233
.I. Photochem. Photobiol. B: Biol., 15 (1992) 233-238
Photoinduction
of albino-3 gene expression in Neurospora crassa conidia Simona
Bairna=,
Alessandra
Carattolib,
Giuseppe
Macinob
and
Giorgio
Morelli”#+
“Unitri di Nutrizione Sperimentale, Istituto Nazionale della Nut&one via Ardeatina 546 00178 Roma (Italy) “Dipartimento di Biopatologia Umana, Sezione di Biologia Cellulare, Policlinico Umberto I”, Universitd di Roma La Sapienza, 00161 Roma (Italy) (Received
January
6, 1992; accepted
March 29, 1992)
Abstract The synthesis of carotenoids is induced by blue light in Neurospora crussa mycelia, while in conidia (the vegetative spores) the accumulation of carotenoids also occurs in the dark. The expression of the albino-3 (~1-3) gene (coding for the carotenogenic enzyme geranyl-geranyl pyrophosphate synthetase) in isolated conidia was analysed. The level of al3 mRNA was shown to be increased in light-induced wild type (wt) conidia. This light response was elicited by blue light and was under the control of the white collar-l (wc1) and white collar-2 (WC-~) gene products. This indicates that the blue-light photoreceptor and the light transduction pathway which activate al-3 gene expression in mycelia are probably the same as in conidia.
Keywords: Carotenoid, crassa.
blue light effects,
light regulation,
gene
expression,
Neurospora
1. Introduction Light has long been known to influence development in conidial fungi [l] and certain species have been characterized as “diurnal sporulators” [2]. Exposure of the filamentous fungus Neurosporu crassa to blue light has several effects, including photoinduction of carotenoid biosynthesis (the orange pigment of N. crassa) in mycelia [3], light control of the endogenous rhythm of conidiation [4], and, under certain conditions, promotion of conidiation [5]. During the vegetative cycle, N. crassa hyphae differentiate into conidia, the dormant asexual spores. Conidia are pigmented both in dark and light growth conditions, indicating that the accumulation of carotenoid is independent of light induction. The two “blind” N. crassa mutants white collar-l (WC-~), white collar-2 (WC-~) are unable to carry out any blue-light-induced responses [3, 6, 71. Photo-induced carotenoid biosynthesis is impaired in the mycelia of these mutants [8]; however, they can still accumulate carotenoids in the conidia. This suggests that two different mechanisms
‘Author
to whom correspondence
loll-1344/92/$5.00
should be addressed.
0 1992 - Elsevier
Sequoia.
All rights
reserved
234
are active in mycelial and conidial cells. The light-independent accumulation of carotenoid pigments in conidia could be seen as a mechanism evolved to confer higher resistance to light and to other oxidative stresses during dormant life. In order to investigate the carotenoid biosynthesis in conidial cells at the molecular level, we took advantage of the genetic and biochemical work previously carried out using N. crassa. Carotenoid production is impaired in the albino mutants, al-l, al-5 al-3. These mutants are defective in the carotenogenic enzymes phytoene dehydrogenase, phytoene synthetase and geranyl-geranyl pyrophosphate synthetase; the activities of these enzymes have been shown to be induced by blue light [8]. Recently al-l [9], al-2 [lo] and al-3 [ll, 121 genes have been isolated. We have shown that light activates the transcription of the al-3 gene in mycelia [13] and similar results have been obtained by Schmidhauser et al. with the al-l gene 191. It has been demonstrated that the photo-induced transcription of the al-1 and al-3 genes in mycelia is impaired in wcI and WC-~ mutants [9, 11, 131. In the present study we analysed the regulation of al-3 gene expression in mature conidia where the accumulation of carotenoid pigments has been considered unaffected by light exposure. The data presented in this communication indicate that al-3 gene expression is also light-regulated in mature conidia. Under blue-light illumination we observed that the al-3 mRNA is rapidly accumulated in wild-type (wt) but not in wc1 and WC-~ conidia. The observation that blue-light and WC gene products control al3 gene expression in mycelial and conidial cells suggests that the photoreceptor and the signal transduction system are the same in both cell types.
