outward in the ER␣ ⫹ Pin1 landscape also contains sequences in which the motif degrades starting at the 3⬘-end. The first ring in the ridge contains NNNTGACCN, and the subsequent second ring includes NNNTGACNN. ER␣ plus Pin1 demonstrated preferences for the consensus ERE and 3-bp spacer, specifically the spacer CCG (labeled Seq1). Additional spacer analysis indicated that Pin1 also enhanced ER␣ interaction at inverted repeats with 0-, 2-, and 3-bp spacers. To confirm the ER␣ signal enhancement on the SNAP array by Pin1, we used FP to quantify the effect of Pin1 on ER␣ binding to three different DNA sequences (Seq1, Seq2, and Seq3; 9-mer embedded within the 25-bp hairpin) (Fig. 5, C–E). As expected, the EREs bearing a consensus AGGTCANNNTGACCT resulted in the highest affinity of ER␣. A plot of Ka versus normalized intensity yielded a linear correlation (r2 ⬎ 0.94), thereby allowing the intensity of every 9-mer sequence to be related to affinity by Ka (Fig. 5F). Consistent with our previous

FIGURE 3. In vitro ER␣ interaction with ERE is increased in the presence of Pin1. A, recombinant purified ER␣ (300 nM) was incubated with 32P-labeled ERE, 32 P-labeled mERE, or 100-fold unlabeled ERE, and/or unlabeled mERE, followed by gel electrophoresis and autoradiography. Free probe indicates unbound ERE and mERE. The indicated unlabeled EREs were used for competition (comp.) of the complex. B, top, model representing cis and trans conformations of the Ser(P)118–Pro119 bond. The schematic of ER␣ N-terminal domain (NTD) shown at the top represents purified ER␣. A stick model shows the phosphorylated Ser(P)118–Pro119 bond in cis and trans conformations and potential catalysis by Pin1. PP2A selectively dephosphorylates the trans-isomer and was used as a biochemical tool to assess cis and trans isomers of the Ser(P)118–Pro119 bond of ER␣. Bottom, in vitro dephosphorylation was performed as described under “Experimental Procedures” in the presence of BSA or Pin1. Reaction mixtures were incubated at 30 °C for the indicated length of time and immunoblotted for Ser(P)118-ER␣, ER␣, and Pin1 using appropriate antibodies. C, determination of Kd values for purified ER␣ (closed circle and square) or ER␣ ⫹ Pin1 (closed triangle and open square) for DNA sequences (ERE and mERE), with the same sequences as probes from the SNAP array, using FP. ND, not detectable Kd. Shown is a representative figure for at least three independent experiments. *, p ⬍ 0.05 between ER␣ and ER␣ ⫹ Pin1. D, in vitro EMSA was performed as in A with 200 nM ER␣ and different Pin1 concentrations (0 –12 ␮M). E, determination of Kd values for ER␣ (filled circles) or ER␣ ⫹ Pin1 (2–20 ␮M) for DNA sequences using FP. Shown is a representative figure for at least three independent experiments. *, p ⬍ 0.05 between ER␣ and ER␣ ⫹ Pin1 (2 ␮M).



13755


addition, a reproducible but unexplainable decrease in binding occurred at 600 nM Pin1. In agreement with the EMSA data, quantitative determination by FP indicated that although the addition of Pin1 enhanced the Kd of ER␣ binding in all cases, the effect was greater at lower doses of Pin1 (2 ␮M) relative to high doses (10 or 20 ␮M) (Fig. 3E). These results suggest that Pin1 activity on ER␣ is concentration-dependent, and based on our EMSA analysis, Pin1 exhibits a biphasic dose response (Fig. 3D). Next, the requirement for isomerization by Pin1 on ER␣ DNA interactions was tested. To avoid potential saturation of binding and to best visualize the effect of Pin1, subsequent EMSA experiments used a suboptimal concentration of 100 nM purified ER␣ unless otherwise noted (Fig. 4A). Juglone is a specific pharmacological inhibitor of the catalytic activity of Pin1 in vitro (49). Quantification of the EMSA results showed that there was an ⬃16-fold increase in DNA binding activity of purified ER␣ due to Pin1. This effect was completely abolished in the presence of juglone (Fig. 4, B and C). These results were recapitulated by FP, where juglone consistently blocked the effect of Pin1 on ER␣ DNA binding affinity (Fig. 4, D and E). The role of Pin1-mediated cis-trans-isomerization in ER␣ DNA binding function was further confirmed using a catalytically inactive (K63A) mutant Pin1 protein (50). Compared with wildtype Pin1, the K63A Pin1 mutant did not increase ER␣ DNA binding activity by either EMSA or FP (Fig. 4, F and G). These data provide evidence that Pin1 isomerase activity is necessary for Pin1 to enhance ER␣ binding to its response element. Specificity and Affinity Landscape of ER␣ DNA Binding Properties Regulated by Pin1—Because all of the DNA binding experiments in previous figures were performed with just two variations of the consensus EREs, we next wanted to unbiasedly explore the global effect of Pin1 on the DNA binding profile of ER␣. For this, we utilized the high throughput DNA microarray, referred to as the SNAP array, which displays 385,000 double-stranded DNA sequences in unique spatially resolved features (44, 45). On the custom-designed SNAP array, duplex DNA probes were designed to contain 9 permuted bp, or 49 ERE variations, preceded by a constant ER␣ half-site. Each probe was additionally flanked by a constant 5-bp region on each end to form 25-bp B-form DNA after hairpinning (Table 2) (44, 45). Binding of purified recombinant ER␣ to the DNA was detected by fluorescence, and the comprehensive DNA binding specificity and affinity of ER␣ to all sequences assayed were analyzed using motif-finding algorithms (51, 52) and sequence specificity landscapes (SSLs; Fig. 5A) (44). Motif analysis of the top fluorescence intensity sequences indicated that ER␣ alone and ER␣ ⫹ Pin1 bound to the consensus ERE (Fig. 5A, top). How-


FIGURE 4. Pin1 isomerase function increases ER␣ binding affinity to ERE. A, to assess various levels of ER␣-ERE binding, recombinant purified ER␣ (0 –300 nM) was first incubated at 30 °C for 30 min and then incubated with 32 P-labeled ERE, followed by gel electrophoresis and autoradiography. B, in vitro EMSA was performed as in (Fig. 3D) with 100 nM ER␣ and different Pin1 amounts (0 – 0.6 ␮M) in the presence and absence of Pin1 catalytic inhibitor, juglone (10 ␮M), and 100 ng of BSA. C, EMSA autoradiography in B was quantified using a PhosphorImager, and data are represented as means ⫾ S.E. (error bars) for at least three independent experiments. *, p ⬍ 0.05; n.s., not significant comparing ER␣ and ER␣ ⫹ Pin1. D, determination of Kd values for unoccupied ER␣ (closed circles), ER␣ ⫹ Pin1 (closed squares), or ER␣ ⫹ Pin1 ⫹ juglone (closed triangles) for the ERE was assessed by FP. E, graph showing Kd values for ER␣, ER␣ ⫹ Pin1, and ER␣ ⫹ Pin1 ⫹ juglone. Data are represented as means ⫾ S.E. for at least three independent experiments. *, p ⬍ 0.05. F, determination of Kd values for unoccupied ER␣ (closed circles), ER␣ ⫹ Pin1 (closed squares), or ER␣ ⫹ K63A mutant Pin1 (closed triangles) for the ERE was assessed by FP, and a representative graph is shown. *, p ⬍ 0.05. G, in vitro EMSA was performed as in B in the presence and absence of 1 and 2 ␮M Pin1 (WT) or catalytic mutant K63A.


