Human Cell DOI 10.1007/s13577-015-0118-2
RESEARCH ARTICLE
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage interactions N. Zulaziz1 • A. Azhim1 • N. Himeno2 • M. Tanaka3 • Y. Satoh4 • M. Kinoshita5 H. Miyazaki6 • D. Saitoh6 • N. Shinomiya7 • Y. Morimoto7
•
Received: 28 January 2015 / Accepted: 12 May 2015 Japan Human Cell Society and Springer Japan 2015
Abstract Antibacterial photodynamic therapy (PDT) has come to attract attention as an alternative therapy for drugresistant bacteria. Recent reports revealed that antibacterial PDT induces innate immune response and stimulates abundant cytokine secretion as a part of inflammatory responses. However, the underlying mechanism how antibacterial PDT interacts with immune cells responsible for cytokine secretion has not been well outlined. In this study, we aimed to clarify the difference in gene expression and cytokine secretion between combined culture of fibroblasts and macrophages and their independent cultures. SCRC1008, mouse fibroblast cell line and J774, mouse macrophage-like cell line were co-cultured and PDT treatments with different parameters were carried out. After various incubation periods (1–24 h), cells and culture medium were collected, and mRNA and protein levels for cytokines were measured using real-time PCR and ELISA, respectively. Our results showed that fibroblasts and macrophages & Y. Morimoto [email protected] 1
Department of Electronic Systems Engineering, MalaysiaJapan International Institute of Technology, UTM, Kuala Lumpur, Malaysia
2
iCAT Corporations, Osaka, Japan
3
JGSDF Kumamoto Hospital, Kumamoto, Japan
4
Department of Anesthesiology, National Defense Medical College, Tokorozawa, Japan
5
Department of Immunology and Microbiology, National Defense Medical College, Tokorozawa, Japan
6
Division of Traumatology, National Defense Medical College Research Institute, Tokorozawa, Japan
7
Department of Integrated Physiology Bio-Nano Medicine, National Defense Medical College, Tokorozawa, Japan
interact with each other to mediate the immune response. We propose that fibroblasts initially respond to PDT by expressing Hspa1b, which regulates the NF-jB pathway via Tlr2 and Tlr4. Activation of the NF-jB pathway then results in an enhanced secretion of pro-inflammatory cytokines (TNF-a, IL-6 and IL-1b) and neutrophil chemoattractant MIP-2 and KC from macrophages. Keywords Immune response Macrophage Fibroblast PDT Neutrophil migration
Introduction Importance of neutrophil infiltration in antibacterial PDT Photodynamic therapy (PDT) is one of the alternatives to treat bacterial infections with the rise of threat of drug resistance. Antibacterial PDT was found to stimulate the innate immune response by recruiting neutrophils [1]. This finding makes PDT a more promising option for the treatment of bacterial infection. Although favorable results from in vitro PDT experiments using cultured bacteria have been described in many reports, only a few were applied to in vivo animal infection models. We recently demonstrated that in vivo PDT using methylene blue as a photosensitizer reduced the number of viable bacteria in the knee joint space of arthritis model mice. Interestingly, bacterial clearance in this case was not brought by direct bacterial killing effect of PDT but rather induced by neutrophil accumulation into the infectious joint space followed by phagocytosis [1]. In addition, if neutrophil infiltration was disrupted, complete eradication of bacteria was no longer achieved and surviving bacteria started re-growing [2].
123
N. Zulaziz et al.
These observations imply that neutrophil infiltration is an essential event for antibacterial PDT to combat bacterial infections effectively. Neutrophil infiltration is a phenomenon that is known to be triggered by activated macrophages and those macrophage functions are also influenced by their interactions with surrounding cells. Therefore, we hypothesize that in in vivo tissue PDT stimulates fibroblasts which are positioned as the surrounding cells for macrophages to activate their functions. To prove this, we made an in vitro model by co-culturing fibroblasts and macrophages, and evaluated the changes in cytokine secretion and related gene expressions following PDT treatment. Cytokines and chemokines involved in neutrophil migration PDT-treated cells have been reported to release a group of proteins, i.e., heat shock proteins (HSPs) that are induced by the elevation of temperatures or other environmental stresses. Among them, HSP70 is known to play a key role in innate immune responses as endogenous ligand for toll-like receptors (TLRs), especially TLR2 and TLR4 [3]. Hence, the expression level of TLR2 and TLR4 is a good marker to confirm whether HSP70-related trigger system is activated or not. Once the TLRs bind with their ligand, they recruit adapter molecules and propagate signals to activate the nuclear factor kappa B (NF-jB) transcription signaling pathway. The NF-jB pathway plays a key role in inflammation through the transcription of pro-inflammatory cytokines. Two distinct regulatory pathways, namely canonical and non-canonical pathways are known for this NF-jB activation that is controlled by the inhibitor kappa B kinase (IKK) complex. Taking those aforementioned steps into account, the mechanism of PDT is considered to rely on the activation of inflammatory sequences. The early phase of inflammation in vivo is characterized by the infiltration of neutrophils into tissues in which several cytokines serve as neutrophil chemoattractants. Interleukin-8 (IL-8) has been proposed as a major chemotactic factor for recruiting neutrophils to extravascular sites of inflammation [4]. Thus, we measured IL8. Also, tumor necrosis factor alpha (TNF-a) is a mediator of inflammation that is mainly secreted by activated macrophages. TNF-a serves as the first cytokine in the cascade of pro-inflammatory cytokines and subsequent reactions induce IL-8 production [5]. A number of studies revealed that other cytokines such as IL-1b and IL-6 also have profound effects in regulating the immune response [6, 7]. Thus, in this study, the expression of genes/proteins that are closely related to orchestrating inflammations such as HSPs, TLRs, NF-jB and neutrophil-recruiting chemokines was chosen to evaluate the effects of PDT.
123
Methodology Cell culture and PDT treatment To investigate the cross talk between two types of cells, a combined cell culture (co-culture) system was used, in which one type of cells was seeded on the well bottom of a 6-well culture plate (BD #353502, BD Biosciences), while the other type of cells was seeded on a culture insert with a membrane (a pore size of 0.4 lm) (BD #353090) as shown in Fig. 1. A murine macrophage-like cell line, J774 (JCRB, Tokyo, Japan) and a murine fibroblast SCRC-1008 (ATCC, Tokyo, Japan) were purchased and used in this study. Each cell line was seeded and maintained independently using a 6-well culture plate. J774 cells were cultured in RPMI1640 medium with 10 % FBS, while SCRC-1008 cells were cultured in DMEM medium with 15 % FBS at a concentration of 3.0 9 105 cells/well, respectively. After the cells reached confluent status (1–2 days after cell seeding), they were collected and then co-cultured as mentioned above (Fig. 1) using RPMI1640 medium with 10 % FBS (coculture group) at a concentration of 3.0 9 105 cells/well for each cell line. The volume of the medium used in coculture wells was enough to cover the cells on the inserts and to ensure that substances released from the cells were able to interact with each other. As for the control, two cell lines were cultured independently in respective culture medium (independent groups). PDT treatment According to our previous in vivo study [2], methylene blue was used as a photosensitizer. Immediately after methylene blue (0.4 lM) was added to the culture, cells were irradiated with a laser diode (655 nm, BWF2-655-2400-0.22-SMA-SP, B&W Tek, Newark, DE). The parameters of PDT used in this study are outlined in Table 1. RNA extraction and cDNA synthesis Cells were collected from the inserts and bottom of the wells. Total RNA was isolated using a QIAGEN miRNeasy Mini kit
Fig. 1 Co-culture diagram
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage… Table 1 Parameters for PDT treatment Group name
Parameters Irradiation intensity (mW/cm2)
Irradiation time (s)
Methylene blue concentration (lM)
Incubation time after irradiation
1h
28
600
0.4
1h
2h
28
600
0.4
2h
4h
28
600
0.4
4h
24 h
28
600
0.4
24 h
Control
NT
NT
NT
NT
NT not treated
according to the manufacturer’s instruction (Qiagen). The quality and quantity of RNA from each sample was determined with a spectrophotometer. Total RNA was transcribed into cDNA using SuperScript III First-Strand Synthesis Supermix for qRT-PCR (Invitrogen) according to the manufacturer’s instruction. The resulting cDNA was used for subsequent realtime PCR and reverse transcription PCR experiments. Real-time PCR Real-time fluorescence detection of amplified nucleotides was carried out using 7900HT Fast Real-Time PCR System (Applied Biosystems). Reactions were carried out in MicroAmp Optical 96-well reaction plates (Applied Biosystems) using TaqMan Gene Expression Master Mix (Applied Biosystems,). All primers used in this study were products from TaqMan Gene Expression Assays as follows: Cxcl2 (Mm00436450m1; alternative symbol of MIP-a, encoding MIP-2 which is the murine counterpart of IL-8), Cxcl1 (Mm00433859_m1; previously called GROa, KC, NAP-3), Ikbkb (Mm01222247m1; encoding IKK-b), Nfkb1 (Mm0047 6361m1; encoding NFKB1), Tlr2 (Mm00442346m1; encoding TLR2), Tlr4 (Mm00445273m1; encoding TLR4), Hspa1b (Mm03038954s1; encoding HSP70). Gapdh (Mm99999915_ g1; encoding GAPDPH) and 18S (Hs 99999901s1; encoding eukaryotic 18S rRNA) were used as endogenous controls. The assays were performed in triplicates.