2. Materials
and methods
2.1. Strains
The following N. crassa wild type (wt) and mutant strains were obtained from the Fungal Genetics Stock Center (FGSC, University of Kansas, KS): Oak Ridge wt 74-OR23A (FGSC no. 987) WC-I (MK2; FGSC no. 4403) WC-~ (ER33; FGSC no. 4407). Stocks of conidia were stored frozen in double-distilled water. 2.2 Growth
and photoinduction
conditions
Conidia were innoculated at 4X lo6 cells in 100 ml solid Vogel minimal medium [14] plus 2% sucrose and incubated in the dark at 30 “C for 4 or 8 d. Conidia were harvested in the dark by double filtration through glass wool, collected by centrifugation in Falcon tubes and finally resuspended in 50 ml of distilled water ((2-3) x lo7 cells ml-‘). The purity of the conidia preparations was checked under the light microscope. Mature conidia represented more than 99% of the preparations. White-light induction was performed directly in Falcon tubes with 12 Sylvania GRO-LUX F 18W-GRO lamps. Blue-light induction was performed in the same tubes with a slide projector equipped with a Roscolux Blue N. 83 filter (wavelength range, 30&500 nm). Lightinduced and dark-incubated conidia were collected by centrifugation and immediately frozen in liquid nitrogen. 2.3. RNA
extractions
and Northern
hybridizations
Frozen conidia were powdered in a mortar cooled with liquid nitrogen. Total RNA was extracted, electrophoresed and hybridized as described previously [13]. For electrophoresed on 1.2% Northern blot analysis, total RNA (4 pg) was denatured, agarose-1.9% formaldehyde gels and transferred on to Hybond-N membranes (Amer-
235
sham). Each set of samples was run in duplicate in the same gel and hybridized either to the specific oligonucleotide probe for the al-3 mRNA, or to IF2 cDNA probe, as a control. The (S’ACGGCCATGGTGACGTGTTCCATITCC3’) al-3 oligo is a 27mer complementary to the al-3 mRNA around the translation initiation site [12]. The IF2 cDNA was obtained from the screening of a N. crussu cDNA library [12]. In the case of oligonucleotide probe, filters were hybridized at 50 “C in 5 X SSC, 5 X Denhardt’s solution, 50 mM sodium phosphate pH 7.0, 0.5% SDS, 50 Fg ml-’ denatured herring sperm DNA, 5X lo6 cpm ml-’ of probe for 18 h; the filters were washed at 50 “C in 1 x SSC, 0.1% SDS for 30 min. In the case of IF2 probe, filters were hybridized at 42 “C in 6XSSPE (1 XSSPE is 0.18 M NaCl, 0.01 M sodium phosphate (pH 7.7) 1 mM EDTA), 1 XDenhardt’s solution (0.02% bovine serum albumin (BSA), 0.02% Ficoll, 0.02% polyvinyl pyrrolidone), 50% formamide, 5% dextran sulphate, 0.1% sodium dodecyl sulphate (SDS), 200 pg ml-’ denatured herring sperm DNA, 2~ lo6 cpm ml-’ of probe for 18 h; the filters were washed at 48 “C in 0.1 X SSC (1 XSSC is 0.15 M NaCl, 0.015 M Na citrate pH 7.0) 0.1% SDS for 30 min. Filters were autoradiographed with preflashed Hyperfilm-MP film (Amersham) in the presence of intensifying screens (Cronex Quanta III, Du Pont Co.)
3. Results To study the expression of the al-3 gene in conidia, we harvested mature ungerminated conidial cells (free of conidiophore structures) from solid media cultures of N. crussu grown in the dark for 8 d. The isolated conidia suspensions were then illuminated for 0, 15 or 30 min with white light, under the same conditions used for the photoinduction of al-3 gene expression in mycelia as described in [13]. Total RNA was then extracted and hybridized with a specific oligonucleotide probe for the al-3 gene [13]. Although dark-grown conidia are pigmented, Northern blot analysis revealed that the al-3 mRNA level is not detectable in this dark-grown cell type (Fig. 1, lane 1). Similar results have been obtained with younger conidia harvested from cultures grown for 4 d (data not shown). The steady-state level of the al-3 mRNA increases in wt conidia illuminated for 15 and 30 min (Fig. 1, lanes 2 and 3), indicating that the expression of the al-3 gene is under light control also in this cell type. The rapid accumulation of the al-3 mRNA in conidia is similar to that observed in mycelia [13]. To test whether a blue-light photoreceptor is active in conidia, we have used a blue-light source to induce the expression of the al-3 gene. Figure 2 shows that the al-3 mRNA level increases in mature ungerminated conidia exposed to the blue component of the light spectrum. We further analysed the expression of the al-3 gene in WC-~ and WC-~ strains and the results are shown in Fig. 3. The accumulation of the al-3 mRNA was detected only in the case of irradiated wt conidia. The lack of al-3 mRNA accumulation in the “blind” mutants indicates that the products of WC-I and WC-~ genes also play an essential role in this light response.
