Arch Virol DOI 10.1007/s00705-014-2138-8
BRIEF REPORT
Phylogenetic and recombination analysis of the homing protein domain of grapevine fanleaf virus (GFLV) isolates associated with ‘yellow mosaic’ and ‘infectious malformation’ syndromes in grapevine Toufic Elbeaino • Hulusi Kiyi • Reza Boutarfa • Angelantonio Minafra • Giovanni Paolo Martelli Michele Digiaro
•
Received: 7 February 2014 / Accepted: 29 May 2014 Ó Springer-Verlag Wien 2014
Abstract The RNA2 of seven grapevine fanleaf virus (GFLV) isolates from vines with yellow mosaic (YM) symptoms from different origin were sequenced. These sequences showed a high variability in the homing protein (2AHP) and, in five of them, a putative recombination with arabis mosaic virus (ArMV) was detected. To investigate recombination frequency, the partial sequences of the 2AHP of 28 additional GFLV isolates from nine different countries, showing either YM or infectious malformations (MF) symptoms, were obtained and compared with those of GFLV isolates from GenBank. The analysis confirmed the high level of sequence variability (up to 41 % at the nucleotide level) among isolates. In phylogenetic trees constructed using different approaches, the sequenced isolates always clustered in four conserved groups, three of which comprised YM strains (groups 1, 2 and 3), and one (group 4) the MF strains. Potential interspecific recombination sites between GFLV and ArMV were predicted in the 2AHP gene of several isolates, all of which were associated with YM symptoms.
T. Elbeaino (&) H. Kiyi R. Boutarfa M. Digiaro Istituto Agronomico Mediterraneo di Bari, Via Ceglie 9, 70010 Valenzano, Bari, Italy e-mail: [email protected] A. Minafra Istituto di Virologia Vegetale del CNR, sezione di Bari, Via Amendola 165/A, 70126 Bari, Italy G. P. Martelli Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Universita` degli Studi di Bari, Via Amendola 165/A, 70126 Bari, Italy
Infectious degeneration, one of the most relevant and widespread virus diseases of grapevine, is characterized by two distinct field syndromes, known as infectious malformations (MF) and yellow mosaic (YM) [13], which are induced, respectively, by distorting and chromogenic strains of grapevine fanleaf virus (GFLV), a member of the genus Nepovirus, family Secoviridae [26]. As repeatedly reviewed (see, among others, refs. [2] and [19]), the GFLV genome is made of two separately encapsidated positivesense, single-stranded RNA molecules. RNA-1 is 7,342 nt long and has a single ORF of 6,885 nt coding for a 253-kDa polypeptide (P1), which is cleaved by the viral proteinase into five individual proteins, i.e., proteinase cofactor (1A), helicase (1BHel), genome-linked protein (1CVPg), proteinase (1DPro) and RNA-dependent RNA polymerase (1EPol). RNA-2 is 3,774 nt long and has a single ORF of 3,330 nt coding for a 122-kDa polypeptide (P2), which is cleaved into three individual mature products, i.e., the homing protein (2AHP), which is required for RNA2 replication, the movement protein (2BMP), and the coat protein (2CCP). Both RNAs are polyadenylated at their 30 end and have a small protein (VPg) covalently linked to their 50 end. Like other RNA viruses infecting perennial crops, GFLV has great potential for genetic variation because host plants remain infected for a long time and the viral genome is subjected to high mutation rates due to the lack of proofreading activity of RNA polymerases [8]. Thus, each GFLV isolate consists of a population of genetically related variants [18]. Sequence comparisons revealed that GFLV 2AHP is not as genetically conserved as proteins 2BMP and 2CCP, has a variable size (765-774 nt) and a high amino acid diversity (up to 15 %) [23, 32]. The genetic variability of GFLV isolates, particularly at the 2AHP level, was reported as possibly responsible for the range of symptoms expressed by infected vines [18, 30]. RNA recombination,
123
T. Elbeaino et al. Table 1 List of primers used in RT-PCR to amplify RNA2 of GFLV isolates of this study
s, sense; a, antisense; S, C/G; Y, C/T; R, A/G; W, A/T; N, A/C/ G/T; V, G/C/A
Primer
Primer sequence (50 -30 )
Position (nt)
Size (bp)
HP1-s
CAGGCGNCTNGCCTGYTGGGC
1-21
469
HP1-a
TTCGGCAAASAGTGCCGCAGCT
448-469
HPRi-s
AGCTGCGGCACTSTTTGCCGAA
448-469
MPRi-a
CCCATCATAGTRGCCCTGAG
1580-1599
MPRi-s
CTCAGGGCYACTATGATGGG