GCTTCC). Cycling conditions were 3 min at 94 C, 35 cycles of 30 s at 94 C, 30 s at 60 C and 30 s at 72 C, followed by a 10-min extension step at 72 C. The PCR products were analyzed by an agarose gel electrophoresis. ELISA After co-culture of the cells, culture medium was collected from the culture plates and used for protein assays. Anti-mouse TNFa (555268, BD OptEIATM), IL-6 (555240, BD OptEIATM), IL1b (559603, BD OptEIATM), and IL-8 (554726, BD PharmingenTM) protein levels in control and treated group were determined by ELISA according to the manufacturer’s instructions. The assays were performed in duplicates. Statistical analysis In all the experiments, values were expressed as mean ± standard deviations (SD). Statistical difference between the groups was analyzed using a Student’s t test or one-way analysis of variance (ANOVA), and P \ 0.05 was taken as statistically significant.
Results Effects of PDT on gene expressions in independently cultured or co-cultured cells PDT increased HSP70 (Hspa1b) expression in fibroblast cells. Both SCRC-1008 cells co-cultured with J774 cells (SCRC-C) and independently cultured SCRC-1008 cells (SCRC-I) displayed similar patterns with gradual increase
Reverse transcription PCR (RT-PCR) After cDNA synthesis as a template, conventional PCR was carried out with a TaKaRa Taq kit (TaKaRa Biotech) using primers as follows: Hspa1b (F; GGAGGAGTICAAGAGGAA GC, R; GCGTGATGGATGTGAGAAGT), Tlr2 (F; GCAGG CGACAACCACTTT, R; CAGCAGACTCCAGACACCA G), Tlr4 (F; GAGCCGTTGGTGTATCTTTGA, R; TGTCCT CCCATTCCAGGTAG), Cxcl2 (F; GCAGTGGCAAAGTGGAGATT, R; GGTCTTCAGGCATTGACAGC), Gapdh (F; GCAGTGGCAAAGTGGAGATT, R; AAGATGGTGATGG
Fig. 2 Real-time PCR analysis of Hspa1b expression in independently cultured SCRC-1008 cells (SCRC-I) and in SCRC-1008 cells co-cultured with J774 cells (SCRC-C). At 1–4 h after PDT treatment, the expression of Hspa1b in SCRC-C was significantly up-regulated. Gene expression levels were indicated as a comparison to untreated controls (control level is set to 1). (*P \ 0.05, **P \ 0.01: compared to SCRC-I)
123
N. Zulaziz et al.
in the gene expression from 1 to 4 h (Fig. 2). However, SCRC-C expressed significantly higher level of Hspa1b than SCRC-I. In contrast, no expression of Hspa1b in J774 cells was not detected (data not shown). Both Tlr2 and Tlr4 were up-regulated in J774 cells cocultured with SCRC-1008 cells (J774-C) (Fig. 3a, b). Importantly, the expression of Hspa1b in SCRC-1008 cells and the expression of Tlr2 in J774-C after PDT progressed synchronously. In addition, Tlr4 in J774-C also upregulated within 1 h after PDT which might be involved in the early phase activation of heat shock response (Hspa1b). These results suggest that the up-regulation of HSP70 protein as a ligand for TLRs is closely connected to the augmented expression of Tlr2 and Tlr4 genes. Then, Ikbkb expression in macrophage-like J774 cells was measured since it is closely associated with the inhibition of NF-jB dimers that play key roles in the downstream of TLR-mediated signaling pathways. Real-time PCR analysis revealed that Ikbkb gene expression after
PDT significantly up-regulated only in J774-C at 2–4 h. No significant changes in Ikbkb expression were observed in independently cultured J774 cells (J774-I) as well as in SCRC-1008 cells (both SCRC-I and SCRC-C) (Fig. 3c), suggesting that co-culture of fibroblast and macrophages stimulates this NF-jB-related pathway via the production of some humoral factors by fibroblasts and activated macrophages. Regarding the expression of NF-jB (Nkfb1) itself, no significant change was observed when fibroblasts were cultured independently (SCRC-I). In other cells (J774-I, J774-C, and SCRC-C), however, the up-regulation of Nfkb1 at 24 h was remarkable. When J774-I and J774-C were compared, J774-I showed marked up-regulation of Nfkb1 from early phase of PDT (at 1–4 h) but Nfkb1 expression of J774-C at 24 h was much higher than that of J774-I (almost twice) (Fig. 3d). Regarding the expression of Cxcl2 (MIP-a), co-cultured macrophages (J774-C) showed much higher levels (five–
Fig. 3 Real-time PCR analysis of Tlr2, Tlr4, Ikbkb and Nfkb1 expressions in J774 cells and SCRC-1008 cells either in independent culture condition (indicated as ‘‘-I’’) or in co-culture condition (indicated as ‘‘-C’’). a Tlr2 expression in J774-C was significantly upregulated at 1–4 h after PDT treatment (*P \ 0.05: compared to J774-I), suggesting a modulating role of fibroblasts on macrophage function. Time course of the expression pattern of Tlr2 was similar to that of Hspa1b. b Tlr4 expression was significantly up-regulated at 1 h after PDT treatment (*P \ 0.05: compared to J774-I).
c Significant up-regulation of Ikbkb was observed only in J774-C at 2 h and 4 h (*P \ 0.05: compared to J774-I). d From 1–4 h, the expression of Nfkb1 in J774-I was significantly higher than that in J774-C. However, the expression of Nfkb1 in J774-C after 24 h incubation was significantly higher than that in J774- I (*P \ 0.05). Nfkb1 expression in SCRC-C was up-regulated only at 24 h. Each bar shows a relative gene expression level when untreated control is set to 1
123
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage…
Fig. 4 Real-time PCR analyses of Cxcl2 (MIP-a) and Cxcl1 (KC) expressions in J774 cells either in an independently cultured condition (J774-I) or in a co-cultured condition (J774-C). Gene expression levels are shown as relative values to untreated control. Throughout
tenfold) than independently cultured macrophages (J774-I) throughout the observation period (Fig. 4a). Cxcl1 (KC) is another important gene that is responsible for neutrophil recruitment and the development of PDT-induced inflammation. The expression pattern of Cxcl1 is similar to that of Cxcl2; co-cultured macrophages (J774-C) showed the highest level of Cxcl1 at 1 h and kept significantly higher levels (two–fivefold) than independently cultured macrophages (J774-I) throughout the observation period (Fig. 4b). However, the expression of both Cxcl1 and Cxcl2 was not up-regulated in SCRC-1008 fibroblasts whether co-cultured or independently cultured (data not shown). These results suggest that both KC and MIP-a are exclusively produced by macrophages and dramatically upregulated by the factors secreted from PDT-stimulated fibroblasts. The expression of Hspa1b, Tlr2, Tlr4 and Cxcl2 was also analyzed by conventional RT-PCR (Fig. 5). The results were consistent with those of real-time PCR. Briefly, SCRC-1008 cells co-cultured with J774 cells (SCRC-C) demonstrated stronger Hspa1b expression than the independently cultured cells (SCRC-I). Also, J774 cells cocultured with SCRC-1008 cells (J774-C) showed stronger expressions of Tlr2, Tlr4 and Cxcl2 than independently cultured cells (J774-I). PDT-mediated secretion of pro-inflammatory cytokines by macrophages co-cultured with fibroblasts Co-cultivation of J774 cells with SCRC-1008 cells followed by PDT stimulated the secretion of pro-inflammatory cytokines, i.e., TNF-a, IL-6 and IL-1b. They were secreted immediately after PDT and showed a peak production at 1 h, then gradually decreased until 4 h (Fig. 6a– c). Interestingly, secreted TNF-a in the culture medium of independently cultured J774 cells (green bars in Fig. 6a)
the observation period, expressions of Cxcl2 (a) and Cxcl1 (b) in J774-C showed significantly higher values than those in J774-I (*P \ 0.05, **P \ 0.01)
SCRC-C
SCRC-I
1h 2h 4h 24h Cont 1h 2h 4h 24h Cont Hspa 1b Gapdh J774-C
J774-I
1h 2h 4h 24h Cont 1h 2h 4h 24h Cont Tlr2 Gapdh Tlr4 Gapdh Cxcl2 Gapdh
Fig. 5 RT-PCR analysis of Hspa1b, Tlr2, Tlr4 and Cxcl2. Expression of Hspa1b in co-cultured SCRC1008 cells (SCRC-C) or independently cultured SCRC1008 cells (SCRC-I). The expression of Gapdh is displayed as an internal control. Tlr4, Tlr2, and Cxcl2 expressions in J774 cells either in a co-cultured condition (J774-C) or an independently cultured condition (J774-I). In all four genes, the expression levels in a co-cultured condition are much higher than in an independently cultured condition
showed much higher levels than that of co-cultured cells (blue bars in Fig. 6a), but other pro-inflammatory cytokines (IL-6 and IL-Ib) were not secreted in the culture medium of independently cultured J774 cells (green bars in Fig. 6b, c). This may suggest that cultivation of macrophages with fibroblasts (blue bars in Fig. 6a) did up-regulate the production of TNF-a from macrophages yet the level of its production was kept in an optimal range as compared to the cultivation of macrophages alone (green bars in Fig. 6a) that overproduced TNF-a. TNF-a in the culture medium of independently cultured SCRC-1008 cells (red bars in