4. Discussion Carotenoids are common pigments synthetized by all photosynthetic organisms and by many fungi and bacteria. In fungi, they help to protect the organism from photooxidative damage [3]. In N. crussu carotenogenesis is induced by blue light in
236
Fig. 1. Northern (RNA) blot showing the expression of the al-3 gene in dark-grown and in white-light-induced conidia. Total RNA was prepared from wt conidia. Samples (4pg) of each RNA were separated on an agarose-formaldehyde gel and hybridized to al-3 specific probe. The time of light induction is indicated as 0, 15 or 30 min. Control hybridizations showed that IF2 mRNA, which is not light regulated [13], was present in similar amounts in each mRNA preparation. Fig. 2. Blue-light induction of the al-3 gene. Wt conidia were collected from dark-grown cultures, and the RNA was prepared from conidia kept in the dark (D) or exposed to blue-light for 15 min (BL). Other experimental conditions as in Fig. 1. The position of the small ribosomal RNA is indicated by an asterisk.
Fig. 3. Expression of the al-3 gene in conidia of WC-I and WC-2mutants. Wt and mutant conidia (WC-I and WC-~respectively) were collected from dark-grown cultures, and the RNA was prepared from conidia kept in the dark (D) or exposed to light for 15 min (L). Other experimental conditions as in Fig. 1. mycelia and this phenomenon cloned the al-3 gene, coding acterized the photoregulation In the present study we stage of N. crassa. Conidia and protein synthesis [16]. light induction and for this
has been extensively studied [15]. We have previously for geranyl-geranyl pyrophosphate synthetase, and charof its expression in mycelia [ll-131. analysed al-3 gene expression in conidia, a developmental are quiescent cells with a low rate of metabolic activity Carotenoid accumulation in conidia takes place without reason it has been suggested that carotenoid biosynthesis
237 is constitutive
in this cell type. We have found that the al-3 mRNA level is undetectable in mature conidia obtained from cultures dark-grown for 4 and 8 d. The lack of al3 mRNA accumulation suggests that bulk carotenoid biosynthesis precedes the formation of mature conidia. Schmidhauser et al. have recently reported that al-I and al-2 genes are expressed during conidiogenesis [9], and it is therefore conceivable that carotenoid biosynthesis may start at this stage. Furthermore, in this work we have shown that al-3 gene expression is rapidly induced by light in mature conidia. As in mycelia, this activation is mediated by the blue portion of the light spectrum and requires the products of both the WC genes. These results suggest that conidia and mycelia share the same signal transduction pathway and photoreceptor. We therefore propose that the expression of carotenoid biosynthetic genes is always regulated by light during vegetative growth (mycelia and conidia). A developmental signal, acting during the differentiation from aerial hyphae to conidia, allows carotenoid accumulation in darkgrown asexual spores. Conidiospores are produced not only as agents of dispersion but also as stress-resistant forms. Their morphogenesis ultimately consists in the acquisition of thick walls and pigmentation that confer resistance to drought-, salt-, heat- and light-stresses. Plesofsky-Vig and Brambl [17] have studied the heat shock response of Neurospora. They established that conidiospores respond to severe temperature shift, rapidly inducing the synthesis of heat shock proteins, such as hsp83 and hsp30 [17]. Blue-light irradiation of N. crussa conidia produces singlet molecular oxygen and superoxide which ultimately lead to lipid peroxidation and cellular damage [18, 191. Similarly, the rapid photo-induction of al-3 gene expression and the putative
