article published online: 9 march 2015 | doi: 10.1038/nchembio.1770

Pharmacological folding chaperones act as allosteric ligands of Frizzled4

© 2015 Nature America, Inc. All rights reserved.

Serena F Generoso1,6, Mariateresa Giustiniano2,6, Giuseppe La Regina3, Sara Bottone2, Sara Passacantilli3, Salvatore Di Maro2, Hilde Cassese2, Agostino Bruno2, Massimo Mallardo1, Monica Dentice4, Romano Silvestri3, Luciana Marinelli2, Daniela Sarnataro1,5, Stefano Bonatti1, Ettore Novellino2 & Mariano Stornaiuolo2* Upon binding, ligands can chaperone their protein targets by preventing them from misfolding and aggregating. Thus, an organic molecule that works as folding chaperone for a protein might be its specific ligand, and, similarly, the chaperone potential could represent an alternative readout in a molecular screening campaign toward the identification of new hits. Here we show that small molecules selected for acting as pharmacological chaperones on a misfolded mutant of the Frizzled4 (Fz4) receptor bind and modulate wild-type Fz4, representing what are to our knowledge the first organic ligands of this until-now-undruggable GPCR. The novelty and the advantages of the screening platform, the allosteric binding site addressed by these new ligands and the mechanism they use to modulate Fz4 suggest new avenues for development of inhibitors of the Wnt–b-catenin pathway and for drug discovery.

T

o be properly active, a protein must attain its correct threedimensional structure. Native conformations are achieved after nascent chains undergo the series of structural transitions required for their specific folding pathway1–3. Defects in protein folding are associated to several pathologies, altogether referred to as conformational diseases4. The binding of orthosteric or allosteric drugs to their target proteins may promote the folding of the latter by shifting the ­thermodynamic folding equilibrium toward the native conformation5. These, together with folding intermediates that are endowed with properly organized binding pockets, are the only conformations able to form ligand binding interactions. Ligand binding lowers the free energy of the proteins, increasing their stability6. Moreover, the low energy state of the ligand–protein complex minimizes off­pathway interactions, preventing misfolding and aggregation. It is thus not surprising that the cell uses chaperonic endogenous ligands for post-translationally controlling protein activity. In the presence of nicotine6–8, GABA9 or tyrosine10, the folding efficiency of the nicotinic acetylcholine receptor, the γ-aminobutyric receptor and tyrosinase strongly increases, respectively. By coupling ligand availability to folding efficiency, the cell finely regulates topological and temporal expression of the protein networks5,11. The concept of ligands as pharmacological chaperones has found great applications in the treatment of pathological conditions associated with folding defects12–14. Opioid15, V2-vasopressin5,12, luteinizing hormone16 and β1-adrenergic17 receptors are only a few examples of the G protein–coupled receptors (GPCRs) whose ligands were shown to rescue the function of mutated receptors13,14. Moreover, patients affected by nephrogenic diabetes insipidus, a pathology included among the conformational diseases, were shown to benefit from treatment with V2R antagonists12,18. To date, known ligands of a protein were assayed for their pharmacological chaperone potential. Here, for what is to our knowledge the first time, we show that the potential to rescue misfolded targets

can be used as a readout in screening campaigns toward the identification of new ligands. This new approach may be a valid alternative to traditional screenings, useful especially for protein targets with absent, unknown or complicated signaling pathways. Fz4 is a member of the Frizzled cell surface receptors, which belong to the GPCR class F family19. Seven-transmembrane (TM) segments arrange in the canonical GPCR TM bundle (TMD) and interconnect via three intracellular loops (ICL) and extracellular loops19,20. A large extracellular domain (ECD) binds the receptor’s ligands, the lipoproteins WNTs19 and Norrin21. Finally, a short cytosolic C-terminal tail helps the ICLs orchestrate the downstream intracellular signal22. Several mutations in the coding region of the Fz4 gene have been described in different organisms23,24. In humans, despite being rare, they lead to the development of familial exudative vitreoretinopathy (FEVR), a pathology resulting in aberrant vascularization of the retina during embryo development25. Among the mutations, the frameshift L501fsX533 of Fz4 shows autosomal dominant inheritance and causes a conformational defect by generating a different and shorter C-terminal cytosolic tail that hampers signaling of the mutant receptor (henceforth referred as Fz4-FEVR) and its correct folding and transport to the cell plasma membrane (PM)25–27. The search for organic modulators of Fz4 was recently intensified owing to evidence of its involvement in malignancy. Fz4 is indeed a key component of Wnt–β-catenin signaling that regulates stemness during cellular development and in adult life28. Misregulation of Fz4 activity is involved in tumor proliferation and cancer stem cell genesis in many types of malignancies, such as glioblastoma29, colorectal and breast cancer30,31 in both humans and animal models32. To date, the existence of low-molecular-weight organic molecules binding to and modulating Fz433–35 has not been reported. Here we attempted a molecular screening campaign toward pharmacological chaperones rescuing Fz4-FEVR folding with the ultimate goal to identify small organic wild-type (WT) Fz4 (Fz4-WT)

Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, Naples, Italy. 2Department of Pharmacy, University of Naples Federico II, Naples, Italy. 3Istituto Pasteur—Fondazione Cenci Bolognetti, Dipartimento di Chimica e Tecnologie del Farmaco, Sapienza University of Rome, Rome, Italy. 4Department of Clinical Medicine and Surgery, University of Naples Federico II, Naples, Italy. 5CEINGE-Biotecnologie Avanzate, s.c.a.r.l., Naples, Italy. 6These authors contributed equally to this work. *e-mail: [email protected] 1

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

1

article

Nature chemical biology doi: 10.1038/nchembio.1770

modulators. We selected molecules able to work as folding chaperones by measuring their potency in restoring Fz4-FEVR folding and localization at the PM. We identified three pharmacological chaperones of Fz4-FEVR that are indeed Fz4-WT ligands and act as Wnt–β-catenin inhibitors, proving the validity of the new screening strategy. One of our hits, namely FzM1, exerts its modulatory activity by inducing conformational changes in Fz4-WT that ultimately allow it to inhibit β-catenin nuclear transport and antagonize the Wnt pathway. The Fz4 modulators here described represent what are to our knowledge the first organic molecules addressing this still-undruggable receptor. Here, the novelty of the screening approach, the step of the Wnt–β-catenin cascade targeted by our new compounds together with their mechanism of action are discussed in terms of future development of Wnt pathway inhibitors.

© 2015 Nature America, Inc. All rights reserved.

RESULTS Rescue of Fz4-FEVR as readout to identify Fz4-WT ligands

Among the Fz4 mutations described25, the one resulting in Fz4FEVR shows the most clearly identifiable phenotype, trapping the mutant receptor in the endoplasmic reticulum (ER) and hampering its transport to the PM of the cells25,26. The mutated C-terminal tail of Fz4-FEVR improperly interacts with the ER lipid bilayer, disturbing receptor stability and inducing its aggregation and retention in the ER (Fig. 1a)27. Notwithstanding, Fz4-FEVR localization at the PM can be rescued by overexpressing the protein chaperone α-B crystallin26. Fz4-FEVR can be thus included among the proteins that are responsible for conformational diseases whose phenotype can be rescued by strategies aiming to improve folding. The marked difference in localization between the WT and mutant receptor makes Fz4-FEVR an ideal platform to screen for folding chaperones by offering an unambiguous readout. Two cell lines stably expressing hemagglutinin (HA)-tagged WT Fz4 (HA-Fz4-WT) or Fz4-FEVR (HA-Fz4-FEVR) were generated. As previously shown26,27, HA-Fz4-WT was localized in the Golgi complex and at the PM, whereas HA-Fz4-FEVR appeared to be trapped intracellularly, mainly in the ER (Fig. 1b and Supplementary Results, Supplementary Figs. 1–3)27. HA-Fz4-FEVR HEK293 cells were treated with a library of small molecules (Supplementary Tables 1–3) for 48 h. Chaperone activity was then assayed by measuring the recovery of HA-Fz4-FEVR localization at the PM (Supplementary Tables 4 and 5). Among others, the library contained folding chaperones (radicicol, geldanamycin and 17AAG) and correctors (acridine derivatives, DMSO and glycerol) with known rescuing activity on the cystic fibrosis transmembrane conductance regulator (CFTR) mutant CFTRΔF508 (ref. 36). Those folding chaperones that were already known failed in rescuing Fz4-FEVR localization, whereas the compound FzM1 (1; Fig. 1c) rescued Fz4-FEVR localization at the PM in 15% of the cell population. FzM1 pharmacological activity was confirmed after resynthesis. A further pool of molecules that were structurally similar to FzM1 was added to the screen (compounds 2–12) (Supplementary Table 3 and Supplementary Note). Among the tested candidates, FzM1, 2 and 3 rescued HA-Fz4-FEVR PM localization with an efficiency higher than 10% and with a half-maximum effective concentration (EC50) in the micromolar range (Fig. 1d,e and Supplementary Fig. 5). In untreated cells, Fz4-FEVR forms covalent aggregates27. As shown by western blot analysis of lysates of Fz-FEVR–expressing cells, FzM1 treatment increased Fz4-FEVR solubility in a dose-­response manner (Supplementary Fig. 5), further confirming that it is a chaperone for the mutant receptor. We validated our hits using U87MG glioblastoma cells as a second biological platform. These cells express endogenous Fz4-WT, which they depend on for their in vivo invasiveness29. In U87MG cells, HA-Fz4-WT appeared to localize at the PM of the cells, as expected (Fig. 1f and Supplementary Fig. 6). U87MG tolerated 2