123
N. Zulaziz et al.
Fig. 6 Effects of PDT on cytokine production. ELISA analysis of TNF-a (a), IL-6 (b), IL-1b (c) and MIP-2 (d) secretions using media from independently cultured J774 cells (green bars), SCRC-1008 cells (red bars), and co-cultured cells (blue bars) with n = 2 number of experiments. For each cytokine, secretion activity per hour was measured and secretion level in the untreated control was standardized to ‘1’. (Untreated controls of TNF-a in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC1080 were 8.3, 7.8 and \6.2 9 10-1 pg/mL, respectively. Untreated controls of IL-6 in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC-1080 were
2.4 9 102, 3.7 9 101 and 3.5 pg/mL, respectively. Untreated controls of IL-1b in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC-1080 were 2.8, 2.7 and \2.3 pg/ mL, respectively. Untreated controls of MIP-2 in medium of cocultured cells, independently cultured J774 and independently cultured SCRC-1080 were 3.3 9 101, 4.2 9 101 and \1.3 pg/mL, respectively). a Secretion of TNF-a was higher in medium of independently cultured J774 cells compared to that in medium of cocultured cells at 1–4 h. b–d Secretion of IL-6, IL-1b and MIP-2 in medium of co-cultured cells was higher than in medium of independently cultured J774 cells throughout the observation period
Fig. 6a) was also measured, but the amount was negligible. Therefore, TNF-a was proven to be produced mainly by J774 macrophages. Unlike TNF-a or IL-6, the secretion of IL-1b in co-cultured cells was kept in a high level at 24 h after PDT (blue bars in Fig. 6c). Regarding the neutrophil chemotactic factor MIP-2, a marked increase in its production was observed in co-cultured cells (blue bars in Fig. 6d) but not in independently cultured J774 cells (green bars in Fig. 6d). The secretion level was the highest at 2 h after PDT, and then gradually declined to 24 h (Fig. 6d).
we hypothesized that under certain condition, PDT stimulates tissue fibroblasts to up-regulate macrophage functions, which lead to the initiation and regulation of neutrophil migration. To study this hypothesis, J774 macrophages were co-cultivated with SCRC-1008 fibroblasts and the effects of PDT on their gene expression and cytokine secretion related to pro-inflammatory responses and neutrophil attraction were investigated. Recent report revealed that tumor cells treated with PDT express cell surface HSPs and induce inflammatory and immune responses that contribute to the therapeutic outcome [8]. In this study, Hspa1b gene expression was significantly increased at transcriptional level in SCRC-1008 fibroblasts following PDT when they were co-cultured with J774 macrophages. The basic insult inflicted by PDT is a form of oxidative stress, which is known to be a molecular switch for the temporal expression of genes ligated to the
Discussion We have previously shown that PDT induces neutrophil migration to the infected lesion and enhances bacterial clearance in arthritis model mice [1]. In the present study,
123
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage…
HSPs [9]. The mechanisms of PDT-induced up-regulation of Hspa1b include the activation of lysosome–endosome pathway [10], in which HSPs are translocated into an endolysosomal compartment, transported to the cell surface, and secreted from the cells via the role of transporter proteins. HSPs secreted from the cell surface are thought to take part in paracrine or autocrine interactions with adjacent cell surfaces. It is also possible that PDT-stimulated cells transiently expose HSPs inside the cells by phospholipid flip-flop and membrane packing changes without causing apoptosis [11, 12]. The up-regulation of Hspa1b gene in fibroblasts was considered to cause an increase in surface HSPs proteins and subsequent release of these proteins, which might lead to the stimulation of their applicable receptors of J774 macrophages. Because the chaperokine activity of HSPs has been reported to be mediated in part by utilizing surface receptors for TLR signaling such as TLR2 (receptor for Gram-positive bacteria) and TLR4 (receptor for Gram-negative bacteria) in a CD14-dependent fashion [13], CD14-positive macrophages seem to be the most suitable effector of HSPs-related innate immune responses. In this study, elevated expression of both TLR2 and TRL4 was remarkable in co-cultured J774 cells (J774-C), thereby supporting the idea that chaperokine-mediated activation of TLR pathways occurred in PDT-treated macrophages. Particularly the gene activation pattern of Hspa1b in fibroblasts was well correlated with the up-regulated expression of TLR2 (Tlr2) in J774 macrophages. Therefore, the HSPs-TLR2 activation loop between fibroblasts and macrophages is considered to be the most important part of the PDT-treated stimulation process of innate immune responses and this may explain the efficacy of PDT in MRSA-infected murine arthritis models in our previous report [1]. It is important for HSPs molecules to express chaperokine activity for TLRs on other cells because carboxy-terminal domain is involved in the interaction of HSPs with its chaperoned client peptides (substrates) and endogenous peptides that may serve as a source of antigens that induce subsequent immune responses [8]. Botzler et al. [14] have shown that the carboxy-terminal domain of HSPs is exposed when this molecule is expressed at the cell surface. Therefore, the cell surface expression of HSPs on PDT-treated fibroblasts seems to be essential to initiate the activation of TLRtriggered immune pathways in surrounding macrophages. On one other hand, the expression of Ikbkb that encodes NF-jB pathway inhibitor protein (IjB) increased at 2–4 h after PDT in co-cultured J774 cells (J774-C) and returned to basal level at 24 h. On the other hand, the expression pattern of Nfkb1 was different from that of Ikbkb; it showed relatively low expression in the first 4 h after PDT and then significantly increased at 24 h. Based on these results, the up-regulation of Ikbkb in J774-C might somehow inhibit
the expression of Nfkb1 at the early phase after PDT. Nevertheless, most of the pro-inflammatory cytokines measured in the present study, i.e., TNF-a, IL-6 and IL-1b showed significantly high secretion levels in the first 4 h after PDT. Taking these facts into account, the production of pro-inflammatory cytokines was considered to be regulated exquisitely by modulating the balance between NF-jB and IjB; TNF-a was overproduced in J774-I in which the expression of Ikbkb was low and that of Nfkb1 was high, whereas reasonable amount of TNF-a was produced in J774-C in which the expression of Ikbkb was high and that of Nfkb1 was modest. These results imply that different regulatory mechanisms are involved in activating pro-inflammatory cytokine production pathways after PDT whether fibroblasts and macrophages are co-cultured or not. Although NF-jB has long been considered as a key molecule for pro-inflammatory pathways, recent evidence has shown that it works in both pro- and anti-inflammatory pathways [15]. This also explain the reason why high secretion levels of pro-inflammatory cytokines were maintained in J774-C even though Nfkb1 expression levels were much lower than J774-I at the early phase after PDT treatment. Regarding the production of pro-inflammatory cytokines from macrophages through the activation of TLR pathways, generally their specific ligands are needed to induce effective responses. However, our data revealed that the activation of TLRs via PDT was sufficient to induce the release of pro-inflammatory cytokines including IL-1b. Pro-inflammatory cytokines other than TNF-a were secreted in much higher levels from J774 cells co-cultured with fibroblasts (blue bars in Fig. 6) than independently cultured J774 cells (green bars in Fig. 6). Independent culture of SCRC-1008 fibroblasts did not secrete any of these pro-inflammatory cytokines (data not shown). This means that although fibroblasts did not directly secrete the pro-inflammatory cytokines, they are required to activate macrophage functions to initiate and regulate the innate immune response efficiently. Both real-time PCR and ELISA analyses showed that chemokine (C-X-C motif) ligand 2 (CXCL2/MIP-2) namely murine counterpart of IL-8 was highly expressed during the first 4 h after PDT, then gradually declined afterwards and finally at 24 h, gene expression level was maintained at a high level. MIP-2 is a chemoattractant for neutrophils and secreted from macrophages in response to acute inflammation to recruit and accumulate the neutrophils in the infection focus. Chemokine (C-X-C motif) ligand 1 (CXCL1/KC) is another important chemoattractant for neutrophils. Previous studies demonstrated that CXCL1/ KC and CXCL2/MIP-2 were secreted in a similar time course after induction [16–18]. Our data showed that higher levels of CXCL1/KC and CXCL2/MIP-2 were