Discussion ER␣ and Pin1 are important regulatory molecules in cell division and growth control that have overlapping and distinct roles in cancer (57, 58). The growth-promoting activity of ER␣ is mediated through the transcriptional regulation of gene expression. The mechanisms governing ER␣ transactivation are well described, and hundreds of ER␣ protein partners have been invoked as part of the process (59). They include multiple chromatin-remodeling and chromatin-modifying enzymes as well as the multiprotein Mediator complex, which bridges ER␣ with the basal transcriptional machinery. Phosphorylated ER␣ comprises ⬃48% of the total ER␣ in the presence of ligand (60), and gene expression analysis indicates that phosphorylated ER␣ regulates a subset of ER␣ target genes involved in cell growth (32). Pin1 was discovered as a critical regulator of mitosis and is overexpressed in a number of cancers, including breast, prostate, lung, and colon, among others relative to normal controls (27, 57, 61, 62). A large number of substrates have been reported for Pin1, including critical cancer oncogenes (e.g. c-Myc, cyclin D1, and p53), transcriptional co-regulators (e.g. SMRT and AIB1), chromatin, and components of the transcriptional machinery, such as RNA polymerase II (30, 63). Pin1 is also known to associate with several nuclear receptors, including glucorticoid receptor, PPAR␥, Nur77, androgen receptor, and retinoic acid receptor (38, 64 – 66, 68). The broad activities of ER␣ and Pin1, coordinated through multiprotein complexes, VOLUME 290 • NUMBER 22 • MAY 29, 2015


EMSA and FP results, the Ka plot also shows that Pin1 enhances the affinity of ER␣ for the three sequences analyzed by FP. FP and SNAP analysis indicated that Pin1 does not form a stable interaction with the ER␣-ERE complex but has a transient enzymatic interaction perhaps similar to other “allosteric cofactors” (54, 55). The FP curve for ER␣ in the presence of Pin1 reached a lower plateau than ER␣ alone. FP provides readout on both the shape and size of the ER␣-DNA complex (56). Hence, the change in the ER␣ ⫹ Pin1 FP curve is consistent with Pin1 inducing a conformational change in the ER␣ protein (25). Pin1 Impacts ER␣ Recruitment to Endogenous Estrogen Response Elements—We used a ChIP assay in MCF7 cells overexpressing Pin1 or vector to probe for ER␣-DNA interaction at ER␣ binding sites on endogenous targets. Binding sites interrogated include the well characterized pS2 promoter, the ESR1 distal region (ENH1; ⫺150 kb), the ESR1 promoter (⫹60), and a nonspecific intervening region (⫺811) (46) (Fig. 6, A–C). ER␣ enrichment on ENH1 and pS2 ERE sites were higher in Pin1overexpressing cells (Fig. 6, A and B). In agreement with our SNAP data, these sites bear near perfect EREs, supporting the notion that Pin1 enhances ER␣ occupancy at the ERE sites most resembling a perfect palindromic consensus. In contrast, Pin1 had essentially no impact on the ER␣ binding site on the ESR1 proximal promoter region (⫹60) (Fig. 6C) and a nonspecific region (⫺811) (Fig. 6, A–C). The latter two sites lack a consensus ERE, reflected by the low percentage of input DNA bound, although the ESR1 promoter is a site of estrogen-regulated ER␣ binding (46). Although the effect of Pin1 on ER␣ occupancy on DNA in cells is not as robust as in in vitro studies, the trend is consistent with EMSA and FP findings that Pin1 regulates ER␣ interaction with EREs on target genes.

Regulation of ER␣ DNA Binding Activity by Pin1 TABLE 2 Each group contains different DNA sequences tested DNA sequences (underlined) represent potential ER␣ binding sites, and additional sequences are the flanking, hairpin loop, or spacer sequences between half-sites. N, any nucleotide; N⬘, complement of N; GRE, glucocorticoid response elements; ARE, androgen response elements; ERR, estrogen-related receptor; IR, inverted repeat; DR, direct repeat. Group A