overexpression of HA-Fz4-WT well, whereas expression of HA-Fz4FEVR was toxic for these cells (Fig. 1f and Supplementary Fig. 7). The mutant receptor seemed to localize intracellularly, and the cells appeared stressed and presented pyknotic nuclei. Upon FzM1 treatment, the mutant receptor HA-Fz4-FEVR was able to localize to the PM (Fig.  1f and Supplementary Fig. 6). Moreover, the nuclei of the transfected cells presented normal morphology, and the cells appeared relieved (Supplementary Fig. 7). In U87MG cells, pharmacological chaperones of Fz4 could be screened simultaneously with a double readout as these chaperones reestablished Fz4-FEVR localization at the PM and relieved Fz4-FEVR–transfected cells from stress. Thus, FzM1 promotes HA-Fz4-FEVR PM localization in two different cell lines. Treatment of the HA-Fz4-FEVR stable cell line with FzM1 resulted in unambiguous recovery of PM localization in 10–15% of the population, an efficiency similar to that exerted by pharmacological chaperones on CFTRΔF508 (ref. 36). Notably, when the mutant was transiently expressed either in U87MG or HEK293 cells, FzM1 induced HA-Fz4-FEVR PM localization in a much higher percentage of cells (30% and 68% of recovery after 24 h and 48 h of treatment, respectively; Supplementary Fig. 8). This difference most likely indicates that the ligands support HA-Fz4FEVR molecules in the process of folding rather than rescuing those that are already aggregated. The latter accumulate in the HA-Fz4FEVR stable HEK293 cell line before treatment with compound26,27, and, because they have a covalent nature27, they could indeed be difficult to rescue. We recently proved that, similarly to Fz4-FEVR, an ER-trapped mutant of the Cu2+ transporter ATP-7B, namely ATP-7B-H1069Q, can be rescued by overexpressing the cellular chaperone α-B crystallin26. FzM1 did not rescue either ATP-7B-H1069Q (Supplementary Fig. 9) or the mutants CFTRΔF508 (Supplementary Fig. 10) and VSV-G-tsO45 (Supplementary Fig. 11), indicating that the molecule did not act as a promiscuous molecular chaperone. We thus moved to confirm our main hypotheses by proving that the pharmacological chaperones of Fz4-FEVR, identified by our screening platform, were indeed Fz4-WT modulators. We tested the ability of compounds FzM1, 2 and 3 to modulate the Wnt–βcatenin pathway with a T-cell factor /lymphoid enhancer factor (TCF/LEF) luciferase transcription assay. HEK293 cells do not express endogenous Fz4, and thus, as expected, the treatment with the specific Fz4 agonist, Norrin, did not increase basal TCF/LEF activity (Supplementary Fig. 12). Upon transient expression of Fz4-WT, Norrin was able to increase TCF/LEF activity twofold. As previously shown37, TCF/LEF activation can be further augmented by co­expressing Fz4-WT with low-density lipoprotein receptor 5 (LRP5). Treatment with compounds FzM1, 2 and 3 (Supplementary Fig. 12) did not activate TCF/LEF–dependent transcription in Fz4-WT, Fz4-WT-LRP5 or untransfected HEK293 cells, excluding them as activators of the Wnt–β-catenin pathway. On the contrary, in the presence of the compounds, Norrin-dependent TCF/LEF activation was abolished, suggesting that these molecules could be inhibitors of the Wnt–β-catenin pathway (Fig.  1g and Supplementary Fig. 12). Independently from the presence of LRP5, FzM1 was able to compete with Norrin. Molecules with no pharmacological chaperone activity on Fz4-FEVR (for instance, 4 and 5) failed to act as Wnt inhibitors, confirming the specificity of the screening platform. The frame shift mutation generating the C-terminal tail of Fz4-FEVR causes the loss of part of the KTXXXW motif, which is necessary, together with the ICL3, to mediate interactions with the effector of Fz4, the protein dishevelled (Dsh)38. Thus, despite the ability to rescue Fz4-FEVR folding, this receptor still remains nonfunctional. When Fz4-FEVR was transiently expressed in HEK293, treatment with FzM1, 2 and 3 only minimally affected TCF/LEF activation, proving that they require a fully functional Fz4-WT receptor to act as Wnt inhibitors (Supplementary Fig. 12).

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

© 2015 Nature America, Inc. All rights reserved.

Nature chemical biology doi: 10.1038/nchembio.1770

Figure 1 | Rescue of Fz4-FEVR PM localization as biological platform toward the identification of Fz4 modulators. (a) Schematic cartoon of Fz4-WT and Fz4-FEVR receptors. Through improper interactions with the ER membranes, the Fz4-FEVR tail causes receptor aggregation. (b) Cellular localization of Fz4 and Fz4-FEVR expressed in HEK293 cells. Confocal immunofluorescence of nonpermeabilized (PM) and permeabilized (intracellular) cells showing PM and ER localization of Fz4 and Fz4-FEVR (green), respectively. Colocalization with the ER marker calnexin (magenta) is shown. Scale bars, 10 μm. (c) Chemical structure of FzM1. EC50 values for PM rescue and Wnt inhibition are indicated (n = 3, mean ± s.e.m.). (d) Rescue of Fz4-FEVR localization at the PM upon FzM1 treatment. Confocal immunofluorescence of nonpermeabilized cells showing PM localization of Fz4-FEVR upon treatment with FzM1. Fz4-WT expressing cells are shown for comparison. Scale bars, 20 μm. (e) Dose-response curve of FzM1 rescue of Fz4-FEVR PM localization. (n = 3, ten random fields containing at least 50 cells counted for each replicate; s.d. are indicated). (f) Intracellular localization of HA-Fz4 and HA-Fz4-FEVR expressed in U87MG cells. Immunofluorescence of permeabilized and nonpermeabilized cells showing PM localization of HA-Fz4-WT, ER localization of HA-Fz4-FEVR and rescue of HA-Fz4-FEVR localization at the PM upon treatment with FzM1. Scale bars, 10 μm. (g) Dose-response curve for FzM1 inhibition of Wnt signaling. HEK293 cells were transiently transfected with HA-Fz4-WT and LRP5 and treated with Norrin (40 ng ml−1) in the presence of the indicated concentration of FzM1. Measurements were done in triplicate and are shown as mean ± s.d. RLE, relative luciferase expression.

FzM1’s inability to modulate Wnt signaling in HEK293 cells transfected with HA-Fz4-FEVR or untransfected cells indicates, as well, that the molecules are not modulating Dsh or other proteins acting downstream of Fz4 in the Wnt pathway. Notably, when FzM1 was washed out after being used for treatment, Norrin regained its ability to activate TCF/LEF, indicating

article that the inhibition exerted by FzM1 is reversible. This would ­ideally allow the use of FzM1 in Fz4/Fz4 L501fsX533 heterozygosity, a genetic condition known to generate FEVR in vivo. Fz4WT/Fz4-FEVR autosomal negative dominance was reproduced in vitro by coexpressing the WT and mutant receptor24. As expected, in cells co-expressing Fz4-WT and Fz4-FEVR, Norrin was unable to activate TCF/LEF (Supplementary Fig. 12). Fz4FEVR aggregates trap Fz4-WT in the ER either directly, by improper oligomerization between the WT and mutant receptor24, and/or indirectly, by affecting overall ER morphology and ER-to-PM transport39. In both scenarios, by rescuing Fz4-FEVR solubility, FzM1 could release Fz4-WT from the ER and allow its transport to the PM. After FzM1 was washed out from cells coexpressing Fz4-WT and Fz4-FEVR, Norrin regained its activity, indicating that FzM1 treatment, at least in in vitro cultured cells, is able to rescue Fz4-WT from Fz4-FEVR negative dominance (Supplementary Fig. 12). Thus, FzM1, together with two other positive hits, all from a screening platform evaluating the pharmacological chaperone activity of molecules on Fz4-FEVR folding, are indeed modulators of Fz4WT and inhibitors of the Wnt–β-catenin pathway.