123
N. Zulaziz et al.
Fig. 7 A proposed model for PDT-mediated neutrophil migration: PDT stimulates fibroblast–macrophage interactions and activates the HSPs-TLR signaling pathways, which triggers the NF-jB pathway. The NF-jB pathway promotes the production of cytokines and MIP2/KC. Both MIP-2 and KC play a key role in neutrophil migration
secreted from the co-cultured macrophages (J774-C) than from the independently cultured macrophages (J774-I). Our findings proposed two distinct mechanism of neutrophil migration that is induced by sublethal dose of antibacterial PDT. One is an early phase reaction at about 1 to 4 h after PDT irradiation that may be regulated by TNF-a, MIP-2/KC, or IL-6; the other is a delayed phase reaction that peaks at 24 h after PDT irradiation, and MIP-2/KC and IL-1b are the factors regulating the reaction of this type of neutrophil migration. These two waves of neutrophil activation may be effective for bacterial clearance by recruiting activated neutrophils to the infection focus at the early phase of PDT and by maintaining the bactericidal activity of these recruited neutrophils in the following phase. In summary, co-culture of J774 macrophages with SCRC-1008 fibroblasts showed higher immune responses after stimulation with PDT than isolated cultures. Our results revealed that sublethal dose of PDT is capable of stimulating fibroblasts to express HSPs (Hspa1b), activating Tlr2 and Tlr4 on surrounding macrophages and consequently triggering the Nfkb1 pathway signaling cascade that is involved in the production of pro-inflammatory cytokines, i.e., IL-6, IL-1b and TNF-a. Then, the resulting immune responses are considered to promote neutrophil migration via MIP-2or KC secretion (Fig. 7). Acknowledgments This study was supported in part of JSPS research Grant (to Y. Morimoto) and a Grant from Okinaka Memorial Institute for Medical Research (to Y. Morimoto). We thank M. Yano, A. Majima and Y. Iida (National Defense Medical College, NDMC) for their technical assistance. Conflict of interest of interest.
The authors declare that they have no conflict
References 1. Tanaka M, Mroz P, Dai T, Huang L, Morimoto Y, Kinoshita M, et al. Photodynamic therapy can induce a protective innate immune response against murine bacterial arthritis via neutrophil accumulation. PLoS One. 2012;7(6):e39823. doi:10.1371/journal. pone.0039823.
123
2. Tanaka M, Kinoshita M, Yoshihara Y, Shinomiya N, Seki S, Nemoto K, et al. Photodynamic therapy using intra-articular photofrin for murine MRSA arthritis: biphasic light dose response for neutrophilmediated antibacterial effect. Lasers Surg Med. 2011;43(3):221–9. 3. Asea A, Rehli M, Kabingu E, Boch JA, Bare´ O, Auron PE, et al. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J Biol Chem. 2002;277(17):15028–34. 4. Folkesson HG, Matthay MA, Hebert CA, Broaddus VC. Acid aspiration-induced lung injury in rabbits is mediated by interleukin-8-dependent mechanisms. J Clin Investig. 1995;96(1):107–16. doi:10.1172/JCI118009. 5. Porat R, Poutsiaka DD, Miller LC, Granowitz EV, Dinarello CA. Interleukin-1 (IL-1) receptor blockade reduces endotoxin and Borrelia burgdorferi-stimulated IL-8 synthesis in human mononuclear cells. FASEB J. 1992;6(7):2482–6. 6. Jourdan T, Godlewski G, Cinar R, Bertola A, Szanda G, Liu J, et al. Activation of the Nlrp3 inflammasome in infiltrating macrophages by endocannabinoids mediates beta cell loss in type 2 diabetes. Nat Med. 2013;19(9):1132–40. 7. Westwell-Roper CY, Ehses JA, Verchere CB. Resident macrophages mediate islet amyloid polypeptide-induced islet IL-1b production and b-cell dysfunction. Diabetes. 2014;63(5):1698–711. doi:10.2337/db13-0863. 8. Korbelik M, Sun J, Cecic I. Photodynamic therapy-induced cell surface expression and release of heat shock proteins: relevance for tumor response. Cancer Res. 2005;65(3):1018–26. 9. Luna MC, Ferrario A, Wong S, Fisher AMR, Gomer CJ. Photodynamic therapy-mediated oxidative stress as a molecular switch for the temporal expression of genes ligated to the human heat shock promoter. Cancer Res. 2000;60(6):1637–44. 10. Mambula SS, Calderwood SK. Heat shock protein 70 is secreted from tumor cells by a nonclassical pathway involving lysosomal endosomes. J Immunol. 2006;177(11):7849–57. doi:10.4049/jim munol.177.11.7849. 11. Frasch SC, Henson PM, Nagaosa K, Fessler MB, Borregaard N, Bratton DL. Phospholipid flip-flop and phospholipid scramblase 1 (PLSCR1) co-localize to uropod rafts in formylated Met-Leu-Phestimulated neutrophils. J Biol Chem. 2004;279(17):17625–33. doi:10.1074/jbc.M313414200. 12. John K, Schreiber S, Kubelt J, Herrmann A, Mu¨ller P. Transbilayer movement of phospholipids at the main phase transition of lipid membranes: implications for rapid flip-flop in biological membranes. Biophys J. 2002;83(6):3315–23. doi:10.1016/S00063495(02)75332-0. 13. Asea A. Chaperokine-induced signal transduction pathways. Exerc Immunol Rev. 2003;9:25–33. 14. Botzler C, Li G, Issels RD, Multhoff G. Definition of extracellular localized epitopes of Hsp70 involved in an NK immune response. Cell Stress Chaperones. 1998;3(1):6–11. 15. Lawrence T. The nuclear factor NF-jB pathway in inflammation. Cold Spring Harb Perspect Biol. 2009;1(6):a001651. doi:10. 1101/cshperspect.a001651. 16. Knott PG, Gater PR, Dunford PJ, Fuentes ME, Bertrand CP. Rapid up-regulation of CXC chemokines in the airways after AgSpecific CD4? T cell activation. J Immunol. 2001;166(2):1233–40. doi:10.4049/jimmunol.166.2.1233. 17. Miura M, Fu X, Zhang Q-W, Remick DG, Fairchild RL. Neutralization of Groa and macrophage inflammatory protein-2 attenuates renal ischemia/reperfusion injury. Am J Pathol. 2001;159(6):2137–45. doi:10.1016/S0002-9440(10)63065-9. 18. Roche JK, Keepers TR, Gross LK, Seaner RM, Obrig TG. CXCL1/KC and CXCL2/MIP-2 are critical effectors and potential targets for therapy of Escherichia coli O157:H7-associated renal inflammation. Am J Pathol. 2007;170(2):526–37. doi:10. 2353/ajpath.2007.060366.