1580-1599
998
CPRi-a
TCCATNGTGGTCCCGTYCCACWC
2556-2578
CPRi-s
GWGTGGRACGGGACCACNATGGA
2556-2578
968
OligodT
TTTTTTTTTTTTTTTTTTTTV
NCR2 s
GCGAAGAGTTTAAGAAACTCA
108-128
593
HP1-a
TTCGGCAAASAGTGCCGCAGCT
448-469
one of the mechanisms that may drive genetic variation and evolution of plant viruses [8, 33], is very common with GFLV, as substantiated by the many cases of intraspecies [18, 23, 31] and interspecies recombination events [10, 17, 19, 32] reported in the literature. In GFLV, recombination involves preferentially the 50 -proximal region of RNA-2, and more rarely, the 30 -terminal region, which comprises the CP cistron [32]. An exception is the case of grapevine deformation virus (GDeV), which apparently originated from interspecific recombination between GFLV and ArMV at the CP level [6]. Even though a large number of sequenced GFLV isolates are available in GenBank, for most of them little is known about the symptoms they induce on grapevines. Consequently, it is difficult to establish possible correlations between YM or MF syndromes with genomic features of their causal agents. In this study, the complete RNA2 coding region (RNA2CR) and the 30 non-coding region (NCR) of seven GFLV isolates associated with YM-affected vines of different geographical origins were sequenced and compared with the RNA2 sequences of several GFLV isolates from GenBank. The evidence of interspecific recombination events with ArMV in five of them at the 2AHP level suggested that it was necessary to extend the investigation to a larger number of GFLV isolates and to analyze in more detail the possible implication of recombination in the YM syndrome. The GFLV isolates utilised in this study came in part from vineyards in Apulian (southern Italy) and in part from the collection plots of the Mediterranean Agronomic Institute of Bari (MAIB) and of the Experimental Farm of the Faculty of Agriculture of the University of Bari (UBA), where GFLV isolates from different countries are maintained. Mature canes were collected from 22 vines from Bulgaria (Bu25YM), Greece (Gr11YM), Hungary (Hu26MF), Italy (It17YM, It19YM, It20YM, It21YM, It24YM, It31YM, It34YM, It35YM, It36MF), Romania (Rom2YM), Russia (Urs11YM), Tunisia (Tu7YM, Tu14YM, Tu27MF), Turkey
123
1151
(Tk1MF, Tk4MF, Tk5MF, Tk55YM) and the USA (USA11YM) showing either YM or MF symptoms. Samples were stored for three weeks at 4 °C, forced in a greenhouse at 24-25 °C and then checked for the presence of GFLV and ArMV by DAS-ELISA [4] using commercial kits (Agritest, Italy). The RNA2 sequences of several GFLV isolates were retrieved from GenBank (NCBI) and aligned, and the highly conserved genomic areas in 2AHP, 2BMP, and 2CCP were selected for designing primers (Table 1). Because of the high variability existing at the 2AHP gene level, a second forward primer (NCR2s) was designed in a conserved area in the 50 NCR to detect isolates that were not amplified by the first set of primers. Total nucleic acids (TNA) were extracted from 100 mg of leaves according to Foissac et al. [7]. First-strand cDNA was synthesized using 1 lg of TNA extracts, 0.1 lg of random hexamer primers (Roche Diagnostics, Italy) and 200 units of Moloney murine leukaemia virus (MMLV) reverse transcriptase following the manufacturer’s instructions (Life Technologies, Italy). A cDNA mixture (2.5 ll) was subjected to PCR amplification in a 25-ll reaction mixture containing 1X Taq polymerase buffer (Promega, USA), 1 lM MgCl2, 0.5 mM dNTPs, 0.25 ll of Taq polymerase (5 U/ll) and 0.2 lM each pair of sense and anti-sense primers. PCR amplification consisted of an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 35 s, 52 °C for 45 s and 72 °C for 50 s. PCR products were electrophoresed in 6 % polyacrylamide gels and visualized by silver nitrate staining. The presence of more than one GFLV isolate in infected grapevine sources was investigated by single-strand conformation polymorphism assay (SSCP). An aliquot (3 ll) of the PCR product generated from cDNA or DNA recombinant plasmids was added to 3 volumes of loading buffer prior to denaturation [16]. Denatured ssDNAs of the amplified GFLV-2AHP fragment were subjected to electrophoresis in a non-denaturing 10 % polyacrylamide gel [12]. DNA conformation patterns were visualized by silver