FzM1 binding site

To further confirm that the new screening platform indeed selected molecules addressing our target, we identified the FzM1 binding site on Fz4-WT. Attempting to transform FzM1 in a molecular probe, we derivatized it with an alkyne moiety (FzM1alk (13); Fig.  2a). Despite being extremely unreactive, alkynes can receive nucleophilic attacks from sulfhydryl or hydroxyl group of amino acids to generate covalent adducts. This extremely rare event has been shown to happen at catalytic sites of enzymes as well as in ligand binding pockets40. FzM1alk is still a pharmacological chaperone of Fz4-FEVR, and it is also able to abolish TCF/LEF activity in Fz4-WT–expressing cells (log EC50 as pharmacological chaperones and as Wnt antagonist of −4.8 and −4.9, respectively; Fig. 2a and Supplementary Fig. 12).

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

3

article

Nature chemical biology doi: 10.1038/nchembio.1770 HA-Fz4-FEVR

HA-Fz4

HA-Fz4

T425A K426A

-FEVR

d

PM

e

O

HN

5

8

6

TM5

S

FzM1 FzM1alk log EC50 (PM rescue)

TM6

Tail

8 ICL3

ICL3

= –4.82 ± 0.08

log EC50 (Wnt antagonism) = –4.92 ± 0.10

0

1

10

Fz4

–

Smo

–

f

7

O

RLE (fold reduction)

HN

ICL3

Ser418

1.0

0.5

0

CRE TCF/LEF Gli –8

Thr425

–7

–6 –5 log [FzM1]

–4

–3

log EC50(TCF)= –5.75 ± 0.04 log EC50(Gli)= –4.61 ± 0.02 log EC50(CRE)> –4.0

Deuterium exchange upon FzM1 binding (level of deuteration; FzM1 treated/untreated)

Figure 2 | FzM1 binding site and mechanism of action as folding chaperone. (a) Chemical structure of FzM1alk. EC50 values for FzM1alk as a folding chaperone for Fz4-FEVR and as a Wnt inhibitor are indicated (n = 3, mean ± s.e.m.). (b) Solvent accessibility of Fz4 region upon binding to FzM1 measured by the rate of HDX. The color scale reflects the level of deuterium exchange measured as difference in peptide mass in the presence or in the absence of FzM1. The arrows indicate FzM1 binding site and the C-terminal tail movement upon FzM1 binding. Numbers indicate TMD helices (5–7) and the C-terminal tail helix (8). ICL3 is indicated. (c) Cellular localization of HA-Fz4, HA-Fz4-FEVR and HA-Fz4T425A K426A-FEVR transfected in HEK293 cells. Immunofluorescence of nonpermeabilized cells showing the PM localization of HA-Fz4-WT and HA-Fz4T425A K426A-FEVR but not of HA-Fz4-FEVR. Scale bars, 10 μm. (d) Alignment at ICL3 between Fz4 and Smo (highlighted in yellow is the predicted Dsh binding site on Fz4). (e) Cartoon and surface representation of Fz4 ICL3 (yellow) and C-terminal tail (green). (f) Dose-response curves for FzM1 inhibition of TCF/LEF, Gli and CRE activity. Inhibition EC50 values and statistics (n = 3, mean ± s.e.m.) are as in Figure 1f. RLE, relative luciferase expression.

4

Fz M

1

hi

Ve

Fz M

cle

1

Ve

hi

cle

HA-Fz4-WT HEK293 cells were cultured in the presence of solvent accessibility of ICL3, TM5–7 and the C-terminal tail of the FzM1alk. Fz4 was immunopurified, digested with trypsin and ana- receptor was reduced, whereas the rest of the protein became more lyzed by LC/MS. HPLC profiles of samples from FzM1alk-treated solvent accessible (Fig. 2b and Supplementary Fig. 15). The buried cells and untreated cells were compared. These almost totally over- ICL is part of the Dsh binding region38. Its burial from solvent upon lapped, with the exception of a fraction eluting with a retention time ligand binding appears compatible with ICL3 being contacted by of 17.2 min and present only in samples obtained from FzM1alk- FzM1 and with a change in the conformation of this loop. A burial treated cells (Supplementary Fig. 13). Among the peptides eluting of the C-terminal tail can be also hypothesized from the HDX data. in this fraction, the one with an m/z of 1,386.9 Da corresponded, The latter could be due to a tighter interaction of the tail with ICL3 with a deviation (Δmass) of 1.6 Da from the theoretical mass, to or, more likely, as seen for many other GPCRs41, with the tail interamino acids 418–426 of Fz4 ICL3 (theoretical mass of 990 Da) acting with the detergent micelles. carrying FzM1alk (molecular weight 398.5 Da) covalently linked We envisaged that the diminished solvent accessibility of ICL3 either to S418 or to T425 (Supplementary Fig. 14; theoretical upon FzM1 binding could have been the mechanism behind the mass [M-H-FzM1alk]+ of 1,388.5 Da). A peptide with this m/z was folding chaperone effect of the molecule on Fz4-FEVR. To verify present exclusively in the FzM1alk-treated sample. In contrast, the this, we replaced ICL3 residues with alanines to affect the fold of peptides that co-eluted with it (Supplementary Fig. 13) were not this ICL and its interactions with the solvent. Mutations in the ICL3 unique as they were also present in the untreated sample in similar of Fz4-WT have already been shown to inhibit Dsh binding and abundances, and thus they were not further considered. Thus, the antagonize Fz4 functionality38. We mutated some amino acids in the spectra indicated that FzM1alk interacted with Fz4 ICL3 by con- FZ4-FEVR ICL3 to then test the effect of such mutations on the PM tacting at least S418 or T425. Together with the C-terminal tail, this localization of the receptor (similarly, amino acids were substituted loop forms the binding region for Dsh38. in ICL1 and ICL2 for comparison; Supplementary Figs. 16 and 17). Binding of FzM1alk or FzM1 to Fz4 ICL3 should cause a change in Notably, the resulting mutant receptor regained PM localization solvent accessibility in this region of the receptor. These changes can only when T425 and K426 of FZ4-FEVR were mutated (Fig. 2c). be highlighted by measuring the LiCl a b rate of hydrogen-to-deuterium LiCl Untreated Vehicle FzM1 exchange (HDX) at this site. In β-catenin β-catenin β-catenin 100 the absence of FzM1, almost * 80 the entire receptor exchanged 60 its hydrogen atoms with deu40 terium (with the exception of a helix of the ECD domain, amino 20 acids 154–164; Supplementary 0 Table  6 and Supplementary Fig. 15). As expected, the Figure 3 | Molecular mechanism behind FzM1 inhibition of Wnt pathway. (a) Inhibition of β-catenin nuclear C-terminal tail and the ECD of translocation by FzM1. U87MG cells were treated with LiCl (30 mM) in the presence or not of FzM1 (10 μM). the receptor showed the higher The immunofluorescence shows the intracellular localization of β-catenin (green). Scale bars, 10 μm. (b) The rate of exchange compared to histogram shows the percentage of cells with β-catenin in the nucleus after treatment with LiCl in the presence or the TMD. Upon FzM1 binding, not of FzM1 (n = 3, data represent mean ± s.e.m.; *P < 0.05). Cells with nuclear β-catenin (%)

© 2015 Nature America, Inc. All rights reserved.

42 6 42 9

c

b

41 7

a

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

article

Nature chemical biology doi: 10.1038/nchembio.1770

the abundance of the monophosphorylated β-catenin peptide spanning amino acids 551–565 (ref. 45) decreased upon FzM1 treatment (Supplementary Fig. 18). In contrast, the amount of unphosphorylated peptide increased upon FzM1 treatment. These data suggested that FzM1 could act as a Wnt inhibitor by hampering the formation of the Fz4–Dsh complex, inducing Dsh degradation and ultimately blocking β-catenin phosphorylation at S552 and thus its cytosolic accumulation.