light-induced overaccumulation of carotenoids in conidia could be seen as part of a stress response system. This could help to sustain the conidia in adverse environmental conditions. Acknowledgments
We wish to thank Paola Ballario for critical reading of this manuscript and Giuseppe Crocchioni for skilled technical assistance. This work was supported by Piano Nazionale Sviluppo di Tecnologie Avanzate Applicate alle Piante, Minister0 Agricoltura e Foreste and by Istituto Pasteur -Fondazione Cenci Bolognetti. References C. M. Leach, Interaction of near-ultraviolet light and temperature on sporulation of the fungi Altemaria, Cercosporella, Fusarium, Helminthosporium and Stemphylium, Can. J. Bot., 4.5 (1967) 1999-2016. T. Kumagai, Blue and ultraviolet reversible photoreaction in conidial development of certain fungi, in H. Senger (ed.), The Blue Light Syndrome, Springer, Berlin, 1980, pp. 251-260. R. W. Harding and W. Shropshire, Jr., Photocontrol of carotenoid biosynthesis, Annu. Rev. Plant Physiol., 31 (1980) 217-238. J. F. Feldman, Genetic approaches to circadian clocks, Annu. Rev. Plant PhysioZ., 33 (1982) 583608. E. Kiemm and H. Ninnemann, Correlation between absorbance changes and a physiological response induced by blue light in Neurospora, Photochem. Photobiol., 28 (1978) 227-230. F. Degh Innocenti, U. Pohl and V. E. A. Russo, Photoinduction of protoperithecia in Neurospora crassa by blue light, Photochem. Photobiol., 37 (1983) 49-51. F. Degli Innocenti and V. E. A. Russo, Genetic analysis of blue light-induced responses in Neurospora crassa, in H. Senger (ed.), Blue light effects in biological systems, Springer, Berlin, 1984, pp. 213-219.
238 8 R. W. Harding and R. Turner, Photoregulation of the carotenoid biosynthesis pathway in albino and white collar mutants of Neurospora crassa, Plant Physiol., 68 (1981) 745-749. 9 T. J. Schmidhauser, F. K. Lauter, V. E. A. Russo and C. Yanofsky, Cloning, sequence, and photoregulation of al-l, a carotenoid biosynthetic gene of Neurospora crassa, Mol. Cell. Biol., 10 (1990) 5064-5070. 10 T. J. Schmidhauser, personal communication, 1991. 11 M. A. Nelson, G. Morelli, A. Carattolli, N. Roman0 and G. Macino, Molecular cloning of a Neumspora crassa carotenoid biosynthetic gene (albino-3) regulated by blue light and the products of the white collar genes, Mol. Cell. Biol., 9 (1989) 1271-1276. 12 A. Carattoli, N. Romano, P. Ballario, G. Morelli and G. Macino, The Neurospora crassa carotenoid biosynthetic gene (albino 3) reveals highly conserved regions among prenyltransferases. J. Biol. Chem., 266 (1991) 5854-5859. 13 S. Baima, G. Macino and G. Morelli, Photoregulation of the albino-3 gene in Neurospora crassa, J. Photochem. Photobiol. B: Biol., 11 (1991) 107-115. 14 H. J. Vogel, Distribution of lysine pathways among fungi: evolutionary implications. Am. Nat., 98 (1964) 435-446. 15 W. Rau and U. Mitzka-Schnabel, Carotenoid synthesis in Neurospora crassa, Methods Enzymol., I10 (1985) 253-267, and references cited therein. 16 A. Bonnen and R. Brambl, Germination physiology of Neurospora crassa conidia, Exp. Mycol., 7 (1983) 197-207. 17 N. Plesofsky-Vig and R. Brarnbl, Two developmental stages of Neurospora crassa utilize similar mechanisms for responding to heat shock but contrasting mechanisms for recovery, Mol. Cell. Biol., 7 (1987) 3041-3048. 18 M. Shimizu, T. Egashira and U. Takahama, Inactivation of Neurospora Crassa conidia by singlet molecular oxygen generated by a photosensitized reaction, J. Bacterial., 138 (1979) 293-296. 19 U. Takahama, M. Shimizu-Takahama and T. Egashira, Reduction of exogenous cytochrome c by Neurospora crassa conidia: effects of superoxide dismutase and blue light, J. Bacferiol., 152 (1982) 151-156.