Sequence FLANK-AGGTCAN1–9-FLANK-GGA-FLANK-N9⬘–1⬘-TGACCT-FLANK FLANK-AGGTCA-N1–5-TGACCT-FLANK-GGA-FLANK-AGGTCA-N5⬘–1⬘-TGACCT-FLANK FLANK-AGGTCA-N1–4-TGACCT-FLANK-GGA-FLANK-AGGTCA-N4⬘–1⬘-TGACCT-FLANK FLANK-AGGTCA-N1–3-TGACCT-FLANK-GGA-FLANK-AGGTCA-N3⬘–1⬘-TGACCT-FLANK FLANK-AGGTCA-N1-2-TGACCT-FLANK-GGA-FLANK-AGGTCA-N2⬘–1⬘-TGACCT-FLANK FLANK-AGGTCA-N-TGACCT-FLANK-GGA-FLANK-AGGTCA-N-TGACCT-FLANK FLANK-AGGTCATGACCT-FLANK-GGA-FLANK-AGGTCATGACCT-ACCGC FLANK-N1GN2N3CN4-GGC-N5GN6N7CN8-FLANK-GGA-FLANK-N8⬘GN7⬘N6⬘CN5⬘-GCC-N4⬘GN3⬘N2⬘CN1⬘-FLANK FLANK-AGGTCA-CAG-TGACCT-FLANK-GGA-FLANK-AGGTCA-CTG-TGACCT-FLANK FLANK-AGATCA-CAG-TGATCT-FLANK-GGA-FLANK-AGATCA-CTG-TGATCT-FLANK FLANK-GAGACA-CAG-GGTTTC-FLANK-GGA-FLANK-GAAACC-CTG-TGTCTC-FLANK FLANK-AGGTCA-GGC-TGACCT-FLANK-GGA-FLANK-AGGTCA-GCC-TGACCT-FLANK FLANK-AGATCA-GGC-TGATCT-FLANK-GGA-FLANK-AGATCA-GCC-TGATCT-FLANK FLANK-AGAACA-GGC-TGTTCT-FLANK-GGA-FLANK-AGAACA-GCC-TGTTCT-FLANK FLANK-GAGACA-GGC-GGTTTC-FLANK-GGA-FLANK-GAAACC-GCC-TGTCTC-FLANK FLANK-GGTACA-GGC-TGTTCT-FLANK-GGA-FLANK-AGAACA-GCC-TGTACC-FLANK FLANK-TGGTCA-GGC-AGTTCT-FLANK-GGA-FLANK-AGAACT-GCC-TGACCA-FLANK FLANK-TCAAGGTCA-FLANK-GGA-FLANK-TGACCTTGA-FLANK FLANK-CAGAGGTCA-FLANK-GGA-FLANK-TGACCTCTG-FLANK FLANK-AGGTCA-TGACCT-FLANK-GGA-FLANK-AGGTCA-TGACCT-FLANK FLANK-AGGTCA-C-TGACCT-FLANK-GGA-FLANK-AGGTCA-G-TGACCT-FLANK FLANK-AGGTCA-CA-TGACCT-FLANK-GGA-FLANK-AGGTCA-TG-TGACCT-FLANK FLANK-AGGTCA-CAC-TGACCT-FLANK-GGA-FLANK-AGGTCA-GTG-TGACCT-FLANK FLANK-AGGTCA-CACA-TGACCT-FLANK-GGA-FLANK-AGGTCA-TGTG-TGACCT-FLANK FLANK-AGGTCA-CACAC-TGACCT-FLANK-GGA-FLANK-AGGTCA-GTGTG-TGACCT-FLANK FLANK-AGGTCAAGGTCA-FLANK-GGA-FLANK-TGACCTTGACCT-FLANK FLANK-AGGTCA-C-AGGTCA-FLANK-GGA-FLANK-TGACCT-G-TGACCT-FLANK FLANK-AGGTCA-CA-AGGTCA-FLANK-GGA-FLANK-TGACCT-TG-TGACCT-FLANK FLANK-AGGTCA-CAC-AGGTCA-FLANK-GGA-FLANK-TGACCT-GTG-TGACCT-FLANK FLANK-AGGTCA-CACA-AGGTCA-FLANK-GGA-FLANK-TGACCT-TGTG-TGACCT-FLANK FLANK-AGGTCA-CACAC-AGGTCA-FLANK-GGA-FLANK-TGACCT-GTGTG-TGACCT-FLANK FLANK-N1N2N3-AGGTCA-N4N5N6-FLANK-GGA-FLANK-N6⬘N5⬘N4⬘-TGACCT-N3⬘N2⬘N1⬘-FLANK

make it difficult to dissect the specific activities of these partners in transcription and growth. Our previous studies showed that Pin1 binds to the phosphorylated ER␣, and Pin1 isomerase activity increases receptor transactivation function in both the presence and absence of ligand (25). However, given the extensive protein interactions of both ER␣ and Pin1, an understanding of the direct role of Pin1 in ER␣ transactivation was lacking. In this study, we provide evidence that Pin1 can directly increase ER␣ DNA binding affinity, providing a plausible explanation for increased ER␣ transcriptional function by Pin1 in estrogen-treated cells. Using both breast cancer cell lysates and purified components, our data indicate that the overexpression or addition of Pin1 is sufficient to increase ER␣ affinity for DNA binding sites. Pin1 isomerase activity is responsible for the resultant effect, suggesting that Pin1-induced conformational changes are involved. These studies, combined with our previous studies (25), support a model in which Pin1-catalyzed isomerization induces conformational changes in the ER␣ N terminus, which in turn modulates the ability of ER␣ to dimerize, recognize DNA binding sites, and regulate transcription. Order of addition experiments as well as inhibition of Pin1 catalytic function indicate that Pin1 isomerase activity must occur prior to the effects on ER␣-DNA binding affinity. These Pin1-mediated effects can act on unliganded ER␣ but are further enhanced for estrogenbound ER␣, which suggests that conformational changes from the N terminus are coordinated with ligand-induced changes in the LBD to modulate the activities of the DBD. Of interest, Pin1 enhances transactivation of ER␣ in the presence of OHT (25) but does not significantly increase the binding of OHT-occuMAY 29, 2015 • VOLUME 290 • NUMBER 22

pied ER␣ to DNA. This finding points to context-specific control of ER␣ by Pin1 and indicates that Pin1 enhances tamoxifendriven transcriptional activity through a separate mechanism. In either case, our data reveal that Pin1 regulation of ER␣ transcription involves the integrated activities of multiple functional domains. Interestingly, Pin1 does not directly interact with the ER␣ DBD but rather binds to a phosphorylation site in the adjacent ID region (25). In addition to Ser118, Pin1 has also been reported to bind to Ser294 in the disordered hinge region immediately downstream of the DBD (69). Changes in DNA binding activity coordinated by ID regions have been observed in other transcription factors. For example, the ID regions in Cys2-His2 zinc finger transcription factors lock the DNA binding motif into conformations that contribute to tighter and specific DNA interactions (70, 71). Moreover, ID regions can also coordinate hydrophobic and electrostatic interactions that shape the interface of the DBD and DNA, as has been shown for Max and Ets factors (72, 73). ID regions are mostly enriched with proline residues, and proline isomerization has been shown to kink the protein backbone which functions as a molecular switch to regulate the structure of nearby domains (74 –76). Therefore, allosteric regulation of the ER␣ DBD through extended conformational changes originating in the AF1 domain is plausible, although the lack of effect of EGF, which induces phosphorylation and Pin1 binding but does not affect ER␣ DNA binding, suggests additional complexities. Given the high proportion of ID regions in transcription factors that are common sites of phosphorylation, it is possible that the effects of Pin1 on DNA binding observed here on ER␣ may be more generally applied JOURNAL OF BIOLOGICAL CHEMISTRY

13757


B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF

Description ER half-site held constant; 3-bp spacing and second half-site varied Perfect consensus with 5-mer spacer permuted Perfect consensus with 4-mer spacer permuted Perfect consensus with 3-mer spacer permuted Perfect consensus with 2-mer spacer permuted Perfect consensus with 1-mer spacer permuted Perfect consensus with 0 mer spacer Randomized 8-mer ERE/GRE/ARE ERE mERE mERE2 ER positive control ER negative control GR positive control GR negative control AR positive control AR negative control ERR␥ positive control ERR␥ negative control ERE IRO ERE IR1 ERE IR2 ERE IR3 ERE IR4 ERE IR5 ERE DR0 ERE DR1 ERE DR2 ERE DR3 ERE DR4 ERE DR5 ER or ERR half-site, 6-mer flanking