RESEARCH ARTICLE
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage interactions N. Zulaziz1 • A. Azhim1 • N. Himeno2 • M. Tanaka3 • Y. Satoh4 • M. Kinoshita5 H. Miyazaki6 • D. Saitoh6 • N. Shinomiya7 • Y. Morimoto7
•
Received: 28 January 2015 / Accepted: 12 May 2015 Japan Human Cell Society and Springer Japan 2015
Abstract Antibacterial photodynamic therapy (PDT) has come to attract attention as an alternative therapy for drugresistant bacteria. Recent reports revealed that antibacterial PDT induces innate immune response and stimulates abundant cytokine secretion as a part of inflammatory responses. However, the underlying mechanism how antibacterial PDT interacts with immune cells responsible for cytokine secretion has not been well outlined. In this study, we aimed to clarify the difference in gene expression and cytokine secretion between combined culture of fibroblasts and macrophages and their independent cultures. SCRC1008, mouse fibroblast cell line and J774, mouse macrophage-like cell line were co-cultured and PDT treatments with different parameters were carried out. After various incubation periods (1–24 h), cells and culture medium were collected, and mRNA and protein levels for cytokines were measured using real-time PCR and ELISA, respectively. Our results showed that fibroblasts and macrophages & Y. Morimoto [email protected] 1
Department of Electronic Systems Engineering, MalaysiaJapan International Institute of Technology, UTM, Kuala Lumpur, Malaysia
2
iCAT Corporations, Osaka, Japan
3
JGSDF Kumamoto Hospital, Kumamoto, Japan
4
Department of Anesthesiology, National Defense Medical College, Tokorozawa, Japan
5
Department of Immunology and Microbiology, National Defense Medical College, Tokorozawa, Japan
6
Division of Traumatology, National Defense Medical College Research Institute, Tokorozawa, Japan
7
Department of Integrated Physiology Bio-Nano Medicine, National Defense Medical College, Tokorozawa, Japan
interact with each other to mediate the immune response. We propose that fibroblasts initially respond to PDT by expressing Hspa1b, which regulates the NF-jB pathway via Tlr2 and Tlr4. Activation of the NF-jB pathway then results in an enhanced secretion of pro-inflammatory cytokines (TNF-a, IL-6 and IL-1b) and neutrophil chemoattractant MIP-2 and KC from macrophages. Keywords Immune response Macrophage Fibroblast PDT Neutrophil migration
Introduction Importance of neutrophil infiltration in antibacterial PDT Photodynamic therapy (PDT) is one of the alternatives to treat bacterial infections with the rise of threat of drug resistance. Antibacterial PDT was found to stimulate the innate immune response by recruiting neutrophils [1]. This finding makes PDT a more promising option for the treatment of bacterial infection. Although favorable results from in vitro PDT experiments using cultured bacteria have been described in many reports, only a few were applied to in vivo animal infection models. We recently demonstrated that in vivo PDT using methylene blue as a photosensitizer reduced the number of viable bacteria in the knee joint space of arthritis model mice. Interestingly, bacterial clearance in this case was not brought by direct bacterial killing effect of PDT but rather induced by neutrophil accumulation into the infectious joint space followed by phagocytosis [1]. In addition, if neutrophil infiltration was disrupted, complete eradication of bacteria was no longer achieved and surviving bacteria started re-growing [2].
123
N. Zulaziz et al.
These observations imply that neutrophil infiltration is an essential event for antibacterial PDT to combat bacterial infections effectively. Neutrophil infiltration is a phenomenon that is known to be triggered by activated macrophages and those macrophage functions are also influenced by their interactions with surrounding cells. Therefore, we hypothesize that in in vivo tissue PDT stimulates fibroblasts which are positioned as the surrounding cells for macrophages to activate their functions. To prove this, we made an in vitro model by co-culturing fibroblasts and macrophages, and evaluated the changes in cytokine secretion and related gene expressions following PDT treatment. Cytokines and chemokines involved in neutrophil migration PDT-treated cells have been reported to release a group of proteins, i.e., heat shock proteins (HSPs) that are induced by the elevation of temperatures or other environmental stresses. Among them, HSP70 is known to play a key role in innate immune responses as endogenous ligand for toll-like receptors (TLRs), especially TLR2 and TLR4 [3]. Hence, the expression level of TLR2 and TLR4 is a good marker to confirm whether HSP70-related trigger system is activated or not. Once the TLRs bind with their ligand, they recruit adapter molecules and propagate signals to activate the nuclear factor kappa B (NF-jB) transcription signaling pathway. The NF-jB pathway plays a key role in inflammation through the transcription of pro-inflammatory cytokines. Two distinct regulatory pathways, namely canonical and non-canonical pathways are known for this NF-jB activation that is controlled by the inhibitor kappa B kinase (IKK) complex. Taking those aforementioned steps into account, the mechanism of PDT is considered to rely on the activation of inflammatory sequences. The early phase of inflammation in vivo is characterized by the infiltration of neutrophils into tissues in which several cytokines serve as neutrophil chemoattractants. Interleukin-8 (IL-8) has been proposed as a major chemotactic factor for recruiting neutrophils to extravascular sites of inflammation [4]. Thus, we measured IL8. Also, tumor necrosis factor alpha (TNF-a) is a mediator of inflammation that is mainly secreted by activated macrophages. TNF-a serves as the first cytokine in the cascade of pro-inflammatory cytokines and subsequent reactions induce IL-8 production [5]. A number of studies revealed that other cytokines such as IL-1b and IL-6 also have profound effects in regulating the immune response [6, 7]. Thus, in this study, the expression of genes/proteins that are closely related to orchestrating inflammations such as HSPs, TLRs, NF-jB and neutrophil-recruiting chemokines was chosen to evaluate the effects of PDT.
123
Methodology Cell culture and PDT treatment To investigate the cross talk between two types of cells, a combined cell culture (co-culture) system was used, in which one type of cells was seeded on the well bottom of a 6-well culture plate (BD #353502, BD Biosciences), while the other type of cells was seeded on a culture insert with a membrane (a pore size of 0.4 lm) (BD #353090) as shown in Fig. 1. A murine macrophage-like cell line, J774 (JCRB, Tokyo, Japan) and a murine fibroblast SCRC-1008 (ATCC, Tokyo, Japan) were purchased and used in this study. Each cell line was seeded and maintained independently using a 6-well culture plate. J774 cells were cultured in RPMI1640 medium with 10 % FBS, while SCRC-1008 cells were cultured in DMEM medium with 15 % FBS at a concentration of 3.0 9 105 cells/well, respectively. After the cells reached confluent status (1–2 days after cell seeding), they were collected and then co-cultured as mentioned above (Fig. 1) using RPMI1640 medium with 10 % FBS (coculture group) at a concentration of 3.0 9 105 cells/well for each cell line. The volume of the medium used in coculture wells was enough to cover the cells on the inserts and to ensure that substances released from the cells were able to interact with each other. As for the control, two cell lines were cultured independently in respective culture medium (independent groups). PDT treatment According to our previous in vivo study [2], methylene blue was used as a photosensitizer. Immediately after methylene blue (0.4 lM) was added to the culture, cells were irradiated with a laser diode (655 nm, BWF2-655-2400-0.22-SMA-SP, B&W Tek, Newark, DE). The parameters of PDT used in this study are outlined in Table 1. RNA extraction and cDNA synthesis Cells were collected from the inserts and bottom of the wells. Total RNA was isolated using a QIAGEN miRNeasy Mini kit
Fig. 1 Co-culture diagram
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage… Table 1 Parameters for PDT treatment Group name
Parameters Irradiation intensity (mW/cm2)
Irradiation time (s)
Methylene blue concentration (lM)
Incubation time after irradiation
1h
28
600
0.4
1h
2h
28
600
0.4
2h
4h
28
600
0.4
4h
24 h
28
600
0.4
24 h
Control
NT
NT
NT
NT
NT not treated
according to the manufacturer’s instruction (Qiagen). The quality and quantity of RNA from each sample was determined with a spectrophotometer. Total RNA was transcribed into cDNA using SuperScript III First-Strand Synthesis Supermix for qRT-PCR (Invitrogen) according to the manufacturer’s instruction. The resulting cDNA was used for subsequent realtime PCR and reverse transcription PCR experiments. Real-time PCR Real-time fluorescence detection of amplified nucleotides was carried out using 7900HT Fast Real-Time PCR System (Applied Biosystems). Reactions were carried out in MicroAmp Optical 96-well reaction plates (Applied Biosystems) using TaqMan Gene Expression Master Mix (Applied Biosystems,). All primers used in this study were products from TaqMan Gene Expression Assays as follows: Cxcl2 (Mm00436450m1; alternative symbol of MIP-a, encoding MIP-2 which is the murine counterpart of IL-8), Cxcl1 (Mm00433859_m1; previously called GROa, KC, NAP-3), Ikbkb (Mm01222247m1; encoding IKK-b), Nfkb1 (Mm0047 6361m1; encoding NFKB1), Tlr2 (Mm00442346m1; encoding TLR2), Tlr4 (Mm00445273m1; encoding TLR4), Hspa1b (Mm03038954s1; encoding HSP70). Gapdh (Mm99999915_ g1; encoding GAPDPH) and 18S (Hs 99999901s1; encoding eukaryotic 18S rRNA) were used as endogenous controls. The assays were performed in triplicates.