.I. Photochem. Photobiol. B: Biol., 15 (1992) 233-238
Photoinduction
of albino-3 gene expression in Neurospora crassa conidia Simona
Bairna=,
Alessandra
Carattolib,
Giuseppe
Macinob
and
Giorgio
Morelli”#+
“Unitri di Nutrizione Sperimentale, Istituto Nazionale della Nut&one via Ardeatina 546 00178 Roma (Italy) “Dipartimento di Biopatologia Umana, Sezione di Biologia Cellulare, Policlinico Umberto I”, Universitd di Roma La Sapienza, 00161 Roma (Italy) (Received
January
6, 1992; accepted
March 29, 1992)
Abstract The synthesis of carotenoids is induced by blue light in Neurospora crussa mycelia, while in conidia (the vegetative spores) the accumulation of carotenoids also occurs in the dark. The expression of the albino-3 (~1-3) gene (coding for the carotenogenic enzyme geranyl-geranyl pyrophosphate synthetase) in isolated conidia was analysed. The level of al3 mRNA was shown to be increased in light-induced wild type (wt) conidia. This light response was elicited by blue light and was under the control of the white collar-l (wc1) and white collar-2 (WC-~) gene products. This indicates that the blue-light photoreceptor and the light transduction pathway which activate al-3 gene expression in mycelia are probably the same as in conidia.
Keywords: Carotenoid, crassa.
blue light effects,
light regulation,
gene
expression,
Neurospora
1. Introduction Light has long been known to influence development in conidial fungi [l] and certain species have been characterized as “diurnal sporulators” [2]. Exposure of the filamentous fungus Neurosporu crassa to blue light has several effects, including photoinduction of carotenoid biosynthesis (the orange pigment of N. crassa) in mycelia [3], light control of the endogenous rhythm of conidiation [4], and, under certain conditions, promotion of conidiation [5]. During the vegetative cycle, N. crassa hyphae differentiate into conidia, the dormant asexual spores. Conidia are pigmented both in dark and light growth conditions, indicating that the accumulation of carotenoid is independent of light induction. The two “blind” N. crassa mutants white collar-l (WC-~), white collar-2 (WC-~) are unable to carry out any blue-light-induced responses [3, 6, 71. Photo-induced carotenoid biosynthesis is impaired in the mycelia of these mutants [8]; however, they can still accumulate carotenoids in the conidia. This suggests that two different mechanisms
‘Author
to whom correspondence
loll-1344/92/$5.00
should be addressed.
0 1992 - Elsevier
Sequoia.
All rights
reserved
234
are active in mycelial and conidial cells. The light-independent accumulation of carotenoid pigments in conidia could be seen as a mechanism evolved to confer higher resistance to light and to other oxidative stresses during dormant life. In order to investigate the carotenoid biosynthesis in conidial cells at the molecular level, we took advantage of the genetic and biochemical work previously carried out using N. crassa. Carotenoid production is impaired in the albino mutants, al-l, al-5 al-3. These mutants are defective in the carotenogenic enzymes phytoene dehydrogenase, phytoene synthetase and geranyl-geranyl pyrophosphate synthetase; the activities of these enzymes have been shown to be induced by blue light [8]. Recently al-l [9], al-2 [lo] and al-3 [ll, 121 genes have been isolated. We have shown that light activates the transcription of the al-3 gene in mycelia [13] and similar results have been obtained by Schmidhauser et al. with the al-l gene 191. It has been demonstrated that the photo-induced transcription of the al-1 and al-3 genes in mycelia is impaired in wcI and WC-~ mutants [9, 11, 131. In the present study we analysed the regulation of al-3 gene expression in mature conidia where the accumulation of carotenoid pigments has been considered unaffected by light exposure. The data presented in this communication indicate that al-3 gene expression is also light-regulated in mature conidia. Under blue-light illumination we observed that the al-3 mRNA is rapidly accumulated in wild-type (wt) but not in wc1 and WC-~ conidia. The observation that blue-light and WC gene products control al3 gene expression in mycelial and conidial cells suggests that the photoreceptor and the signal transduction system are the same in both cell types.