The effect of FzM1 on tumor cells

By blocking TCF/LEF–dependent gene transcription, FzM1 might have potential as an inhibitor of tumor cell growth. Some of the TCF/LEF genes are, indeed, related to tumor cell survival, differentiation and invasiveness35. We thus looked at the effects of FzM1 treatment on growth, differentiation and migration of U87MG glioblastoma cells. Fz4 expression in these cells has already been shown to relate to invasiveness and the differentiation state of the cells29. a

b

β-catenin/DAPI

Vehicle

β-catenin/DAPI

FzM1

Vehicle

FzM1

The FzM1 mechanism behind Wnt pathway inhibition

β-catenin/DAPI

c

β-catenin/DAPI

Vehicle

FzM1

Nestin/DAPI

d

po N st est ive in ce lls av N er eu ag ro e sp Z- h di er am e N ne um et ur b er os er ph o f er es

e Vehicle

FzM1

100

CaCo-2 cells (%)

β-catenin

150 100 50

tre Veated hi (d c Un Fz le ( ay 0 tre M1 day ) ( a t Ve ed day 3) hi (d 3 cle a ) F Un z ( y 0 tre M1 day ) ( Veated day 3) hi (d 3 ) c Fz le ( ay M da 0) 1( y da 3) y3 )

β-catenin

g

or ch pho an lo ge gy Eca po dh sit er ive in βpo cat sit en ive in

FzM1 Vehicle

M

50 0

f

Nestin/DAPI

Un

FzM1 acts as inhibitor of Wnt–β-catenin signaling by inhibiting transcription of TCF/LEF–regulated genes (Fig. 1g). The prerequisite for TCF/LEF transcription is the nuclear accumulation of β-catenin33,35. However, for this to happen, β-catenin must be first dislodged from the PM, where it forms a stable complex with E-cadherin. This complex keeps β-catenin in a resting state by protecting it both from the APC destruction complex (Axin, APC and GSK3-β)35, which is responsible for its degradation, and from its nuclear transport, which is necessary for TCF/LEF activation. Fz4 controls several events leading to β-catenin nuclear accumulation. It recruits Dsh, which is protected by proteasomal degradation44, and, in complex with Fz4, recruits the intracellular kinases31 responsible for β-catenin C-terminal phosphorylation and its dislodgment from the PM45. Furthermore, the Dsh–Fz4 complex destabilizes the APC complex, protecting β-catenin from degradation and ultimately allowing its nuclear translocation. To understand the mechanism of action behind FzM1 inhibition of TCF/LEF activity, we started looking at the intracellular levels of Dsh and β-catenin. We used HeLa cells expressing a higher amount of endogenous Dsh. Similarly to what was seen for HEK293 cells, upon Fz4-WT expression FzM1 treatment blocked Norrin-induced TCF/LEF activity (Supplementary Fig. 12). Upon treatment with FzM1, total intracellular levels of Dsh were reduced with respect to untreated cells (Supplementary Fig. 18), indicating that FzM1 affected Fz4-dependent Dsh stabilization. The total level of β-catenin was, however, unaltered by FzM1 treatment in all of the cell lines tested (Supplementary Fig. 18), indicating that FzM1 modulates neither GSK3-β nor the APC destruction complex. We thus wondered whether FzM1 affected β-catenin intracellular localization. As expected29, β-catenin, at the steady state, was localized in U87MG cells at the PM. When cells were cultured in the presence of LiCl, an inhibitor of GSK3-β, β-catenin accumulated in the nucleus (Fig. 3a). FzM1 treatment by itself did not have effect on β-catenin localization. In cells simultaneously cultured in the presence of FzM1 and LiCl, however, β-catenin nuclear accumulation was hampered (Fig. 3a,b and Supplementary Fig. 19). Similarly, FzM1 was able to block TCF/LEF activation induced by LiCl (Supplementary Fig. 12). We envisaged that FzM1, by inducing Dsh degradation, was indirectly inhibiting β-catenin C-terminal phosphorylation and detachment from the PM. Cells cultured in the presence of FzM1 and treated or not with LiCl were lysed, and β-catenin was immuno­isolated, digested and processed by LC/MS. LC/MS analysis ­indicated that

Control (%)

© 2015 Nature America, Inc. All rights reserved.

Though the FEVR C-terminal tail induces Fz4-FEVR aggregation27, ICL3 can counterbalance the effect of the tail, influencing the susceptibility of the full receptor to the aggregation. By identifying the FzM1alk binding site at the ICL3 region, we proved that this pharmacological chaperone is indeed a ligand of Fz4-WT. The ICL3 sequence is very well conserved among the class F GPCR members (ten different Frizzled proteins and the Smoothened receptor (Smo))41, with S418, one of the anchoring points of FzM1alk, being conserved in Smo (Fig. 2d,e). We performed a comparison of FzM1 effect on the activity of TCF/LEF promoters (dependent on Frizzleds) and on Gli promoters (dependent on Smo; Fig. 2f). As a further control, we looked at FzM1’s effect on the activity of cAMP-responsive elements (CREs), which are modulated by GPCRs linked to G proteins but not involved in Fz4-dependent signaling. We performed this experiment in CaCo-2 cells, which are known to endogenously express Fz4 and Smo and their agonists, Norrin and Sonic, respectively42,43. FzM1 inhibited Gli activity less efficiently than TCF/LEF activity (log EC50 of −4.6 and −5.7, respectively). On the contrary, it did not modulate CRE activity (log EC50 > −4.0), indicating that it does not influence GPCRs linked to G proteins (Fig. 2f).

Figure 4 | Effect of FzM1 treatment on U87MG and CaCo-2 cells. (a,b) FzM1 treatment affects U87MG neurosphere formation. Average shape, height and dimension of neurospheres (side view in a, top view in b) formed by U87MG cells in the presence of vehicle (DMSO 0.1%, 5 d) or of FzM1 (10 μM, 5 d). β-catenin is in green, and nuclei are in blue (DAPI). Scale bars, 20 μm. (c) FzM1 reduces the number of Nestin-positive U87MG cells. Nestin is in green, and nuclei are in blue (DAPI). Scale bars, 100 μm. (d) Reduction in number of Nestin-positive cells, number of neurospheres formed and neurosphere average diameter upon treatment of U87MG with FzM1 (n = 3, data represent mean ± s.e.m.). (e) FzM1 treatment (10 μM, 5 d) affects U87MG cell morphology (bright field image and nuclei are shown). Upon treatment, cells acquire a more differentiated phenotype. Scale bars, 100 μm. (f) FzM1 accelerates CaCo-2 cell differentiation. CaCo-2 cells were treated with vehicle (DMSO 0.1%, 3 d) or with FzM1 (10 μM, 3 d). Upon treatment, cells acquire a more differentiated phenotype (β-catenin is in green). Scale bars, 20 μm. (g) Quantification of differentiation of CaCo-2 (number of cells changed in morphology, E-cadherin–positive and β-catenin–positive cells) upon treatment with FzM1 (10 μM, 3 d); n = 3, data represent mean ± s.e.m.