FIGURE 5. Effect of Pin1 on ER␣ DNA binding using the comprehensive SNAP microarray. A, top, motif for estrogen-occupied ER␣ binding to all permutations of the core sequence, AGGTCAN9, in the 25-bp hairpin on the SNAP array. Bottom, SSL for estrogen-occupied ER␣ binding to all 262,144 (9-mer) DNA sequences. Each ring contains sequences with increasing mismatches from the seed motif composed of the sequences NNNTGACCT and TGACCTNNN. Left, motif and SSL for ER␣. Right, motif and SSL for ER␣ ⫹ Pin1. B, the effect of Pin1 was determined by plotting normalized fluorescence intensity for ER␣ (Array1_noPin1) versus ER␣ ⫹ Pin1 (Array1_wtPin1) binding to different DNA probes from the groups listed in Table 2. A representative graph from two independent replicates is shown. Error bars, 1 S.D. C–E, determination of Kd values for estrogen-occupied ER␣ (filled circles) or ER␣ ⫹ Pin1 (open squares) for three DNA sequences (Seq1, Seq2, and Seq3; shown by arrows in Fig. 5A) from the SNAP array using FP. F, correlation between normalized SNAP intensity and Ka, relating fluorescence intensities on the SNAP arrays to affinity of ER␣ (filled circles) or ER␣ ⫹ Pin1 (open squares) for each DNA sequence.

and be a model for the role of ID domain regulation in transcription factor function. Pin1 may also regulate ER␣ DNA binding via promoting interdomain interactions. As mentioned previously, the impor-


tance of ligand in modulating Pin1 activity implicates coordinated regulation of the N-terminal AF1 and the C-terminal LBD on the DBD. This finding is in agreement with other results, which indicate that the N and C termini of receptors VOLUME 290 • NUMBER 22 • MAY 29, 2015


coordinately regulate receptor activity (77–79). Other receptor binding partners have been identified that enhance allosteric interactions among functional domains. Direct p300 interaction with the N-terminal A/B region of ER␣ not only bridges the N and C termini of ER␣ but also enhances receptor transactivation through ligand-induced synergism between AF1 and AF2 (80). Similarly, Dutertre and Smith (24) showed the importance of AF1 in recruiting SRC1 (steroid receptor coactivator-1) and CBP (CREB-binding protein) in mediating interaction and transcriptional synergism between AF1 and AF2 domains. Previous studies have also suggested that AF1 coregulator binding may have long range effects through changes in structure. Like Pin1, TBP binds to the N-terminal AF1 domains of ER␣ as well as the glucorticoid receptor and progesterone receptor (10, 81– 83). In the case of glucorticoid receptor, TBP binding induces the transition to an ordered structure that facilitates interaction with the coactivator SRC1 to enhance ligand activated transcription. Recent studies of progesterone receptor using hydrogen-deuterium exchange have shown that TBP binding to progesterone receptor AF1 domain stabilized the AF2 domain, supporting the notion that coregulator binding at the AF1 domain may facilitate physical interactions between the AF1 and AF2 to alter transcriptional responses (83). NMR analysis of the ER␣ N terminus showed that, unlike TBP, Pin1 binding and isomerization of ER␣ does not induce an ordered structure in the N terminus (25). Pin1 did, however, increase ER␣ dimerization (25), which is necessary for receptor MAY 29, 2015 • VOLUME 290 • NUMBER 22

DNA binding function. We propose that Pin1 probably plays multiple roles in directing ER␣ DNA binding function by inducing conformational changes that are transmitted to both the DBD and dimer interface and that can be further modulated by ligand interactions in the LBD. The SNAP-SSL analysis provided an unprecedented view into the effects of Pin1 on the ER␣-ERE interactions. For our analysis, we employed the SNAP technology which, unlike ChIP-sequencing, can distinguish direct ER␣-DNA interactions from indirect/protein-tethered interactions with DNA and also overcomes complications associated with Pin1 interactions with basal transcriptional machinery. Moreover, although ChIP-sequencing is an established and powerful technique, it requires next generation sequencing expertise, takes days or weeks to complete depending on the number of lanes needed, generates complicated data, is particular to a cell type or condition, is labor-intensive, and includes DNA amplification (84 – 86). SNAP arrays, however, can be performed with purified proteins or lysates with high throughput. SNAP arrays were particularly well suited for our analysis because we wanted to pinpoint the specific biochemical effects of Pin1 on the ER␣ERE interaction without the input of other cellular proteins. The DNA probes examined on the SNAP array contained the core sequence AGGTCA-9-mer embedded within a 25-bp hairpin, allowing for an unbiased analysis of the 3-mer spacer and 6-mer half site (49 or 262,144 permutations). Motif searching JOURNAL OF BIOLOGICAL CHEMISTRY

13759


FIGURE 6. Pin1 regulates ER␣ enrichment on its target genes. A–C, MCF7 cells expressing GFP or GFP-Pin1 were treated with 10 nM E2 for the indicated times, and ChIP analyses were performed to examine occupancy of ER␣ at regions of pS2 promoter (A), ESR1 ENH1 (B), ESR1 ⫹60 promoter (C), and ESR1 ⫺811 nonspecific region (A–C). Data are represented as means ⫾ S.E. (error bars) for at least three independent experiments. No statistically significant differences were observed (p ⬎ 0.05).


Acknowledgments—We thank McArdle Laboratories for Cancer Research for support of this project. We also thank the University of Wisconsin Carbone Comprehensive Cancer Center for use of its shared services to complete this research. We thank Dr. Kun Ping Lu (Harvard Medical School) for Pin1 reagents and Dr. Yongna Xing (University of Wisconsin, Madison, WI) for purified PP2A holoenzyme.