2. Materials
and methods
2.1. Strains
The following N. crassa wild type (wt) and mutant strains were obtained from the Fungal Genetics Stock Center (FGSC, University of Kansas, KS): Oak Ridge wt 74-OR23A (FGSC no. 987) WC-I (MK2; FGSC no. 4403) WC-~ (ER33; FGSC no. 4407). Stocks of conidia were stored frozen in double-distilled water. 2.2 Growth
and photoinduction
conditions
Conidia were innoculated at 4X lo6 cells in 100 ml solid Vogel minimal medium [14] plus 2% sucrose and incubated in the dark at 30 “C for 4 or 8 d. Conidia were harvested in the dark by double filtration through glass wool, collected by centrifugation in Falcon tubes and finally resuspended in 50 ml of distilled water ((2-3) x lo7 cells ml-‘). The purity of the conidia preparations was checked under the light microscope. Mature conidia represented more than 99% of the preparations. White-light induction was performed directly in Falcon tubes with 12 Sylvania GRO-LUX F 18W-GRO lamps. Blue-light induction was performed in the same tubes with a slide projector equipped with a Roscolux Blue N. 83 filter (wavelength range, 30&500 nm). Lightinduced and dark-incubated conidia were collected by centrifugation and immediately frozen in liquid nitrogen. 2.3. RNA
extractions
and Northern
hybridizations
Frozen conidia were powdered in a mortar cooled with liquid nitrogen. Total RNA was extracted, electrophoresed and hybridized as described previously [13]. For electrophoresed on 1.2% Northern blot analysis, total RNA (4 pg) was denatured, agarose-1.9% formaldehyde gels and transferred on to Hybond-N membranes (Amer-
235
sham). Each set of samples was run in duplicate in the same gel and hybridized either to the specific oligonucleotide probe for the al-3 mRNA, or to IF2 cDNA probe, as a control. The (S’ACGGCCATGGTGACGTGTTCCATITCC3’) al-3 oligo is a 27mer complementary to the al-3 mRNA around the translation initiation site [12]. The IF2 cDNA was obtained from the screening of a N. crussu cDNA library [12]. In the case of oligonucleotide probe, filters were hybridized at 50 “C in 5 X SSC, 5 X Denhardt’s solution, 50 mM sodium phosphate pH 7.0, 0.5% SDS, 50 Fg ml-’ denatured herring sperm DNA, 5X lo6 cpm ml-’ of probe for 18 h; the filters were washed at 50 “C in 1 x SSC, 0.1% SDS for 30 min. In the case of IF2 probe, filters were hybridized at 42 “C in 6XSSPE (1 XSSPE is 0.18 M NaCl, 0.01 M sodium phosphate (pH 7.7) 1 mM EDTA), 1 XDenhardt’s solution (0.02% bovine serum albumin (BSA), 0.02% Ficoll, 0.02% polyvinyl pyrrolidone), 50% formamide, 5% dextran sulphate, 0.1% sodium dodecyl sulphate (SDS), 200 pg ml-’ denatured herring sperm DNA, 2~ lo6 cpm ml-’ of probe for 18 h; the filters were washed at 48 “C in 0.1 X SSC (1 XSSC is 0.15 M NaCl, 0.015 M Na citrate pH 7.0) 0.1% SDS for 30 min. Filters were autoradiographed with preflashed Hyperfilm-MP film (Amersham) in the presence of intensifying screens (Cronex Quanta III, Du Pont Co.)
3. Results To study the expression of the al-3 gene in conidia, we harvested mature ungerminated conidial cells (free of conidiophore structures) from solid media cultures of N. crussu grown in the dark for 8 d. The isolated conidia suspensions were then illuminated for 0, 15 or 30 min with white light, under the same conditions used for the photoinduction of al-3 gene expression in mycelia as described in [13]. Total RNA was then extracted and hybridized with a specific oligonucleotide probe for the al-3 gene [13]. Although dark-grown conidia are pigmented, Northern blot analysis revealed that the al-3 mRNA level is not detectable in this dark-grown cell type (Fig. 1, lane 1). Similar results have been obtained with younger conidia harvested from cultures grown for 4 d (data not shown). The steady-state level of the al-3 mRNA increases in wt conidia illuminated for 15 and 30 min (Fig. 1, lanes 2 and 3), indicating that the expression of the al-3 gene is under light control also in this cell type. The rapid accumulation of the al-3 mRNA in conidia is similar to that observed in mycelia [13]. To test whether a blue-light photoreceptor is active in conidia, we have used a blue-light source to induce the expression of the al-3 gene. Figure 2 shows that the al-3 mRNA level increases in mature ungerminated conidia exposed to the blue component of the light spectrum. We further analysed the expression of the al-3 gene in WC-~ and WC-~ strains and the results are shown in Fig. 3. The accumulation of the al-3 mRNA was detected only in the case of irradiated wt conidia. The lack of al-3 mRNA accumulation in the “blind” mutants indicates that the products of WC-I and WC-~ genes also play an essential role in this light response.