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

5

© 2015 Nature America, Inc. All rights reserved.

article

Nature chemical biology doi: 10.1038/nchembio.1770

U87MG cells arrange on the culture dish to form neurospheres29 (Fig. 4a,b and Supplementary Figs. 20–23). These spherical cell clusters contain cells positive for Nestin, a neural stem cell marker (Fig. 4c and Supplementary Fig. 21)29. Neurosphere formation was markedly hampered by treatment with compound (Fig. 4a–c and Supplementary Figs. 20–22). At 10 μM, the compound affected neurosphere formation, but it reduced cell viability at higher concentrations (Fig. 4c,d and Supplementary Figs. 20–23). FzM1 did not induce apoptosis, as shown by the absence of annexin V–positive staining (Supplementary Fig. 24). On the contrary, FzM1 affected migration of U87MG cells in a Transwell chamber assay (Supplementary Fig. 25), and, remarkably, affected their morphology, causing them to acquire a more elongated or neuronal appearance (Fig. 4e and Supplementary Fig. 26). Similarly, the number of cells positive for Nestin decreased (Fig. 4c,d), suggesting that, upon FzM1 treatment, U87MG cells transitioned toward a more differentiated phenotype. To prove that FzM1, by inhibiting Wnt signaling, indeed induced differentiation of cells, we tested its effect on CaCo-2 cells. Like U87MG cells, CaCo-2 cells express endogenous Fz4 and Norrin and have high basal TCF/LEF activity42. When cultured in vitro, they slowly differentiate to form monolayers of differentiated epithelial cells. Similarly to what seen for U87MG cells, CaCo-2 cells were sensitive to FzM1 treatment, which blocked the high basal TCF/LEF activity at 5 μM and affected cell viability at higher concentrations (Supplementary Fig. 27). Notably, the compound sped up the differentiation of CaCo-2 cells, as shown by the marked change in their morphology (increase in cytoplasm volume; Fig. 4f,g and Supplementary Fig. 28) and by the expression of the differentiation marker E-cadherin (Supplementary Fig. 29). Overall, our results indicate that the blockage of Wnt–β-catenin pathway exerted by FzM1 affected the growth and differentiation state of at least two tumor cell lines, the U87MG cells and the Caco-2 cells, known to rely on an active Wnt pathway to maintain their undifferentiated proliferative state.

DISCUSSION

That ligands can act as pharmacological chaperones in rescuing the folding of their targets is undoubtedly a milestone in structural biology. Here, for what is to our knowledge the first time, we proved that, by transitive property, this same concept can constitute the rationale on which to base a molecular screening platform for the identification of new ligands. We here described what are to our knowledge the first small molecules that address the until-nowundruggable Fz4 receptor and inhibit Wnt signaling. This goal was achieved by using the potency of candidate molecules to rescue the ER-trapped folding defective mutant of Fz4, Fz4-FEVR, as a readout for our screening. Three molecules in our library rescued Fz4-FEVR PM localization with an EC50 in the micromolar range. The same compounds were at the same time able to modulate Wnt signaling, proving the validity of our screening platform. FzM1alk, one of our positive hits, physically interacted with the ICL3 of the receptor. This unstructured loop is involved in the interaction of Fz4 with Dsh, the protein that intracellularly transduces the activation state of Fz4. ICL3 length and primary sequence varies among the different classes of GPCR. However, the ICL3 of Fz4 and Smo, another class F GPCR member, are similar41. Accordingly, FzM1 can inhibit intracellular Gli activity. Despite the low potency (only micromolar) of the hit, we documented a partial selectivity of the compound over the two pathways, suggesting that an optimized version of FzM1 will eventually better discriminate between these close GPCRs. It could have been expected that a screening platform that uses as readout the potency in rescuing folding-defective mutants would have identified especially intercalating agents or detergents. 6

In contrast, our biological platform selected compounds directly addressing the target. Despite the need to validate the new screening platform’s success rate by testing a higher number of compounds on many different targets, we believe that this strategy constitutes an interesting alternative to traditional screening approaches. It might be especially useful in the case of protein targets difficult to purify in large quantities and proteins with unclear, unknown or even absent connections to signaling cascades, such as orphan receptors or prions. Furthermore, we have previously shown that appending the mutated tail of Fz4-FEVR to other TM proteins is sufficient to determine the unfolding of the chimeric proteins and their ER retention27. One could consider the FEVR tail as a universal aggregating module to be appended to the protein to be targeted, with the resulting chimera being the biological platform on which to base the screening campaign. FzM1alk, and most likely FzM1, binds the ICL3 of Fz4. Thus, they do not address the canonical orthosteric Wnt binding site and should rather be defined as allosteric modulators. Although the LC/MS results we presented indicate a very likely candidate binding site, we cannot exclude the possibility that it is not the only one. FzM1alk could have multiple binding sites on the receptor, either devoid of the nucleophiles necessary to establish a covalent linkage with the compound or not detected by the LC/MS analysis. Notwithstanding, binding of FzM1alk to the ICL3 of Fz4 well explains its effect as a Fz4-WT modulator. This loop is certainly involved in signal transduction by forming, together with the KTXXXW motif at the C-terminal tail of Fz4, the Dsh binding site38. Mutations at the level of ICL3 have been shown to abolish Dsh binding and inhibit functionality of Frizzled proteins23,24,46. FzM1alk bound to S418 or T425 could alter the conformation of ICL3 and hamper the binding of the effector, ultimately antagonizing Wnt signaling. In our opinion, the change in the conformation of ICL3 upon FzM1 binding is also the mechanism behind the pharmacological chaperone activity it exerts on Fz4-FEVR. Fz4-FEVR bound to FzM1 is more resistant to receptor aggregation and is properly transported to PM. Moreover, a Fz4-FEVR mutant carrying T425 and K426 mutated to alanine reaches the PM despite the presence of the mutated tail. Upon FzM1 binding or when the T425A or K426A mutations are present, the new conformation that ICL3 adopts can compromise the contacts the FEVR-tail establishes with the rest of the receptor, ultimately reducing the aggregation process. The new Wnt pathway inhibitor FzM1 exerts its inhibitory effect by blocking β-catenin nuclear translocation29. This effect is achieved by blocking β-catenin C-terminal phosphorylation, a prerequisite for the nuclear transport of the protein45. The interplay of Dsh with many kinases (Akt, Rac1 and Jnk2)47 has been described even if the picture behind their interaction is far from complete. FzM1 binding to Fz4 inhibits Dsh recruitment, inducing its degradation and ultimately hampering the recruitment of the kinases of the Wnt–β-catenin cascade. The Wnt inhibition exerted by FzM1 affects the growth, migration and differentiation of U87MG glioblastoma cells, which well represent this frequent and highly malignant type of brain tumor29, and that of CaCo2 cells, suggesting the future applicability of these Fz4 allosteric modulators as antitumor drugs48. Although Dsh has been already addressed with peptides mimicking the sequences of the Frizzled proteins49, FzM1 is to our knowledge the first example of a compound able to hit the same protein-protein complex by contacting, in contrast, the Dsh binding site on Fz4. Owing to its properties, FzM1 represents what is to our knowledge the first template on which Fz4 modulators with improved potency and efficacy can be designed and suggests new avenues for developing Wnt-β-catenin pathway modulators. Received 18 July 2014; accepted 10 February 2015; published online 9 March 2015

nature chemical biology | Advance online publication | www.nature.com/naturechemicalbiology

Nature chemical biology doi: 10.1038/nchembio.1770 Methods

Methods and any associated references are available in the online version of the paper.

© 2015 Nature America, Inc. All rights reserved.