Homing protein domain of grapevine fanleaf virus
staining. In the case of multiple DNA conformation patterns, further amplifications of recombinant DNA were made, and the products were subjected to a new SSCP analysis. Finally, representatives of each SSCP pattern were sequenced. All PCR amplicons were ligated in StrataCloneTM PCR Cloning vector pSC-A (Stratagene, USA), subcloned into Escherichia coli SoloPACK cells and custom sequenced (Primm, Italy). Nucleotide and protein sequences were analysed with the assistance of the DNA Strider 1.1 program [11]. Search for homologies with proteins from the Protein Information Resources database (PIR, release 47.0) was done with the programs FASTA [21], BlastX and BlastP [1]. For phylogenetic analysis, nucleotide and amino acid sequences were aligned using MUSCLE [5], and trees supported by bootstrapping were generated by the maximum-parsimony, maximum-likelihood and standard neighbour-joining methods [22], applying the JTT matrix and pairwise gap deletion options implemented in MEGA 5.05 [29]. Branches with less than 50 % bootstrap support were collapsed. The aligned sequences of the complete RNA2-CR of seven YM-GFLV isolates and, subsequently, of the 2AHP domain of 21 GFLV isolates (either YM or MF) were checked using RDP3 [15], which allows sequence analysis for recombination using seven different detection methods: the original RDP, BOOTSCAN/RECSCAN [14, 15, 25], GENECONV [20, 27], MaxiChi [24, 28], Chimaera [24], Siscan [9] and 3SEQ [3]. ELISA confirmed the presence of GFLV in the totality of the 22 samples analysed, none of which was positive for ArMV. The sets of primers designed in the conserved regions of GFLV-RNA2 successfully amplified the entire 2AHP, 2BMP, 2CCP and the 30 NCR from the entire set of tested samples. The RNA2-CR and the 30 NCR of seven GFLV-YM isolates (It20, It21, It24, It34, Tk55, Urs11 and USA11) were sequenced completely. The CR length ranged from 3324 to 3348 nt, whereas the 30 NCR, excluding the poly(A) tail, ranged from 210 to 213 nt. The comparison with comparable GenBank sequences of 35 other GFLV isolates using the BLAST algorithm revealed an overall nucleotide sequence identity from 79 to 99 %. Maximum-likelihood phylogenetic trees with 1000 bootstrap replicates generated from the complete RNA2-CR sequences of the 42 isolates revealed segregation into at least eight distinct clades (Fig. 1). Of the YM isolates sequenced in the present study, four (Urs11, Tk55, It20-7 and It34) grouped together with the French isolate A17d and the American isolate WACF2142, two (USA11 and It24) clustered with several Slovenian and French isolates, and isolate It21 clustered with the Slovenian isolate Vol57c5 (Fig. 1). Analyzing the nucleotide sequences of the different domains in the RNA2-CR separately, 2AHP
appeared to be the most variable (up to 33 % divergence), followed by 2BMP (up to 22 %) and 2CCP (up to 16 %). Interestingly, the 2AHP of some of the GFLV isolates under study showed a nucleotide sequence identity level with ArMV that was higher than that with GFLV isolates from GenBank, suggesting that interspecific recombination events had occurred in 2AHP. Recombination analysis using the RDP3 program predicted the occurrence of potential interspecies recombination events in five isolates (It20, It21, It34, Tk55, and Urs11) out of the seven sequenced in this study, having ArMV as minor parent. In all these cases, the crossover region was localised in 2AHP and involved the N-terminus, comprising the first 444 nt (Table 2). This result prompted a further analysis for recombination on a subset of 15 GFLV isolates (nine YM and six MF), which were also sequenced in the course of this study. These 15 additional GFLV isolates were sequenced only in the region of the N-terminus of 2AHP (469 bp), which has been shown to be more frequently involved in this phenomenon. Electropherograms of SSCP analysis of infected grapevine samples revealed different haplotype patterns and lengths of the viral fragments, indicating that, in at least six cases, two different viral molecular variants co-existed in the same vine (It17 [It 17-1 and It17-2], It20 [It20-4 and It20-7], It21 [It21-1 and It21-3], It35 [It35-2 and It35-3], It36 [It36-2 and It36-3], Tk4 [Tk4-15-1 and Tk4-15-2]). More often, the nucleotide sequences of molecular