References 1. Klein-Hitpass, L., Ryffel, G. U., Heitlinger, E., and Cato, A. C. (1988) A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor. Nucleic Acids Res. 16, 647– 663 2. Klein-Hitpass, L., Tsai, S. Y., Greene, G. L., Clark, J. H., Tsai, M. J., and O’Malley, B. W. (1989) Specific binding of estrogen receptor to the estrogen response element. Mol. Cell. Biol. 9, 43– 49 3. Schwabe, J. W., Chapman, L., Finch, J. T., and Rhodes, D. (1993) The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: how receptors discriminate between their response elements. Cell 75, 567–578 4. Klinge, C. M. (2001) Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res. 29, 2905–2919 5. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J. R., and Chambon, P. (1987) Functional domains of the human estrogen receptor. Cell 51, 941–951 6. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989) The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59, 477– 487 7. Klinge, C. M. (2000) Estrogen receptor interaction with co-activators and co-repressors. Steroids 65, 227–251 8. Me´tivier, R., Penot, G., Hu¨bner, M. R., Reid, G., Brand, H., Kos, M., and Gannon, F. (2003) Estrogen receptor-␣ directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115, 751–763 9. Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A., and Brown, M. (2000) Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843– 852 10. Wa¨rnmark, A., Wikstro¨m, A., Wright, A. P., Gustafsson, J. A., and Ha¨rd, T. (2001) The N-terminal regions of estrogen receptor ␣ and ␤ are unstructured in vitro and show different TBP binding properties. J. Biol. Chem. 276, 45939 – 45944 11. Chen, D., Riedl, T., Washbrook, E., Pace, P. E., Coombes, R. C., Egly, J. M., and Ali, S. (2000) Activation of estrogen receptor ␣ by S118 phosphorylation involves a ligand-dependent interaction with TFIIH and participation of CDK7. Mol. Cell 6, 127–137 12. Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995) Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270, 1491–1494 13. Medunjanin, S., Hermani, A., De Servi, B., Grisouard, J., Rincke, G., and Mayer, D. (2005) Glycogen synthase kinase-3 interacts with and phosphorylates estrogen receptor ␣ and is involved in the regulation of receptor activity. J. Biol. Chem. 280, 33006 –33014 14. Rogatsky, I., Trowbridge, J. M., and Garabedian, M. J. (1999) Potentiation of human estrogen receptor ␣ transcriptional activation through phosphorylation of serines 104 and 106 by the cyclin A-CDK2 complex. J. Biol. Chem. 274, 22296 –22302 15. Thomas, R. S., Sarwar, N., Phoenix, F., Coombes, R. C., and Ali, S. (2008) Phosphorylation at serines 104 and 106 by Erk1/2 MAPK is important for estrogen receptor-␣ activity. J. Mol. Endocrinol. 40, 173–184 16. Likhite, V. S., Stossi, F., Kim, K., Katzenellenbogen, B. S., and Katzenellenbogen, J. A. (2006) Kinase-specific phosphorylation of the estrogen receptor changes receptor interactions with ligand, deoxyribonucleic acid, and coregulators associated with alterations in estrogen and tamoxifen activity. Mol. Endocrinol. 20, 3120 –3132 17. Chandra, V., Huang, P., Hamuro, Y., Raghuram, S., Wang, Y., Burris, T. P., and Rastinejad, F. (2008) Structure of the intact PPAR-␥-RXR-nuclear receptor complex on DNA. Nature 456, 350 –356 18. Chandra, V., Huang, P., Potluri, N., Wu, D., Kim, Y., and Rastinejad, F. (2013) Multidomain integration in the structure of the HNF-4␣ nuclear receptor complex. Nature 495, 394 –398 19. He, B., Wang, K., Liu, Y., Xue, B., Uversky, V. N., and Dunker, A. K. (2009) Predicting intrinsic disorder in proteins: an overview. Cell Res. 19, 929 –949 20. Hilser, V. J., and Thompson, E. B. (2011) Structural dynamics, intrinsic disorder, and allostery in nuclear receptors as transcription factors. J. Biol. Chem. 286, 39675–39682



indicated an ER␣ preference for the consensus TGACCT at the second half-site in the presence or absence of Pin1. SNAP-SSL analysis of all 9-mer permutations adjacent to the AGGTCA sequence further uncovered additional Pin1-induced effects on ER␣-DNA binding specificity and affinity. The most apparent effect of Pin1 was an enhancement of ER␣ affinity for the consensus ERE, but Pin1 caused ER␣ to be recruited to other ER␣ binding sites as well, including inverted repeats of zero, two, and three spacers as well as AGGTCA direct repeats. The SNAP data indicated that ERE spacer sizes of 0- and 3-mer are preferred (Groups T and W; Table 2 and Fig. 5B), as has been observed previously (53). In addition, enhanced ER␣ interaction at an inverted repeat is consistent with ER␣ dimer binding, and our previous findings indicated that Pin1 enhances ER␣ dimerization (25). Data showing that ER␣ ⫹ Pin1 consistently preferred the CCG spacer within the context of the inverted repeat suggest that Pin1 may also alter ER␣-DNA interactions directly via subtle spacer sequence preferences. To further support Pin1 effects on ER␣ specificity, we performed a differential binding analysis of the full 262,144 SNAP sequences. In comparing ER␣ versus ER␣ ⫹ Pin1 affinities in this analysis, ER␣ ⫹ Pin1 is enriched for strong palindromic ERE sequences, whereas ER␣ alone is enriched for sequences with a nearly unidentifiable degenerate second half-site. The ability of ER␣ to recognize a strong half-site with a highly degenerate second half-site has been observed in genome-wide ER␣ assays (67, 87). Our comparative analysis of Pin1 enhancement of ER␣ binding at sites that best resemble the consensus ERE is further supported by our ChIP findings. Identification of direct actions of Pin1 on ER␣ transactivation were facilitated by in vitro approaches, which revealed activities that would not be uncovered in the complex environments of the cell. The studies reported here indicate that although Pin1 may regulate multiple factors in the transcriptional process, at least one component of Pin1 isomerase activity on ER␣ is through the direct regulation of receptor DNA binding activity. Although Pin1 is not required for ER␣ binding to the DNA, these results suggest that one of the outcomes of Pin1 binding is to tune the receptor function and contribute to the specificity of gene regulation by phosphorylated forms of the receptor. Importantly, the identification of Pin1 as an ID region-binding protein that changes ER␣ interactions with DNA opens the door to future structural studies to pursue the allosteric transmission of signal from an important yet poorly understood ID region of the ER␣ to other functional domains of the receptor. Such insight would contribute to an understanding of how communication between ID functional domains of nuclear receptors and other Pin1-regulated transcription factors coordinate DNA binding functions and transcriptional activation, offering novel avenues to target and control Pin1 interactions in disease.