References

1. Dobson, C.M. Protein folding and misfolding. Nature 426, 884–890 (2003). 2. Hartl, F.U. Chaperone-assisted protein folding: the path to discovery from a personal perspective. Nat. Med. 17, 1206–1210 (2011). 3. Hartl, F.U., Bracher, A. & Hayer-Hartl, M. Molecular chaperones in protein folding and proteostasis. Nature 475, 324–332 (2011). 4. Sitia, R. & Braakman, I. Quality control in the endoplasmic reticulum protein factory. Nature 426, 891–894 (2003). 5. Morello, J.P. et al. Pharmacological chaperones rescue cell-surface expression and function of misfolded V2 vasopressin receptor mutants. J. Clin. Invest. 105, 887–895 (2000). 6. Tapper, A.R. et al. Nicotine activation of alpha4 receptors: sufficient for reward, tolerance, and sensitization. Science 306, 1029–1032 (2004). 7. Sallette, J. et al. Nicotine upregulates its own receptors through enhanced intracellular maturation. Neuron 46, 595–607 (2005). 8. Xiao, C. et al. Chronic nicotine selectively enhances α4β2 nicotinic acetylcholine receptors in the nigrostriatal dopamine pathway. J. Neurosci. 29, 12428–12439 (2009). 9. Eshaq, R.S. et al. GABA acts as a ligand chaperone in the early secretory pathway to promote cell surface expression of GABAA receptors. Brain Res. 1346, 1–13 (2010). 10. Halaban, R., Cheng, E., Svedine, S., Aron, R. & Hebert, D.N. Proper folding and endoplasmic reticulum to Golgi transport of tyrosinase are induced by its substrates, DOPA and tyrosine. J. Biol. Chem. 276, 11933–11938 (2001). 11. Schubert, U. et al. Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature 404, 770–774 (2000). 12. Morello, J.P. & Bichet, D.G. Nephrogenic diabetes insipidus. Annu. Rev. Physiol. 63, 607–630 (2001). 13. Ulloa-Aguirre, A. & Michael Conn, P. Pharmacoperones: a new therapeutic approach for diseases caused by misfolded G protein–coupled receptors. Recent Pat. Endocr. Metab. Immune Drug Discov. 5, 13–24 (2011). 14. Maya-Núñez, G., Ulloa-Aguirre, A., Janovick, J.A. & Conn, P.M. Pharmacological chaperones correct misfolded GPCRs and rescue function: protein trafficking as a therapeutic target. Subcell. Biochem. 63, 263–289 (2012). 15. Petäjä-Repo, U.E. et al. Ligands act as pharmacological chaperones and increase the efficiency of Δ opioid receptor maturation. EMBO J. 21, 1628–1637 (2002). 16. Newton, C.L. et al. Rescue of expression and signaling of human luteinizing hormone G protein–coupled receptor mutants with an allosterically binding small-molecule agonist. Proc. Natl. Acad. Sci. USA 108, 7172–7176 (2011). 17. Kobayashi, H., Ogawa, K., Yao, R., Lichtarge, O. & Bouvier, M. Functional rescue of beta-adrenoceptor dimerization and trafficking by pharmacological chaperones. Traffic 10, 1019–1033 (2009). 18. Bernier, V. et al. Pharmacologic chaperones as a potential treatment for X-linked nephrogenic diabetes insipidus. J. Am. Soc. Nephrol. 17, 232–243 (2006); erratum 17, 591 (2006). 19. Schulte, G. International union of basic and clinical pharmacology. LXXX. The class Frizzled receptors. Pharmacol. Rev. 62, 632–667 (2010). 20. Wang, H.Y., Liu, T. & Malbon, C.C. Structure-function analysis of Frizzleds. Cell. Signal. 18, 934–941 (2006). 21. Wang, Y. et al. Norrin/Frizzled4 signaling in retinal vascular development and blood brain barrier plasticity. Cell 151, 1332–1344 (2012). 22. Wong, H.C. et al. Structural basis of the recognition of the dishevelled DEP domain in the Wnt signaling pathway. Nat. Struct. Biol. 7, 1178–1184 (2000). 23. Strutt, D., Madder, D., Chaudhary, V. & Artymiuk, P.J. Structure-function dissection of the frizzled receptor in Drosophila melanogaster suggests different mechanisms of action in planar polarity and canonical Wnt signaling. Genetics 192, 1295–1313 (2012). 24. Kaykas, A. et al. Mutant Frizzled 4 associated with vitreoretinopathy traps wild-type Frizzled in the endoplasmic reticulum by oligomerization. Nat. Cell Biol. 6, 52–58 (2004). 25. Robitaille, J. et al. Mutant frizzled-4 disrupts retinal angiogenesis in familial exudative vitreoretinopathy. Nat. Genet. 32, 326–330 (2002). 26. D’Agostino, M. et al. The cytosolic chaperone α-crystallin B rescues folding and compartmentalization of misfolded multispan transmembrane proteins. J. Cell Sci. 126, 4160–4172 (2013). 27. Lemma, V. et al. A disorder-to-order structural transition in the COOH-tail of Fz4 determines misfolding of the L501fsX533-Fz4 mutant. Sci. Rep. 3, 2659 (2013). 28. Malaterre, J., Ramsay, R.G. & Mantamadiotis, T. Wnt-Frizzled signaling and the many paths to neural development and adult brain homeostasis. Front. Biosci. 12, 492–506 (2007).

article

29. Jin, X. et al. Frizzled 4 regulates stemness and invasiveness of migrating glioma cells established by serial intracranial transplantation. Cancer Res. 71, 3066–3075 (2011). 30. Polakis, P. Drugging Wnt signaling in cancer. EMBO J. 31, 2737–2746 (2012). 31. Voronkov, A. & Krauss, S. Wnt/β-catenin signaling and small molecule inhibitors. Curr. Pharm. Des. 19, 634–664 (2013). 32. Schulte, G. & Bryja, V. The Frizzled family of unconventional G-protein–coupled receptors. Trends Pharmacol. Sci. 28, 518–525 (2007). 33. Zimmerman, Z.F., Moon, R.T. & Chien, A.J. Targeting Wnt pathways in disease. Cold Spring Harb. Perspect. Biol. 4, a008086 (2012). 34. Dann, C.E. et al. Insights into Wnt binding and signaling from the structures of two Frizzled cysteine-rich domains. Nature 412, 86–90 (2001). 35. MacDonald, B.T. & He, X. Frizzled and LRP5/6 receptors for Wnt/β-catenin signaling. Cold Spring Harb. Perspect. Biol. 4, a007880 (2012). 36. Varga, K. et al. Enhanced cell surface stability of rescued ΔF508 cystic fibrosis transmembrane conductance regulator by pharmacological chaperones. Biochem. J. 410, 555–564 (2008). 37. Ke, J. et al. Structure and function of Norrin in assembly and activation of a Frizzled 4–Lrp5/6 complex. Genes Dev. 27, 2305–2319 (2013). 38. Tauriello, D.V. et al. Wnt/β-catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc. Natl. Acad. Sci. USA 109, E812–E820 (2012). 39. D’Agostino, M. et al. ER reorganization is remarkably induced in COS-7 cells accumulating transmembrane protein receptors not competent for export from the endoplasmic reticulum. J. Membr. Biol. 247, 1149–1159 (2014). 40. Ekkebus, R. et al. On terminal alkynes that can react with active-site cysteine nucleophiles in proteases. J. Am. Chem. Soc. 135, 2867–2870 (2013). 41. Wang, C. et al. Structure of the human smoothened receptor bound to an antitumour agent. Nature 497, 338–343 (2013). 42. Ueno, K. et al. Frizzled-7 as a potential therapeutic target in colorectal cancer. Neoplasia 10, 697–705 (2008). 43. Chatel, G. et al. Hedgehog signaling pathway is inactive in colorectal cancer cell lines. Int. J. Cancer 121, 2622–2627 (2007). 44. Jung, H. et al. Deubiquitination of Dishevelled by Usp14 is required for Wnt signaling. Oncogenesis 2, E64 1–11 (2013). 45. Maher, M.T., Mo, R., Flozak, A.S., Peled, O.N. & Gottardi, C.J. β-Catenin phosphorylated at serine 45 is spatially uncoupled from β-catenin phosphorylated in the GSK3 domain: implications for signaling. PLoS ONE 5, e10184 (2010). 46. Jones, K.H., Liu, J. & Adler, P.N. Molecular analysis of EMS-induced frizzled mutations in Drosophila melanogaster. Genetics 142, 205–215 (1996). 47. Wu, X. et al. Rac1 activation controls nuclear localization of β-catenin during canonical Wnt signaling. Cell 133, 340–353 (2008). 48. Gurney, A. et al. Wnt pathway inhibition via the targeting of Frizzled receptors results in decreased growth and tumorigenicity of human tumors. Proc. Natl. Acad. Sci. USA 109, 11717–11722 (2012). 49. Grandy, D. et al. Discovery and characterization of a small molecule inhibitor of the PDZ domain of dishevelled. J. Biol. Chem. 284, 16256–16263 (2009).

Acknowledgments

We thank R. Polishchuk (Telethon Institute of Genetics and Medicine) and B.A. Stanton (Dartmouth Center for the Environmental Health Sciences) for sharing ATP-7B and CFTR expression constructs. We thank J. Hausmann for the fruitful discussions. We thank R. Carmelo for the technical help and A. Ciogli and A. Sansone for MS spectral analyses. This work was financed by Progetti di Rilevante Interesse Nazionale (PRIN) 2012–2015 (grant no. 2012C5YJSK_003) to L.M., PRIN2010-2011 (grant no. 2010W7YRLZ_001) to R.S., Bando Futuro in Ricerca 2010 (grant no. RBFR10ZJQT) to G.L.R. and Fondazione Telethon (grant no. GGP14002) to S.B.

Author contributions

S.F.G. and M.S. performed all of the experiments with the assistance of S.B. and M.M. for HDX, and S.D.M. for LC/MS. M.D. performed the experiments on CaCO-2 cells. D.S. performed confocal imaging. M.G., G.L.R., S.P., H.C., A.B. and L.M. collected and synthesized the compounds of the library and performed chemical characterization. M.S. planned the work and analyzed the results. M.S. wrote the manuscript with assistance from E.N., S.B. and R.S.