GCTTCC). Cycling conditions were 3 min at 94 C, 35 cycles of 30 s at 94 C, 30 s at 60 C and 30 s at 72 C, followed by a 10-min extension step at 72 C. The PCR products were analyzed by an agarose gel electrophoresis. ELISA After co-culture of the cells, culture medium was collected from the culture plates and used for protein assays. Anti-mouse TNFa (555268, BD OptEIATM), IL-6 (555240, BD OptEIATM), IL1b (559603, BD OptEIATM), and IL-8 (554726, BD PharmingenTM) protein levels in control and treated group were determined by ELISA according to the manufacturer’s instructions. The assays were performed in duplicates. Statistical analysis In all the experiments, values were expressed as mean ± standard deviations (SD). Statistical difference between the groups was analyzed using a Student’s t test or one-way analysis of variance (ANOVA), and P \ 0.05 was taken as statistically significant.
Results Effects of PDT on gene expressions in independently cultured or co-cultured cells PDT increased HSP70 (Hspa1b) expression in fibroblast cells. Both SCRC-1008 cells co-cultured with J774 cells (SCRC-C) and independently cultured SCRC-1008 cells (SCRC-I) displayed similar patterns with gradual increase
Reverse transcription PCR (RT-PCR) After cDNA synthesis as a template, conventional PCR was carried out with a TaKaRa Taq kit (TaKaRa Biotech) using primers as follows: Hspa1b (F; GGAGGAGTICAAGAGGAA GC, R; GCGTGATGGATGTGAGAAGT), Tlr2 (F; GCAGG CGACAACCACTTT, R; CAGCAGACTCCAGACACCA G), Tlr4 (F; GAGCCGTTGGTGTATCTTTGA, R; TGTCCT CCCATTCCAGGTAG), Cxcl2 (F; GCAGTGGCAAAGTGGAGATT, R; GGTCTTCAGGCATTGACAGC), Gapdh (F; GCAGTGGCAAAGTGGAGATT, R; AAGATGGTGATGG
Fig. 2 Real-time PCR analysis of Hspa1b expression in independently cultured SCRC-1008 cells (SCRC-I) and in SCRC-1008 cells co-cultured with J774 cells (SCRC-C). At 1–4 h after PDT treatment, the expression of Hspa1b in SCRC-C was significantly up-regulated. Gene expression levels were indicated as a comparison to untreated controls (control level is set to 1). (*P \ 0.05, **P \ 0.01: compared to SCRC-I)
123
N. Zulaziz et al.
in the gene expression from 1 to 4 h (Fig. 2). However, SCRC-C expressed significantly higher level of Hspa1b than SCRC-I. In contrast, no expression of Hspa1b in J774 cells was not detected (data not shown). Both Tlr2 and Tlr4 were up-regulated in J774 cells cocultured with SCRC-1008 cells (J774-C) (Fig. 3a, b). Importantly, the expression of Hspa1b in SCRC-1008 cells and the expression of Tlr2 in J774-C after PDT progressed synchronously. In addition, Tlr4 in J774-C also upregulated within 1 h after PDT which might be involved in the early phase activation of heat shock response (Hspa1b). These results suggest that the up-regulation of HSP70 protein as a ligand for TLRs is closely connected to the augmented expression of Tlr2 and Tlr4 genes. Then, Ikbkb expression in macrophage-like J774 cells was measured since it is closely associated with the inhibition of NF-jB dimers that play key roles in the downstream of TLR-mediated signaling pathways. Real-time PCR analysis revealed that Ikbkb gene expression after
PDT significantly up-regulated only in J774-C at 2–4 h. No significant changes in Ikbkb expression were observed in independently cultured J774 cells (J774-I) as well as in SCRC-1008 cells (both SCRC-I and SCRC-C) (Fig. 3c), suggesting that co-culture of fibroblast and macrophages stimulates this NF-jB-related pathway via the production of some humoral factors by fibroblasts and activated macrophages. Regarding the expression of NF-jB (Nkfb1) itself, no significant change was observed when fibroblasts were cultured independently (SCRC-I). In other cells (J774-I, J774-C, and SCRC-C), however, the up-regulation of Nfkb1 at 24 h was remarkable. When J774-I and J774-C were compared, J774-I showed marked up-regulation of Nfkb1 from early phase of PDT (at 1–4 h) but Nfkb1 expression of J774-C at 24 h was much higher than that of J774-I (almost twice) (Fig. 3d). Regarding the expression of Cxcl2 (MIP-a), co-cultured macrophages (J774-C) showed much higher levels (five–
Fig. 3 Real-time PCR analysis of Tlr2, Tlr4, Ikbkb and Nfkb1 expressions in J774 cells and SCRC-1008 cells either in independent culture condition (indicated as ‘‘-I’’) or in co-culture condition (indicated as ‘‘-C’’). a Tlr2 expression in J774-C was significantly upregulated at 1–4 h after PDT treatment (*P \ 0.05: compared to J774-I), suggesting a modulating role of fibroblasts on macrophage function. Time course of the expression pattern of Tlr2 was similar to that of Hspa1b. b Tlr4 expression was significantly up-regulated at 1 h after PDT treatment (*P \ 0.05: compared to J774-I).
c Significant up-regulation of Ikbkb was observed only in J774-C at 2 h and 4 h (*P \ 0.05: compared to J774-I). d From 1–4 h, the expression of Nfkb1 in J774-I was significantly higher than that in J774-C. However, the expression of Nfkb1 in J774-C after 24 h incubation was significantly higher than that in J774- I (*P \ 0.05). Nfkb1 expression in SCRC-C was up-regulated only at 24 h. Each bar shows a relative gene expression level when untreated control is set to 1
123
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage…
Fig. 4 Real-time PCR analyses of Cxcl2 (MIP-a) and Cxcl1 (KC) expressions in J774 cells either in an independently cultured condition (J774-I) or in a co-cultured condition (J774-C). Gene expression levels are shown as relative values to untreated control. Throughout
tenfold) than independently cultured macrophages (J774-I) throughout the observation period (Fig. 4a). Cxcl1 (KC) is another important gene that is responsible for neutrophil recruitment and the development of PDT-induced inflammation. The expression pattern of Cxcl1 is similar to that of Cxcl2; co-cultured macrophages (J774-C) showed the highest level of Cxcl1 at 1 h and kept significantly higher levels (two–fivefold) than independently cultured macrophages (J774-I) throughout the observation period (Fig. 4b). However, the expression of both Cxcl1 and Cxcl2 was not up-regulated in SCRC-1008 fibroblasts whether co-cultured or independently cultured (data not shown). These results suggest that both KC and MIP-a are exclusively produced by macrophages and dramatically upregulated by the factors secreted from PDT-stimulated fibroblasts. The expression of Hspa1b, Tlr2, Tlr4 and Cxcl2 was also analyzed by conventional RT-PCR (Fig. 5). The results were consistent with those of real-time PCR. Briefly, SCRC-1008 cells co-cultured with J774 cells (SCRC-C) demonstrated stronger Hspa1b expression than the independently cultured cells (SCRC-I). Also, J774 cells cocultured with SCRC-1008 cells (J774-C) showed stronger expressions of Tlr2, Tlr4 and Cxcl2 than independently cultured cells (J774-I). PDT-mediated secretion of pro-inflammatory cytokines by macrophages co-cultured with fibroblasts Co-cultivation of J774 cells with SCRC-1008 cells followed by PDT stimulated the secretion of pro-inflammatory cytokines, i.e., TNF-a, IL-6 and IL-1b. They were secreted immediately after PDT and showed a peak production at 1 h, then gradually decreased until 4 h (Fig. 6a– c). Interestingly, secreted TNF-a in the culture medium of independently cultured J774 cells (green bars in Fig. 6a)
the observation period, expressions of Cxcl2 (a) and Cxcl1 (b) in J774-C showed significantly higher values than those in J774-I (*P \ 0.05, **P \ 0.01)
SCRC-C
SCRC-I
1h 2h 4h 24h Cont 1h 2h 4h 24h Cont Hspa 1b Gapdh J774-C
J774-I
1h 2h 4h 24h Cont 1h 2h 4h 24h Cont Tlr2 Gapdh Tlr4 Gapdh Cxcl2 Gapdh
Fig. 5 RT-PCR analysis of Hspa1b, Tlr2, Tlr4 and Cxcl2. Expression of Hspa1b in co-cultured SCRC1008 cells (SCRC-C) or independently cultured SCRC1008 cells (SCRC-I). The expression of Gapdh is displayed as an internal control. Tlr4, Tlr2, and Cxcl2 expressions in J774 cells either in a co-cultured condition (J774-C) or an independently cultured condition (J774-I). In all four genes, the expression levels in a co-cultured condition are much higher than in an independently cultured condition
showed much higher levels than that of co-cultured cells (blue bars in Fig. 6a), but other pro-inflammatory cytokines (IL-6 and IL-Ib) were not secreted in the culture medium of independently cultured J774 cells (green bars in Fig. 6b, c). This may suggest that cultivation of macrophages with fibroblasts (blue bars in Fig. 6a) did up-regulate the production of TNF-a from macrophages yet the level of its production was kept in an optimal range as compared to the cultivation of macrophages alone (green bars in Fig. 6a) that overproduced TNF-a. TNF-a in the culture medium of independently cultured SCRC-1008 cells (red bars in