4. Discussion Carotenoids are common pigments synthetized by all photosynthetic organisms and by many fungi and bacteria. In fungi, they help to protect the organism from photooxidative damage [3]. In N. crussu carotenogenesis is induced by blue light in
236
Fig. 1. Northern (RNA) blot showing the expression of the al-3 gene in dark-grown and in white-light-induced conidia. Total RNA was prepared from wt conidia. Samples (4pg) of each RNA were separated on an agarose-formaldehyde gel and hybridized to al-3 specific probe. The time of light induction is indicated as 0, 15 or 30 min. Control hybridizations showed that IF2 mRNA, which is not light regulated [13], was present in similar amounts in each mRNA preparation. Fig. 2. Blue-light induction of the al-3 gene. Wt conidia were collected from dark-grown cultures, and the RNA was prepared from conidia kept in the dark (D) or exposed to blue-light for 15 min (BL). Other experimental conditions as in Fig. 1. The position of the small ribosomal RNA is indicated by an asterisk.
Fig. 3. Expression of the al-3 gene in conidia of WC-I and WC-2mutants. Wt and mutant conidia (WC-I and WC-~respectively) were collected from dark-grown cultures, and the RNA was prepared from conidia kept in the dark (D) or exposed to light for 15 min (L). Other experimental conditions as in Fig. 1. mycelia and this phenomenon cloned the al-3 gene, coding acterized the photoregulation In the present study we stage of N. crassa. Conidia and protein synthesis [16]. light induction and for this
has been extensively studied [15]. We have previously for geranyl-geranyl pyrophosphate synthetase, and charof its expression in mycelia [ll-131. analysed al-3 gene expression in conidia, a developmental are quiescent cells with a low rate of metabolic activity Carotenoid accumulation in conidia takes place without reason it has been suggested that carotenoid biosynthesis
237 is constitutive
in this cell type. We have found that the al-3 mRNA level is undetectable in mature conidia obtained from cultures dark-grown for 4 and 8 d. The lack of al3 mRNA accumulation suggests that bulk carotenoid biosynthesis precedes the formation of mature conidia. Schmidhauser et al. have recently reported that al-I and al-2 genes are expressed during conidiogenesis [9], and it is therefore conceivable that carotenoid biosynthesis may start at this stage. Furthermore, in this work we have shown that al-3 gene expression is rapidly induced by light in mature conidia. As in mycelia, this activation is mediated by the blue portion of the light spectrum and requires the products of both the WC genes. These results suggest that conidia and mycelia share the same signal transduction pathway and photoreceptor. We therefore propose that the expression of carotenoid biosynthetic genes is always regulated by light during vegetative growth (mycelia and conidia). A developmental signal, acting during the differentiation from aerial hyphae to conidia, allows carotenoid accumulation in darkgrown asexual spores. Conidiospores are produced not only as agents of dispersion but also as stress-resistant forms. Their morphogenesis ultimately consists in the acquisition of thick walls and pigmentation that confer resistance to drought-, salt-, heat- and light-stresses. Plesofsky-Vig and Brambl [17] have studied the heat shock response of Neurospora. They established that conidiospores respond to severe temperature shift, rapidly inducing the synthesis of heat shock proteins, such as hsp83 and hsp30 [17]. Blue-light irradiation of N. crussa conidia produces singlet molecular oxygen and superoxide which ultimately lead to lipid peroxidation and cellular damage [18, 191. Similarly, the rapid photo-induction of al-3 gene expression and the putative