39. Khanal, P., Yun, H. J., Lim, S. C., Ahn, S. G., Yoon, H. E., Kang, K. W., Hong, R., and Choi, H. S. (2012) Proyl isomerase Pin1 facilitates ubiquitin-mediated degradation of cyclin-dependent kinase 10 to induce tamoxifen resistance in breast cancer cells. Oncogene 31, 3845–3856 40. Liou, Y. C., Ryo, A., Huang, H. K., Lu, P. J., Bronson, R., Fujimori, F., Uchida, T., Hunter, T., and Lu, K. P. (2002) Loss of Pin1 function in the mouse causes phenotypes resembling cyclin D1-null phenotypes. Proc. Natl. Acad. Sci. U.S.A. 99, 1335–1340 41. Wulf, G. M., Ryo, A., Wulf, G. G., Lee, S. W., Niu, T., Petkova, V., and Lu, K. P. (2001) Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1. EMBO J. 20, 3459 –3472 42. Furlow, J. D., Ahrens, H., Mueller, G. C., and Gorski, J. (1990) Antisera to a synthetic peptide recognize native and denatured rat estrogen receptors. Endocrinology 127, 1028 –1032 43. Ozers, M. S., Warren, C. L., and Ansari, A. Z. (2009) Determining DNA sequence specificity of natural and artificial transcription factors by cognate site identifier analysis. Methods Mol. Biol. 544, 637– 653 44. Carlson, C. D., Warren, C. L., Hauschild, K. E., Ozers, M. S., Qadir, N., Bhimsaria, D., Lee, Y., Cerrina, F., and Ansari, A. Z. (2010) Specificity landscapes of DNA binding molecules elucidate biological function. Proc. Natl. Acad. Sci. U.S.A. 107, 4544 – 4549 45. Warren, C. L., Kratochvil, N. C., Hauschild, K. E., Foister, S., Brezinski, M. L., Dervan, P. B., Phillips, G. N., Jr., and Ansari, A. Z. (2006) Defining the sequence-recognition profile of DNA-binding molecules. Proc. Natl. Acad. Sci. U.S.A. 103, 867– 872 46. Ellison-Zelski, S. J., Solodin, N. M., and Alarid, E. T. (2009) Repression of ESR1 through actions of estrogen receptor ␣ and Sin3A at the proximal promoter. Mol. Cell. Biol. 29, 4949 – 4958 47. Tzeng, D. Z., and Klinge, C. M. (1996) Phosphorylation of purified estradiol-liganded estrogen receptor by casein kinase II increases estrogen response element binding but does not alter ligand stability. Biochem. Biophys. Res. Commun. 223, 554 –560 48. Bunone, G., Briand, P. A., Miksicek, R. J., and Picard, D. (1996) Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J. 15, 2174 –2183 49. Hennig, L., Christner, C., Kipping, M., Schelbert, B., Ru¨cknagel, K. P., Grabley, S., Ku¨llertz, G., and Fischer, G. (1998) Selective inactivation of parvulin-like peptidyl-prolyl cis/trans isomerases by juglone. Biochemistry 37, 5953–5960 50. Ryo, A., Suizu, F., Yoshida, Y., Perrem, K., Liou, Y. C., Wulf, G., Rottapel, R., Yamaoka, S., and Lu, K. P. (2003) Regulation of NF-␬B signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA. Mol. Cell 12, 1413–1426 51. Bailey, T. L., and Elkan, C. (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc. Int. Conf. Intell. Syst. Mol. Biol. 2, 28 –36 52. Liu, X. S., Brutlag, D. L., and Liu, J. S. (2002) An algorithm for finding protein-DNA binding sites with applications to chromatin-immunoprecipitation microarray experiments. Nat. Biotechnol. 20, 835– 839 53. El Marzouk, S., Gahattamaneni, R., Joshi, S. R., and Scovell, W. M. (2008) The plasticity of estrogen receptor-DNA complexes: binding affinity and specificity of estrogen receptors to estrogen response element half-sites separated by variant spacers. J. Steroid Biochem. Mol. Biol. 110, 186 –195 54. Das, D., Peterson, R. C., and Scovell, W. M. (2004) High mobility group B proteins facilitate strong estrogen receptor binding to classical and halfsite estrogen response elements and relax binding selectivity. Mol. Endocrinol. 18, 2616 –2632 55. Wei, G., Li, A. G., and Liu, X. (2005) Insights into selective activation of p53 DNA binding by c-Abl. J. Biol. Chem. 280, 12271–12278 56. Ozers, M. S., Hill, J. J., Ervin, K., Wood, J. R., Nardulli, A. M., Royer, C. A., and Gorski, J. (1997) Equilibrium binding of estrogen receptor with DNA using fluorescence anisotropy. J. Biol. Chem. 272, 30405–30411 57. Lu, Z., and Hunter, T. (2014) Prolyl isomerase Pin1 in cancer. Cell Res. 24, 1033–1049 58. Sommer, S., and Fuqua, S. A. (2001) Estrogen receptor and breast cancer. Semin. Cancer Biol. 11, 339 –352 59. Malovannaya, A., Lanz, R. B., Jung, S. Y., Bulynko, Y., Le, N. T., Chan,


13761


21. Liu, J., Perumal, N. B., Oldfield, C. J., Su, E. W., Uversky, V. N., and Dunker, A. K. (2006) Intrinsic disorder in transcription factors. Biochemistry 45, 6873– 6888 22. Endoh, H., Maruyama, K., Masuhiro, Y., Kobayashi, Y., Goto, M., Tai, H., Yanagisawa, J., Metzger, D., Hashimoto, S., and Kato, S. (1999) Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor ␣. Mol. Cell. Biol. 19, 5363–5372 23. Watanabe, M., Yanagisawa, J., Kitagawa, H., Takeyama, K., Ogawa, S., Arao, Y., Suzawa, M., Kobayashi, Y., Yano, T., Yoshikawa, H., Masuhiro, Y., and Kato, S. (2001) A subfamily of RNA-binding DEAD-box proteins acts as an estrogen receptor ␣ coactivator through the N-terminal activation domain (AF-1) with an RNA coactivator, SRA. EMBO J. 20, 1341–1352 24. Dutertre, M., and Smith, C. L. (2003) Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-␣: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol. Endocrinol. 17, 1296 –1314 25. Rajbhandari, P., Finn, G., Solodin, N. M., Singarapu, K. K., Sahu, S. C., Markley, J. L., Kadunc, K. J., Ellison-Zelski, S. J., Kariagina, A., Haslam, S. Z., Lu, K. P., and Alarid, E. T. (2012) Regulation of estrogen receptor ␣ N-terminus conformation and function by peptidyl prolyl isomerase Pin1. Mol. Cell. Biol. 32, 445– 457 26. Simons, S. S., Jr., Edwards, D. P., and Kumar, R. (2014) Minireview: dynamic structures of nuclear hormone receptors: new promises and challenges. Mol. Endocrinol. 28, 173–182 27. Lu, K. P., Hanes, S. D., and Hunter, T. (1996) A human peptidyl-prolyl isomerase essential for regulation of mitosis. Nature 380, 544 –547 28. Verdecia, M. A., Bowman, M. E., Lu, K. P., Hunter, T., and Noel, J. P. (2000) Structural basis for phosphoserine-proline recognition by group IV WW domains. Nat. Struct. Biol. 7, 639 – 643 29. Yaffe, M. B., Schutkowski, M., Shen, M., Zhou, X. Z., Stukenberg, P. T., Rahfeld, J. U., Xu, J., Kuang, J., Kirschner, M. W., Fischer, G., Cantley, L. C., and Lu, K. P. (1997) Sequence-specific and phosphorylation-dependent proline isomerization: a potential mitotic regulatory mechanism. Science 278, 1957–1960 30. Wulf, G., Finn, G., Suizu, F., and Lu, K. P. (2005) Phosphorylation-specific prolyl isomerization: is there an underlying theme? Nat. Cell Biol. 7, 435– 441 31. Rajbhandari, P., Schalper, K. A., Solodin, N. M., Ellison-Zelski, S. J., Ping Lu, K., Rimm, D. L., and Alarid, E. T. (2014) Pin1 modulates ER␣ levels in breast cancer through inhibition of phosphorylation-dependent ubiquitination and degradation. Oncogene 33, 1438 –1447 32. Cheng, J., Zhang, C., and Shapiro, D. J. (2007) A functional serine 118 phosphorylation site in estrogen receptor-␣ is required for down-regulation of gene expression by 17␤-estradiol and 4-hydroxytamoxifen. Endocrinology 148, 4634 – 4641 33. Valley, C. C., Me´tivier, R., Solodin, N. M., Fowler, A. M., Mashek, M. T., Hill, L., and Alarid, E. T. (2005) Differential regulation of estrogen-inducible proteolysis and transcription by the estrogen receptor ␣ N terminus. Mol. Cell. Biol. 25, 5417–5428 34. Stanya, K. J., Liu, Y., Means, A. R., and Kao, H. Y. (2008) Cdk2 and Pin1 negatively regulate the transcriptional corepressor SMRT. J. Cell Biol. 183, 49 – 61 35. Xu, Y. X., and Manley, J. L. (2007) Pin1 modulates RNA polymerase II activity during the transcription cycle. Genes Dev. 21, 2950 –2962 36. Yi, P., Wu, R. C., Sandquist, J., Wong, J., Tsai, S. Y., Tsai, M. J., Means, A. R., and O’Malley, B. W. (2005) Peptidyl-prolyl isomerase 1 (Pin1) serves as a coactivator of steroid receptor by regulating the activity of phosphorylated steroid receptor coactivator 3 (SRC-3/AIB1). Mol. Cell. Biol. 25, 9687–9699 37. Farrell, A. S., Pelz, C., Wang, X., Daniel, C. J., Wang, Z., Su, Y., Janghorban, M., Zhang, X., Morgan, C., Impey, S., and Sears, R. C. (2013) Pin1 regulates the dynamics of c-Myc DNA binding to facilitate target gene regulation and oncogenesis. Mol. Cell. Biol. 33, 2930 –2949 38. Poolman, T. M., Farrow, S. N., Matthews, L., Loudon, A. S., and Ray, D. W. (2013) Pin1 promotes GR transactivation by enhancing recruitment to target genes. Nucleic Acids Res. 41, 8515– 8525