123
N. Zulaziz et al.
Fig. 6 Effects of PDT on cytokine production. ELISA analysis of TNF-a (a), IL-6 (b), IL-1b (c) and MIP-2 (d) secretions using media from independently cultured J774 cells (green bars), SCRC-1008 cells (red bars), and co-cultured cells (blue bars) with n = 2 number of experiments. For each cytokine, secretion activity per hour was measured and secretion level in the untreated control was standardized to ‘1’. (Untreated controls of TNF-a in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC1080 were 8.3, 7.8 and \6.2 9 10-1 pg/mL, respectively. Untreated controls of IL-6 in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC-1080 were
2.4 9 102, 3.7 9 101 and 3.5 pg/mL, respectively. Untreated controls of IL-1b in medium of co-cultured cells, independently cultured J774 and independently cultured SCRC-1080 were 2.8, 2.7 and \2.3 pg/ mL, respectively. Untreated controls of MIP-2 in medium of cocultured cells, independently cultured J774 and independently cultured SCRC-1080 were 3.3 9 101, 4.2 9 101 and \1.3 pg/mL, respectively). a Secretion of TNF-a was higher in medium of independently cultured J774 cells compared to that in medium of cocultured cells at 1–4 h. b–d Secretion of IL-6, IL-1b and MIP-2 in medium of co-cultured cells was higher than in medium of independently cultured J774 cells throughout the observation period
Fig. 6a) was also measured, but the amount was negligible. Therefore, TNF-a was proven to be produced mainly by J774 macrophages. Unlike TNF-a or IL-6, the secretion of IL-1b in co-cultured cells was kept in a high level at 24 h after PDT (blue bars in Fig. 6c). Regarding the neutrophil chemotactic factor MIP-2, a marked increase in its production was observed in co-cultured cells (blue bars in Fig. 6d) but not in independently cultured J774 cells (green bars in Fig. 6d). The secretion level was the highest at 2 h after PDT, and then gradually declined to 24 h (Fig. 6d).
we hypothesized that under certain condition, PDT stimulates tissue fibroblasts to up-regulate macrophage functions, which lead to the initiation and regulation of neutrophil migration. To study this hypothesis, J774 macrophages were co-cultivated with SCRC-1008 fibroblasts and the effects of PDT on their gene expression and cytokine secretion related to pro-inflammatory responses and neutrophil attraction were investigated. Recent report revealed that tumor cells treated with PDT express cell surface HSPs and induce inflammatory and immune responses that contribute to the therapeutic outcome [8]. In this study, Hspa1b gene expression was significantly increased at transcriptional level in SCRC-1008 fibroblasts following PDT when they were co-cultured with J774 macrophages. The basic insult inflicted by PDT is a form of oxidative stress, which is known to be a molecular switch for the temporal expression of genes ligated to the
Discussion We have previously shown that PDT induces neutrophil migration to the infected lesion and enhances bacterial clearance in arthritis model mice [1]. In the present study,
123
Photodynamic therapy mediates innate immune responses via fibroblast–macrophage…
HSPs [9]. The mechanisms of PDT-induced up-regulation of Hspa1b include the activation of lysosome–endosome pathway [10], in which HSPs are translocated into an endolysosomal compartment, transported to the cell surface, and secreted from the cells via the role of transporter proteins. HSPs secreted from the cell surface are thought to take part in paracrine or autocrine interactions with adjacent cell surfaces. It is also possible that PDT-stimulated cells transiently expose HSPs inside the cells by phospholipid flip-flop and membrane packing changes without causing apoptosis [11, 12]. The up-regulation of Hspa1b gene in fibroblasts was considered to cause an increase in surface HSPs proteins and subsequent release of these proteins, which might lead to the stimulation of their applicable receptors of J774 macrophages. Because the chaperokine activity of HSPs has been reported to be mediated in part by utilizing surface receptors for TLR signaling such as TLR2 (receptor for Gram-positive bacteria) and TLR4 (receptor for Gram-negative bacteria) in a CD14-dependent fashion [13], CD14-positive macrophages seem to be the most suitable effector of HSPs-related innate immune responses. In this study, elevated expression of both TLR2 and TRL4 was remarkable in co-cultured J774 cells (J774-C), thereby supporting the idea that chaperokine-mediated activation of TLR pathways occurred in PDT-treated macrophages. Particularly the gene activation pattern of Hspa1b in fibroblasts was well correlated with the up-regulated expression of TLR2 (Tlr2) in J774 macrophages. Therefore, the HSPs-TLR2 activation loop between fibroblasts and macrophages is considered to be the most important part of the PDT-treated stimulation process of innate immune responses and this may explain the efficacy of PDT in MRSA-infected murine arthritis models in our previous report [1]. It is important for HSPs molecules to express chaperokine activity for TLRs on other cells because carboxy-terminal domain is involved in the interaction of HSPs with its chaperoned client peptides (substrates) and endogenous peptides that may serve as a source of antigens that induce subsequent immune responses [8]. Botzler et al. [14] have shown that the carboxy-terminal domain of HSPs is exposed when this molecule is expressed at the cell surface. Therefore, the cell surface expression of HSPs on PDT-treated fibroblasts seems to be essential to initiate the activation of TLRtriggered immune pathways in surrounding macrophages. On one other hand, the expression of Ikbkb that encodes NF-jB pathway inhibitor protein (IjB) increased at 2–4 h after PDT in co-cultured J774 cells (J774-C) and returned to basal level at 24 h. On the other hand, the expression pattern of Nfkb1 was different from that of Ikbkb; it showed relatively low expression in the first 4 h after PDT and then significantly increased at 24 h. Based on these results, the up-regulation of Ikbkb in J774-C might somehow inhibit
the expression of Nfkb1 at the early phase after PDT. Nevertheless, most of the pro-inflammatory cytokines measured in the present study, i.e., TNF-a, IL-6 and IL-1b showed significantly high secretion levels in the first 4 h after PDT. Taking these facts into account, the production of pro-inflammatory cytokines was considered to be regulated exquisitely by modulating the balance between NF-jB and IjB; TNF-a was overproduced in J774-I in which the expression of Ikbkb was low and that of Nfkb1 was high, whereas reasonable amount of TNF-a was produced in J774-C in which the expression of Ikbkb was high and that of Nfkb1 was modest. These results imply that different regulatory mechanisms are involved in activating pro-inflammatory cytokine production pathways after PDT whether fibroblasts and macrophages are co-cultured or not. Although NF-jB has long been considered as a key molecule for pro-inflammatory pathways, recent evidence has shown that it works in both pro- and anti-inflammatory pathways [15]. This also explain the reason why high secretion levels of pro-inflammatory cytokines were maintained in J774-C even though Nfkb1 expression levels were much lower than J774-I at the early phase after PDT treatment. Regarding the production of pro-inflammatory cytokines from macrophages through the activation of TLR pathways, generally their specific ligands are needed to induce effective responses. However, our data revealed that the activation of TLRs via PDT was sufficient to induce the release of pro-inflammatory cytokines including IL-1b. Pro-inflammatory cytokines other than TNF-a were secreted in much higher levels from J774 cells co-cultured with fibroblasts (blue bars in Fig. 6) than independently cultured J774 cells (green bars in Fig. 6). Independent culture of SCRC-1008 fibroblasts did not secrete any of these pro-inflammatory cytokines (data not shown). This means that although fibroblasts did not directly secrete the pro-inflammatory cytokines, they are required to activate macrophage functions to initiate and regulate the innate immune response efficiently. Both real-time PCR and ELISA analyses showed that chemokine (C-X-C motif) ligand 2 (CXCL2/MIP-2) namely murine counterpart of IL-8 was highly expressed during the first 4 h after PDT, then gradually declined afterwards and finally at 24 h, gene expression level was maintained at a high level. MIP-2 is a chemoattractant for neutrophils and secreted from macrophages in response to acute inflammation to recruit and accumulate the neutrophils in the infection focus. Chemokine (C-X-C motif) ligand 1 (CXCL1/KC) is another important chemoattractant for neutrophils. Previous studies demonstrated that CXCL1/ KC and CXCL2/MIP-2 were secreted in a similar time course after induction [16–18]. Our data showed that higher levels of CXCL1/KC and CXCL2/MIP-2 were