Competing financial interests

The authors declare no competing financial interests.

Additional information

Supplementary information and chemical compound information is available in the online version of the paper. Reprints and permissions information is available online at http://www.nature.com/reprints/index.html. Correspondence and requests for materials should be addressed to M.S.

nature CHEMICAL BIOLOGY | Advance online publication | www.nature.com/naturechemicalbiology

7

ONLINE METHODS

Reagents. Salt and organic solvents were from Applichem (Germany). Components of the library (purity > 90% by LC/MS) were from Fluka (USA), Sigma-Aldrich (USA), Applichem (Germany), Acros Organics (Thermo Fisher Scientific, UK), Alfa Aesar (UK) and Carlo Erba (Italy). 17-(Allylamino)-17demethoxygeldanamycin (17AAG, Sigma-Aldrich), Radicicol (Sigma-Aldrich, USA), geldanamycin (Sigma-Aldrich, USA), acridine orange hydrochloride hydrate (Sigma-Aldrich, USA), methylene blue (Carlo Erba), glycerol (Fluka) and chloroquine phosphate (Sigma-Aldrich, USA) were handled according to manufacturer instructions. Mother stocks were prepared in DMSO and stored at −80 °C. Hygromicin and polyethylenimine (PEI) were from Sigma-Aldrich (USA).

© 2015 Nature America, Inc. All rights reserved.

Cell cultures. HEK293, HeLa, CaCo-2 and U87MG were grown in DMEM 10% FBS, Glutamax and Pen/Strep. Transfections were performed with PEI27. Polyclonal HA-Fz4 and HA-Fz4-FEVR cell clones were obtained by transfecting HEK293 cells with the corresponding cDNAs cloned in pcDNA 5.0 (kind gift of B.T. MacDonald (Harvard Medical School)) and selected for hygromycin resistance. After selection stable clones were grown in complete medium supplemented with 50 μg/ml of Hygromycin. Mutagenesis. The mutant L501fsX533(Fz4-FEVR) and all of the mutants of Fz4-FEVR with double-amino-acid substitutions to alanine were obtained by site-directed mutagenesis using pCDNA5-HA-Fz4 as a template and the following forward (Fw) and reverse (Rev) primers: HA-Fz4-FEVR: (Fw, TGGTCTGCCAAAACTTCACACGTGGCAGAAG; Rev, AGTTTTGGCAGACCAAATCCACATG) HA-Fz4-FEVR-IL1-RF-AA: (Fw, CTGATCGATTCTTCTGCGGCTTCC TACCCTGAGCGC; Rev, AGAAGAATCGATCAGGAAGGTC) HA-Fz4-FEVR-IL1-SY-AA: (Fw, GATTCTTCTAGGTTTGCCGCCCC TGAGCGCCCCATC; Rev, AAACCTAGAAGAATCGATCAGG) HA-Fz4-FEVR-IL2-WF-AA: (FwATTCTGACACTCACTGCGGCTTT GGCAGCAGGACTC; Rev, AGTGAGTGTCAGAATAACCC) HA-Fz4-FEVR-IL2-KW-AA: (Fw, TTGGCAGCAGGACTCGCAGCGGG TCATGAAGCCATT;Rev GAGTCCTGCTGCCAAAAACC) HA-Fz4-FEVR-IL2-HE-AA: (Fw, GGACTCAAATGGGGTGCTGCAGCC ATTGAAATGCACAG; Rev, ACCCCATTTGAGTCCTGCTGCC) HA-Fz4-FEVR-IL2-IE-AA: (Fw, TGGGGTCATGAAGCCGCTGCAAT GCACAGCTCTTAT; Rev, GGCTTCATGACCCCATTTGAG) HA-Fz4-FEVR-IL3-RS-AA: (Fw, GCCTTGTTCAAAATTGCGGCAAATC TTCAAAAGGAT;RevAATTTTGAACAAGGCCACCAAACC) HA-Fz4-FEVR-IL3-LQ-AA: (FwAAAATTCGGTCAAATGCTGCAAA GGATGGGACAAAG; Rev, ATTTGACCGAATTTTGAAC) HA-Fz4-FEVR-IL3-KD-AA: (Fw, CGGTCAAATCTTCAAGCGGCTGGG ACAAAGACAGAC; Rev, TTGAAGATTTGACCGAATTTTG) HA-Fz4-FEVR-IL3-TK-AA: (Fw, CTTCAAAAGGATGGGGCAGCGACA GACAAGTTAGAA; Rev, CCCATCCTTTTGAAGATTTG) HA-Fz4-FEVR-IL3-TD-AA: (Fw, AAGGATGGGACAAAGGCAGCCAA GTTAGAAAGACTG; Rev, CTTTGTCCCATCCTTTTGAAG) HA-Fz4-FEVR-IL3-KL-AA: (Fw, GGGACAAAGACAGACGCGGCAGAAA GACTGATGGTC; Rev, GTCTGTCTTTGTCCCATCC) HA-Fz4-FEVR-IL3-ER-AA: (Fw, AAGACAGACAAGTTAGCAGCACTG ATGGTCAAGATT;Rev-TAACTTGTCTGTCTTTGTCCC) Antibodies. Mouse monoclonal anti-HA (HA-7, Sigma-Aldrich) was used at 1:2,000 dilution for western blotting (WB) and immunofluorescence (IF) and at 1:200 dilution for immunoprecipitation (IP). Other antibodies used: rabbit polyclonal anti-HA (H6908, Sigma-Aldrich; dilution of 1:200 for IF); mouse monoclonal anti-β-catenin (15B8, Abcam, UK; dilutions of 1:200, 1:2,000 and 1:200 for IF, WB and IP, respectively); mouse monoclonal anti-Dsh (10B5, Santa Cruz; dilution of 1:100 in TBS for WB); mouse monoclonal anti-­Nestin (10C2, Santa Cruz; dilution of 1:100 for IF); mouse monoclonal anti–E­cadherin (67A4, Santa Cruz; 1:2,000 dilution for IF), mouse monoclonal anti-α tubulin (10D8, Santa Cruz; 1:1,000 dilution for WB). Peroxidase-conjugated anti-mouse (A3682, Sigma-Aldrich, WB 1:5,000) and anti- rabbit IgG (A0545, Sigma-Aldrich WB 1:5,000); Texas Red–conjugated anti-mouse (115-025-003, Jackson ImmunoResearch Laboratories; 1:500 dilution for IF) and anti-rabbit IgG (111-025-003, Jackson ImmunoResearch Laboratories; 1:500 dilution for IF); FITC-conjugated goat anti-mouse (115-095-003, Jackson ImmunoResearch nature chemical biology