60.

61.

62. 63.

64.

66.

67.

68.

69.

70.

71.

72.

73.


Res. Commun. 323, 750 –759 74. Eckert, B., Martin, A., Balbach, J., and Schmid, F. X. (2005) Prolyl isomerization as a molecular timer in phage infection. Nat. Struct. Mol. Biol. 12, 619 – 623 75. Lummis, S. C., Beene, D. L., Lee, L. W., Lester, H. A., Broadhurst, R. W., and Dougherty, D. A. (2005) Cis-trans isomerization at a proline opens the pore of a neurotransmitter-gated ion channel. Nature 438, 248 –252 76. Sarkar, P., Saleh, T., Tzeng, S. R., Birge, R. B., and Kalodimos, C. G. (2011) Structural basis for regulation of the Crk signaling protein by a proline switch. Nat. Chem. Biol. 7, 51–57 77. Benecke, A., Chambon, P., and Gronemeyer, H. (2000) Synergy between estrogen receptor alpha activation functions AF1 and AF2 mediated by transcription intermediary factor TIF2. EMBO Rep. 1, 151–157 78. Me´tivier, R., Penot, G., Flouriot, G., and Pakdel, F. (2001) Synergism between ERalpha transactivation function 1 (AF-1) and AF-2 mediated by steroid receptor coactivator protein-1: requirement for the AF-1 ␣-helical core and for a direct interaction between the N- and C-terminal domains. Mol. Endocrinol. 15, 1953–1970 79. Schaufele, F., Carbonell, X., Guerbadot, M., Borngraeber, S., Chapman, M. S., Ma, A. A., Miner, J. N., and Diamond, M. I. (2005) The structural basis of androgen receptor activation: intramolecular and intermolecular amino-carboxy interactions. Proc. Natl. Acad. Sci. U.S.A. 102, 9802–9807 80. Kobayashi, Y., Kitamoto, T., Masuhiro, Y., Watanabe, M., Kase, T., Metzger, D., Yanagisawa, J., and Kato, S. (2000) p300 mediates functional synergism between AF-1 and AF-2 of estrogen receptor ␣ and ␤ by interacting directly with the N-terminal A/B domains. J. Biol. Chem. 275, 15645–15651 81. Khan, S. H., Ling, J., and Kumar, R. (2011) TBP binding-induced folding of the glucocorticoid receptor AF1 domain facilitates its interaction with steroid receptor coactivator-1. PLoS One 6, e21939 82. Kumar, R., Volk, D. E., Li, J., Lee, J. C., Gorenstein, D. G., and Thompson, E. B. (2004) TATA box binding protein induces structure in the recombinant glucocorticoid receptor AF1 domain. Proc. Natl. Acad. Sci. U.S.A. 101, 16425–16430 83. Kumar, R., Moure, C. M., Khan, S. H., Callaway, C., Grimm, S. L., Goswami, D., Griffin, P. R., and Edwards, D. P. (2013) Regulation of the structurally dynamic N-terminal domain of progesterone receptor by proteininduced folding. J. Biol. Chem. 288, 30285–30299 84. Johnson, D. S., Mortazavi, A., Myers, R. M., and Wold, B. (2007) Genomewide mapping of in vivo protein-DNA interactions. Science 316, 1497–1502 85. Barski, A., Cuddapah, S., Cui, K., Roh, T. Y., Schones, D. E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007) High-resolution profiling of histone methylations in the human genome. Cell 129, 823– 837 86. Handel, A. E., Sandve, G. K., Disanto, G., Handunnetthi, L., Giovannoni, G., and Ramagopalan, S. V. (2013) Integrating multiple oestrogen receptor ␣ ChIP studies: overlap with disease susceptibility regions, DNase I hypersensitivity peaks and gene expression. BMC Med. Genomics 6, 45 87. Lin, C. Y., Vega, V. B., Thomsen, J. S., Zhang, T., Kong, S. L., Xie, M., Chiu, K. P., Lipovich, L., Barnett, D. H., Stossi, F., Yeo, A., George, J., Kuznetsov, V. A., Lee, Y. K., Charn, T. H., Palanisamy, N., Miller, L. D., Cheung, E., Katzenellenbogen, B. S., Ruan, Y., Bourque, G., Wei, C. L., and Liu, E. T. (2007) Whole-genome cartography of estrogen receptor ␣ binding sites. PLoS Genet. 3, e87



65.