light-induced overaccumulation of carotenoids in conidia could be seen as part of a stress response system. This could help to sustain the conidia in adverse environmental conditions. Acknowledgments
We wish to thank Paola Ballario for critical reading of this manuscript and Giuseppe Crocchioni for skilled technical assistance. This work was supported by Piano Nazionale Sviluppo di Tecnologie Avanzate Applicate alle Piante, Minister0 Agricoltura e Foreste and by Istituto Pasteur -Fondazione Cenci Bolognetti. References C. M. Leach, Interaction of near-ultraviolet light and temperature on sporulation of the fungi Altemaria, Cercosporella, Fusarium, Helminthosporium and Stemphylium, Can. J. Bot., 4.5 (1967) 1999-2016. T. Kumagai, Blue and ultraviolet reversible photoreaction in conidial development of certain fungi, in H. Senger (ed.), The Blue Light Syndrome, Springer, Berlin, 1980, pp. 251-260. R. W. Harding and W. Shropshire, Jr., Photocontrol of carotenoid biosynthesis, Annu. Rev. Plant Physiol., 31 (1980) 217-238. J. F. Feldman, Genetic approaches to circadian clocks, Annu. Rev. Plant PhysioZ., 33 (1982) 583608. E. Kiemm and H. Ninnemann, Correlation between absorbance changes and a physiological response induced by blue light in Neurospora, Photochem. Photobiol., 28 (1978) 227-230. F. Degh Innocenti, U. Pohl and V. E. A. Russo, Photoinduction of protoperithecia in Neurospora crassa by blue light, Photochem. Photobiol., 37 (1983) 49-51. F. Degli Innocenti and V. E. A. Russo, Genetic analysis of blue light-induced responses in Neurospora crassa, in H. Senger (ed.), Blue light effects in biological systems, Springer, Berlin, 1984, pp. 213-219.
238 8 R. W. Harding and R. Turner, Photoregulation of the carotenoid biosynthesis pathway in albino and white collar mutants of Neurospora crassa, Plant Physiol., 68 (1981) 745-749. 9 T. J. Schmidhauser, F. K. Lauter, V. E. A. Russo and C. Yanofsky, Cloning, sequence, and photoregulation of al-l, a carotenoid biosynthetic gene of Neurospora crassa, Mol. Cell. Biol., 10 (1990) 5064-5070. 10 T. J. Schmidhauser, personal communication, 1991. 11 M. A. Nelson, G. Morelli, A. Carattolli, N. Roman0 and G. Macino, Molecular cloning of a Neumspora crassa carotenoid biosynthetic gene (albino-3) regulated by blue light and the products of the white collar genes, Mol. Cell. Biol., 9 (1989) 1271-1276. 12 A. Carattoli, N. Romano, P. Ballario, G. Morelli and G. Macino, The Neurospora crassa carotenoid biosynthetic gene (albino 3) reveals highly conserved regions among prenyltransferases. J. Biol. Chem., 266 (1991) 5854-5859. 13 S. Baima, G. Macino and G. Morelli, Photoregulation of the albino-3 gene in Neurospora crassa, J. Photochem. Photobiol. B: Biol., 11 (1991) 107-115. 14 H. J. Vogel, Distribution of lysine pathways among fungi: evolutionary implications. Am. Nat., 98 (1964) 435-446. 15 W. Rau and U. Mitzka-Schnabel, Carotenoid synthesis in Neurospora crassa, Methods Enzymol., I10 (1985) 253-267, and references cited therein. 16 A. Bonnen and R. Brambl, Germination physiology of Neurospora crassa conidia, Exp. Mycol., 7 (1983) 197-207. 17 N. Plesofsky-Vig and R. Brarnbl, Two developmental stages of Neurospora crassa utilize similar mechanisms for responding to heat shock but contrasting mechanisms for recovery, Mol. Cell. Biol., 7 (1987) 3041-3048. 18 M. Shimizu, T. Egashira and U. Takahama, Inactivation of Neurospora Crassa conidia by singlet molecular oxygen generated by a photosensitized reaction, J. Bacterial., 138 (1979) 293-296. 19 U. Takahama, M. Shimizu-Takahama and T. Egashira, Reduction of exogenous cytochrome c by Neurospora crassa conidia: effects of superoxide dismutase and blue light, J. Bacferiol., 152 (1982) 151-156.