123
N. Zulaziz et al.
Fig. 7 A proposed model for PDT-mediated neutrophil migration: PDT stimulates fibroblast–macrophage interactions and activates the HSPs-TLR signaling pathways, which triggers the NF-jB pathway. The NF-jB pathway promotes the production of cytokines and MIP2/KC. Both MIP-2 and KC play a key role in neutrophil migration
secreted from the co-cultured macrophages (J774-C) than from the independently cultured macrophages (J774-I). Our findings proposed two distinct mechanism of neutrophil migration that is induced by sublethal dose of antibacterial PDT. One is an early phase reaction at about 1 to 4 h after PDT irradiation that may be regulated by TNF-a, MIP-2/KC, or IL-6; the other is a delayed phase reaction that peaks at 24 h after PDT irradiation, and MIP-2/KC and IL-1b are the factors regulating the reaction of this type of neutrophil migration. These two waves of neutrophil activation may be effective for bacterial clearance by recruiting activated neutrophils to the infection focus at the early phase of PDT and by maintaining the bactericidal activity of these recruited neutrophils in the following phase. In summary, co-culture of J774 macrophages with SCRC-1008 fibroblasts showed higher immune responses after stimulation with PDT than isolated cultures. Our results revealed that sublethal dose of PDT is capable of stimulating fibroblasts to express HSPs (Hspa1b), activating Tlr2 and Tlr4 on surrounding macrophages and consequently triggering the Nfkb1 pathway signaling cascade that is involved in the production of pro-inflammatory cytokines, i.e., IL-6, IL-1b and TNF-a. Then, the resulting immune responses are considered to promote neutrophil migration via MIP-2or KC secretion (Fig. 7). Acknowledgments This study was supported in part of JSPS research Grant (to Y. Morimoto) and a Grant from Okinaka Memorial Institute for Medical Research (to Y. Morimoto). We thank M. Yano, A. Majima and Y. Iida (National Defense Medical College, NDMC) for their technical assistance. Conflict of interest of interest.
The authors declare that they have no conflict
References 1. Tanaka M, Mroz P, Dai T, Huang L, Morimoto Y, Kinoshita M, et al. Photodynamic therapy can induce a protective innate immune response against murine bacterial arthritis via neutrophil accumulation. PLoS One. 2012;7(6):e39823. doi:10.1371/journal. pone.0039823.
123
2. Tanaka M, Kinoshita M, Yoshihara Y, Shinomiya N, Seki S, Nemoto K, et al. Photodynamic therapy using intra-articular photofrin for murine MRSA arthritis: biphasic light dose response for neutrophilmediated antibacterial effect. Lasers Surg Med. 2011;43(3):221–9. 3. Asea A, Rehli M, Kabingu E, Boch JA, Bare´ O, Auron PE, et al. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J Biol Chem. 2002;277(17):15028–34. 4. Folkesson HG, Matthay MA, Hebert CA, Broaddus VC. Acid aspiration-induced lung injury in rabbits is mediated by interleukin-8-dependent mechanisms. J Clin Investig. 1995;96(1):107–16. doi:10.1172/JCI118009. 5. Porat R, Poutsiaka DD, Miller LC, Granowitz EV, Dinarello CA. Interleukin-1 (IL-1) receptor blockade reduces endotoxin and Borrelia burgdorferi-stimulated IL-8 synthesis in human mononuclear cells. FASEB J. 1992;6(7):2482–6. 6. Jourdan T, Godlewski G, Cinar R, Bertola A, Szanda G, Liu J, et al. Activation of the Nlrp3 inflammasome in infiltrating macrophages by endocannabinoids mediates beta cell loss in type 2 diabetes. Nat Med. 2013;19(9):1132–40. 7. Westwell-Roper CY, Ehses JA, Verchere CB. Resident macrophages mediate islet amyloid polypeptide-induced islet IL-1b production and b-cell dysfunction. Diabetes. 2014;63(5):1698–711. doi:10.2337/db13-0863. 8. Korbelik M, Sun J, Cecic I. Photodynamic therapy-induced cell surface expression and release of heat shock proteins: relevance for tumor response. Cancer Res. 2005;65(3):1018–26. 9. Luna MC, Ferrario A, Wong S, Fisher AMR, Gomer CJ. Photodynamic therapy-mediated oxidative stress as a molecular switch for the temporal expression of genes ligated to the human heat shock promoter. Cancer Res. 2000;60(6):1637–44. 10. Mambula SS, Calderwood SK. Heat shock protein 70 is secreted from tumor cells by a nonclassical pathway involving lysosomal endosomes. J Immunol. 2006;177(11):7849–57. doi:10.4049/jim munol.177.11.7849. 11. Frasch SC, Henson PM, Nagaosa K, Fessler MB, Borregaard N, Bratton DL. Phospholipid flip-flop and phospholipid scramblase 1 (PLSCR1) co-localize to uropod rafts in formylated Met-Leu-Phestimulated neutrophils. J Biol Chem. 2004;279(17):17625–33. doi:10.1074/jbc.M313414200. 12. John K, Schreiber S, Kubelt J, Herrmann A, Mu¨ller P. Transbilayer movement of phospholipids at the main phase transition of lipid membranes: implications for rapid flip-flop in biological membranes. Biophys J. 2002;83(6):3315–23. doi:10.1016/S00063495(02)75332-0. 13. Asea A. Chaperokine-induced signal transduction pathways. Exerc Immunol Rev. 2003;9:25–33. 14. Botzler C, Li G, Issels RD, Multhoff G. Definition of extracellular localized epitopes of Hsp70 involved in an NK immune response. Cell Stress Chaperones. 1998;3(1):6–11. 15. Lawrence T. The nuclear factor NF-jB pathway in inflammation. Cold Spring Harb Perspect Biol. 2009;1(6):a001651. doi:10. 1101/cshperspect.a001651. 16. Knott PG, Gater PR, Dunford PJ, Fuentes ME, Bertrand CP. Rapid up-regulation of CXC chemokines in the airways after AgSpecific CD4? T cell activation. J Immunol. 2001;166(2):1233–40. doi:10.4049/jimmunol.166.2.1233. 17. Miura M, Fu X, Zhang Q-W, Remick DG, Fairchild RL. Neutralization of Groa and macrophage inflammatory protein-2 attenuates renal ischemia/reperfusion injury. Am J Pathol. 2001;159(6):2137–45. doi:10.1016/S0002-9440(10)63065-9. 18. Roche JK, Keepers TR, Gross LK, Seaner RM, Obrig TG. CXCL1/KC and CXCL2/MIP-2 are critical effectors and potential targets for therapy of Escherichia coli O157:H7-associated renal inflammation. Am J Pathol. 2007;170(2):526–37. doi:10. 2353/ajpath.2007.060366.