D. W., Ding, C., Shi, Y., Yucer, N., Krenciute, G., Kim, B. J., Li, C., Chen, R., Li, W., Wang, Y., O’Malley, B. W., and Qin, J. (2011) Analysis of the human endogenous coregulator complexome. Cell 145, 787–799 Atsriku, C., Britton, D. J., Held, J. M., Schilling, B., Scott, G. K., Gibson, B. W., Benz, C. C., and Baldwin, M. A. (2009) Systematic mapping of posttranslational modifications in human estrogen receptor-␣ with emphasis on novel phosphorylation sites. Mol. Cell Proteomics 8, 467– 480 Lu, K. P., Suizu, F., Zhou, X. Z., Finn, G., Lam, P., and Wulf, G. (2006) Targeting carcinogenesis: a role for the prolyl isomerase Pin1? Mol. Carcinog. 45, 397– 402 Wulf, G., Ryo, A., Liou, Y. C., and Lu, K. P. (2003) The prolyl isomerase Pin1 in breast development and cancer. Breast Cancer Res. 5, 76 – 82 Lu, K. P., and Zhou, X. Z. (2007) The prolyl isomerase PIN1: a pivotal new twist in phosphorylation signalling and disease. Nat. Rev. Mol. Cell Biol. 8, 904 –916 La Montagna, R., Caligiuri, I., Maranta, P., Lucchetti, C., Esposito, L., Paggi, M. G., Toffoli, G., Rizzolio, F., and Giordano, A. (2012) Androgen receptor serine 81 mediates Pin1 interaction and activity. Cell Cycle 11, 3415–3420 Fujimoto, Y., Shiraki, T., Horiuchi, Y., Waku, T., Shigenaga, A., Otaka, A., Ikura, T., Igarashi, K., Aimoto, S., Tate, S., and Morikawa, K. (2010) Proline cis/trans-isomerase Pin1 regulates peroxisome proliferator-activated receptor ␥ activity through the direct binding to the activation function-1 domain. J. Biol. Chem. 285, 3126 –3132 Brondani, V., Schefer, Q., Hamy, F., and Klimkait, T. (2005) The peptidylprolyl isomerase Pin1 regulates phospho-Ser77 retinoic acid receptor ␣ stability. Biochem. Biophys. Res. Commun. 328, 6 –13 Ross-Innes, C. S., Stark, R., Teschendorff, A. E., Holmes, K. A., Ali, H. R., Dunning, M. J., Brown, G. D., Gojis, O., Ellis, I. O., Green, A. R., Ali, S., Chin, S. F., Palmieri, C., Caldas, C., and Carroll, J. S. (2012) Differential oestrogen receptor binding is associated with clinical outcome in breast cancer. Nature 481, 389 –393 Gianni, M., Boldetti, A., Guarnaccia, V., Rambaldi, A., Parrella, E., Raska, I., Jr., Rochette-Egly, C., Del Sal, G., Rustighi, A., Terao, M., and Garattini, E. (2009) Inhibition of the peptidyl-prolyl-isomerase Pin1 enhances the responses of acute myeloid leukemia cells to retinoic acid via stabilization of RAR␣ and PML-RAR␣. Cancer Res. 69, 1016 –1026 Lucchetti, C., Caligiuri, I., Toffoli, G., Giordano, A., and Rizzolio, F. (2013) The Prolyl isomerase Pin1 acts synergistically with CDK2 to regulate the basal activity of estrogen receptor ␣ in breast cancer. PLoS One 8, e55355 Laity, J. H., Chung, J., Dyson, H. J., and Wright, P. E. (2000) Alternative splicing of Wilms’ tumor suppressor protein modulates DNA binding activity through isoform-specific DNA-induced conformational changes. Biochemistry 39, 5341–5348 Laity, J. H., Dyson, H. J., and Wright, P. E. (2000) DNA-induced ␣-helix capping in conserved linker sequences is a determinant of binding affinity in Cys(2)-His(2) zinc fingers. J. Mol. Biol. 295, 719 –727 Pufall, M. A., Lee, G. M., Nelson, M. L., Kang, H. S., Velyvis, A., Kay, L. E., McIntosh, L. P., and Graves, B. J. (2005) Variable control of Ets-1 DNA binding by multiple phosphates in an unstructured region. Science 309, 142–145 Pursglove, S. E., Fladvad, M., Bellanda, M., Moshref, A., Henriksson, M., Carey, J., and Sunnerhagen, M. (2004) Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein. Biochem. Biophys.

Signal Transduction: Peptidylprolyl Isomerase Pin1 Directly Enhances the DNA Binding Functions of Estrogen Receptor α

J. Biol. Chem. 2015, 290:13749-13762. doi: 10.1074/jbc.M114.621698 originally published online April 12, 2015

Access the most updated version of this article at doi: 10.1074/jbc.M114.621698 Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 87 references, 36 of which can be accessed free at http://www.jbc.org/content/290/22/13749.full.html#ref-list-1


Prashant Rajbhandari, Mary Szatkowski Ozers, Natalia M. Solodin, Christopher L. Warren and Elaine T. Alarid

Binding of the estrogen receptor DNA-binding domain to the estrogen response element induces DNA bending.

Complementary DNA encoding the human T-cell FK506-binding protein, a peptidylprolyl cis-trans isomerase distinct from cyclophilin.

Prolyl isomerase Pin1 in cancer.

Peptidyl Prolyl Isomerase PIN1 Directly Binds to and Stabilizes Hypoxia-Inducible Factor-1α.

Regulation of AU-Rich Element RNA Binding Proteins by Phosphorylation and the Prolyl Isomerase Pin1.

Isolation of estrogen receptor-binding sites in human genomic DNA.

Prolyl isomerase Pin1 regulates the osteogenic activity of Osterix.

MicroRNA-140-5p inhibits hepatocellular carcinoma by directly targeting the unique isomerase Pin1 to block multiple cancer-driving pathways.

Uterine estrogen receptor interaction with estrogen-responsive DNA sequences in vitro: effects of ligand binding on receptor-DNA complexes.

Phosphate-Induced Renal Fibrosis Requires the Prolyl Isomerase Pin1.

Purified estrogen receptor enhances in vitro transcription.

ShaPINg Cell Fate Upon DNA Damage: Role of Pin1 Isomerase in DNA Damage-Induced Cell Death and Repair.

The prolyl isomerase pin1 regulates mRNA levels of genes with short half-lives by targeting specific RNA binding proteins.

Implications of estrogen receptor alpha and estrogen receptor beta for adipose tissue functions and cardiometabolic complications.

In vitro binding of the estrogen receptor to DNA: absence of saturation at equilibrium.

MicroRNA-296-5p (miR-296-5p) functions as a tumor suppressor in prostate cancer by directly targeting Pin1.

Peptidylprolyl isomerase A governs TARDBP function and assembly in heterogeneous nuclear ribonucleoprotein complexes.

Activation of the G protein-coupled estrogen receptor, but not estrogen receptor α or β, rapidly enhances social learning.

Characterization of estrogen binding in the developing rat testis. Ontogeny of the testicular cytoplasmic estrogen receptor.

Site-directed polyclonal antibodies inhibit binding of activated estrogen receptor to DNA.

Effect of estrogen receptor α binding on functional DNA methylation in breast cancer.

Expression of peptidyl-prolyl isomerase PIN1 and its role in the pathogenesis of extrahepatic cholangiocarcinoma.

Human chromosome segregation involves multi-layered regulation of separase by the peptidyl-prolyl-isomerase Pin1.

Pathological Role of Peptidyl-Prolyl Isomerase Pin1 in the Disruption of Synaptic Plasticity in Alzheimer's Disease.