Laboratories; 1:500 dilution for IF) and anti-rabbit IgG (111-095-003, Jackson ImmunoResearch Laboratories; 1:500 dilution for IF). TCF/LEF, Gli and CRE assays. Cignal TCF/LEF, Gli and CRE reporter assays (all from Qiagen), were performed according to the manufacturer’s instructions. Cells were plated in black 96-well Optiplates (PerkinElmer) and treated with different dilutions of compounds for 48 h before being processed. Fruit fly and Renilla luminescence were measured in an Envision Plate Reader (PerkinElmer), using the Promega Dual-Glo kit (according to the manufacturer’s instructions). Western blotting. Samples were diluted in 20 mM Tris HCl (pH 6.8), 50 mM DTT, 1% SDS, 5% glycerol and bromophenol blue and then boiled for 10 min at 95 °C. Samples were loaded on a SDS-PAGE gel. The run was performed at 100 V at 25 °C. After the run, proteins were transferred onto a nitrocellulose filter (Schleicher-Schuel) at 80 V for 1 h at 4 °C. Filters were blocked in PBS supplemented with 3% nonfat dry milk (Bio-Rad) for 2 h at 25 °C and ­incubated with primary and secondary antibody diluted in PBS supplemented with 0.3% nonfat dry milk in PBS. The ECL reaction was performed using the Lumi Light ECL Kit (Roche) according to the manufacturer’s procedures. Sedimentation in glycerol gradients. Fz4-FEVR solubility assay was performed as already described26. Aliquots of cell extract obtained from transfected cells were loaded on top of a 20–40% glycerol gradient in lysis buffer (Tris-HCl 20 mM, NaCl 150 mM, Triton X-100, 0.5%) and centrifuged at 4 °C in the Beckman SW-50.1 rotor for 16 h at 45,000 r.p.m. in a Beckman Coulter Optima L90K ultracentrifuge. Pellets were recovered in the same lysis buffer as that used for glycerol gradient preparation. Aliquots of pellets and supernatants were analyzed by SDS-PAGE and immunoblotting. Immunofluorescence. Immunofluorescence was performed as already described50. Cells growing on glass coverslips were fixed in 3.7% formaldehyde/PBS pH 7.4 for 30 min. Formaldehyde was quenched by incub­ ating the coverslips for 30 min in 0.1 M glycine/PBS. Cells were permeabilized in 0.1% Triton/ PBS, pH 7.4, for 10 min at 25 °C and then incub­ated with primary and secondary antibodies diluted in PBS for 1 h and 30 min, respectively. Confocal microscopy and colocalization evaluation. Cells were analyzed with a Leica TCS-SMD-SP5 confocal microscope (for detection of Alexa 488, an argon laser at 488 nm was used for excitation, and for fluorescence detection it was used at 505–560 nm; for detection of Texas Red, a DPSS laser at 561 nm was used for excitation, and for fluorescence detection it was used at 580–620 nm). 1-μm-thick optical slices were acquired with a 63× or 40×/1.4 NA objective. For colocalization evaluation, spatially colocalizing pixels of each optical section were measured using Manders’s colocalization coefficient with the LAS AF software. Three-dimensional reconstruction of Z sections was performed by using LAS AF software on a Leica TCS SP8 confocal microscope. ImageJ Software (National Institutes of Health, Bethesda, MD) was used for analysis. Statistical analysis. EC50 was calculated by fitting direct total binding data by nonlinear regression analysis of dose-response curve using Prism software (GraphPad, GraphPad Software, San Diego California USA; http:// www.graphpad.com/). All data were analyzed using the two-tailed Student’s t-test. P < 0.05 were considered statistically significant. Immunoisolation from cultured cells and trypsin digestion. Cells were lysed in B buffer (Hepes K-OH 50mM, 150 mM NaCl, 1% Triton X-100, supplemented with protease inhibitors). Lysates were centrifuged at 14,000 r.p.m. to remove cell debris and unbroken cells. Clarified lysates were incubated overnight with antibody at 4 °C, followed by treatment with Protein A–coupled Sepharose (45 min, 4 °C). Samples were extensively washed in B buffer and then resuspended in 40 μl of buffer containing trypsin and incubated overnight at RT. 20 μl of the tryptic digestion were processed for LC/MS. HDX. Immunoisolated Fz4 (still bound to the Sepharose beads) was incubated in B buffer at 4 °C in the presence of or without ligand (10 μM concentration). After 30 min, beads were resuspended in 40 μl of D20 for 1 min in the presence of or without ligand. Formic acid was then added (5% final concentration), doi:10.1038/nchembio.1770

and the samples were boiled four times at 95 °C for 15 min. DTT (50 mM) was added to reduce disulfide bonds. 20 μl of the tryptic digestion were processed for LC/MS. HPLC/MS. All samples were analyzed by analytical HPLC/MS (Agilent 1200 series HPLC system, Agilent 1260 UV-vis detector Infinity and Agilent Quadrupole 6110 LC/MS) equipped with a C18-bounded analytical reversephase HPLC column (Vydac 218TP104, 4.6 × 250 mm) using a gradient elution (10–90% acetonitrile in water (0.1% TFA) over 20 min; flow rate = 1.0 ml/min. For HDX experiments, the gradient buffer was kept at a pH lower than 2.5 (to reduce back exchange) by adding formic acid.

© 2015 Nature America, Inc. All rights reserved.

LC/MS spectra analysis. LC/MS spectra were analyzed with MetAlign51 with the following settings: mass resolution/BIN (nominal mass mode, 0.65), peak slope factor (5× noise), peak threshold factor (5× noise), peak threshold abs. value (150), average peak width (three scans), autoscaling on total signal, tuning alignment (prealign processing iterative, mass peak selection set on min. factor (5× noise). Amplitudes of masses coming from treated and untreated samples were subtracted to identify mass exclusively present in each of the samples. Masses were assigned with Mascot (MatrixScience)52. Samples containing only trypsin or protein Sepharose or antibody were run as controls. Fz4 receptor model. Fz4-WT three-dimensional model was built using the CCP4 (ref. 53). Crystal structure of the cysteine-rich domain of Fz8 (Protein Data Bank (PDB) code 4F0A)54 and the TMD of smoothened receptor (PDB codes 4N4W41 and 4JKV55) were used as templates for the ECD and the TMD of Fz4, respectively. Cartoons were generated as already described56. General chemical experimental information. All reagents and solvents are commercially available and were used as purchased, without further purification. They were handled according to the material safety data sheet of the supplier. Melting points were determined on a Stuart Scientific SMP1 apparatus and on a Stuart Scientific SMP30 apparatus and are uncorrected. Infrared spectra (IR) were run on a PerkinElmer SpectrumOne FT-ATR spectrophotometer. Band position and absorption ranges are given in cm−1. MS and high-resolution MS (HRMS) analyses were recorded on AB Sciex API-2000 and Thermo Fisher Scientific Inc. Trace 1300 (MS) and Thermo Fisher Scientific Inc. Orbitrap Exactive (HRMS) spectrometers. Proton (1H, 400.13 MHz) and carbon (13C, 100.6 MHz) NMR spectra were recorded on Bruker Avance 400 and Varian Inova 400 spectrometers in the indicated solvent (Supplementary Note), and the corresponding fid files were processed using MestreLab Research S.L.

doi:10.1038/nchembio.1770

MestreReNova 6.2.1-769 and Bruker Topspin 3.2 software. Chemical shifts are expressed in δ units (p.p.m.) from tetramethylsilane. Column chromatography was performed on silica gel from Macherey-Nagel, Merck and SigmaAldrich (70−230 mesh). Silica gel thin-layer chromatography (TLC) cards from Macherey-Nagel, Merck and Sigma-Aldrich (silica gel precoated aluminum cards with fluorescent indicator that can be visualized at 254 nm) were used for TLC. Developed plates were visualized with a Spectroline ENF 260C/FE UV apparatus. Organic solutions were dried over anhydrous Na2SO4. Evaporation of the solvents was carried out on a Büchi Rotavapor R-210 equipped with a Büchi V-850 vacuum controller and a Büchi V-700 or V-710 vacuum pump. Elemental analyses of the tested compounds were found within ± 0.4% of the theoretical values. The purity of tested compounds was found to be >95% by HPLC analysis. The HPLC system used (Thermo Fisher Scientific Inc. Dionex UltiMate 3000) consisted of a SR-3000 solvent rack, an LPG-3400SD quaternary analytical pump, a TCC-3000SD column compartment, a DAD-3000 diode array detector and an analytical manual injection valve with a 20-μl loop. Samples were dissolved in acetonitrile at 10 mg/ml. HPLC analysis was performed by using a Thermo Fisher Scientific Inc. Acclaim 120 C18 reversedphase column (5 μm, 4.6 mm × 250 mm,) at 30 ± 1 °C with an isocratic gradient (90:10 acetonitrile/water), a flow rate of 1.0 ml/min and signal detection at 254 nm and 365 nm. Chromatographic data were acquired and processed by Thermo Fisher Scientific Inc. Chromeleon 6.80 software.

50. Radner, S. et al. Transient transfection coupled to baculovirus infection for rapid protein expression screening in insect cells. J. Struct. Biol. 179, 46–55 (2012). 51. Lommen, A. MetAlign: interface-driven, versatile metabolomics tool for hyphenated full-scan mass spectrometry data preprocessing. Anal. Chem. 81, 3079–3086 (2009). 52. Perkins, D.N. et al. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20, 3551–3567 (1999). 53. Winn, M.D. et al. Overview of the CCP4 suite and current developments. Acta Crystallogr. D Biol. Crystallogr. 67, 235–242 (2011). 54. Janda, C.Y., Waghray, D., Levin, A.M., Thomas, C. & Garcia, K.C. Structural basis of Wnt recognition by Frizzled. Science 337, 59–64 (2012). 55. Wang, C. et al. Structural basis for Smoothened receptor modulation and chemoresistance to anticancer drugs. Nat. Commun. 5, 4355–4365 (2014). 56. Stornaiuolo, M. et al. Assembly of a π-π stack of ligands in the binding site of an acetylcholine-binding protein. Nat. Commun. 4, 1875 (2013).

nature CHEMICAL BIOLOGY