variants from the same plant varied by a few nucleotides only and therefore clustered closely in the phylogenetic tree. In other instances, e.g., It20 and It21, variants from the same vine had a sequence divergence wide enough to separate them from each other in the phylogenetic tree. This may be the outcome of subsequent infections by different isolates following grafting or transmission by nematode vectors. The six isolates identified in mixed infections using SSCP analysis were also cloned and sequenced, thus bringing to 28 the total number of isolates with sequenced 2AHP. When the 2AHP amino acid sequences were aligned, they assembled in distinct groups characterized by the presence of different conserved blocks of residues (Fig. 2). Marked differences were found between groups 1, 2 and 3, comprising YM isolates, and group 4, comprising MF isolates. The MF group was compact and characterized by the occurrence of some exclusive conserved residue blocks (e.g., at position 13-15 [AxC], 20-21 [GR], 32 [C], 39-40 [KE], 59-74 [ExPxxRxxxEGxAGxA], and 80-88 [HxHTLGLVP]) that were absent in YM isolates. By contrast, YM isolates clustered in three different groups (1, 2 and 3) based on the types of residue blocks that were conserved only in some isolates. For example, group 2, including isolates Rom2, It19 and It21, showed characteristic conserved
123
T. Elbeaino et al. 0.05
1000
1000
ArMV-TA ArMV-NW 3138-07 WAME1492 837 1000 SAPC53 SACH44 870 1000 WAPN8133 WAPN173 826 984 WAPN57 CAZINA1 970 CACSC1 757 863 CACSC2 CAZINA4 992 F13 1000 1000 CACSB5 776 Nw Usa11 Vol45c1 Vol50c2 1000 885 1000 Vol47c1 It24 B19a A10a 972 1000 A17a 787 WACF2142 943 Urs11 A17d It34 757 903 Tk55 815 It20 885 WACH911 WAPN165 1000 1000 WAPN6132 870 Vol57c5 It21 752 1000 Urmia Shir-Amin Takestan 1000 Bonab 1000 Ghu 999 CACSC3 1000 CACSB3 CAZINA3 1000 CACSC4 1000 GDefV
Fig. 1 Phylogenetic tree generated by the maximum-likelihood method from the nucleotide sequence alignment of the complete RNA2 coding region of GFLV isolates considered in this study, together with homologue sequences of GFLV, ArMV and GDeV retrieved from GenBank. The accession numbers of the sequences that were used are as follows: ArMV (Ta [EF426853], NW [AY017339]); GFLV (3138-07 [JX559643], WAME1492 [GQ332370], SAPCS3 [JF968121], SACH44 [KC900163], WAPN8133 [GQ332369], WAPN173 [GQ332368], WAPN57 [GQ332367], CAZINA1 [GU972571], CACSC1 [GU972581], CACSC2 [GU972582], CAZINA4 [GU972574], F13 [NC_003623], CACSB5 [GU972580], Nw [AY017338], Vol45c1 [DQ922652],
Vol50c2 (DQ922661), Vol 47c1 (DQ922653), B19a (AY780903), A10a (AY780902), A17a (AY780899), WACF2142 [GQ332371], A17d [AY780901], WACH911 [GQ332364], WAPN165 [GQ332365], WAPN6132 [GQ332366], Vol57c5 [DQ922678], Urmia [JQ071375], Shir-Amin [JQ071374], Takestan [JQ071377], Bonab [JQ071376], Ghu [EF426852], CACSC3 [GU972583], CACSB3 [GU972578], CAZINA3 [GU972573], CACSC4 [GU972584]); GDeV [NC_017938]. The accession numbers for the GFLV isolate sequenced in this study are USA11 (HG939481), It24 (HG939478), Urs11 (HG939482), It34 (HG939479), Tk55 (HG939483), It20 (HG939477), and It21 (HG939480). Bootstrap values are shown at branch nodes
residues at positions 13-20 (VxxQAQSR), 26 (Y), 32-56 (CxSGxSAxxAExxARxxKxxSLERV), 63-94 (PxxQxxTE CxITPGGIxxExxTxxTTxTSRVV) and 104 (H) (Fig. 2). The same amino acid blocks were common to the Iranian isolates Bonab and Takestan, which came from
vines with vein banding symptoms [34]. The amino acid block at position 96-119 of group 3 (QxxxxPx VxxxxxxxMxRxxxxP), which was suggested by Jawhar et al. [10] as potentially characterizing the YM strains (YM5, YM7 and YMC1) and was common to some
123
Homing protein domain of grapevine fanleaf virus Table 2 Recombination crossover events in 2AHP of GFLV isolates detected using the Recombination Detection Program (RDP3) Isolates
Reference
Nt. position in 2AHP
Parental isolates (Major 9 minor)
RDP3 (P-value) *
Urs11
This study
107-440
GFLV-F13 9 ArMV-Ta
RGBMC3 sS (5.397 9 10-11/2.301 9 10-3)
Tk55
This study
271-444
GFLV-F13 9 ArMV-Ta
RGBMC3sS (4.965 9 10-12/5.515 9 10-3)
It34
This study
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (4.512 9 10-15/2.329 9 10-7)
It20-7
This study
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (4.512 9 10-15/2.329 9 10-7)
YM7-YM5 - YMC1
(Jawhar et al., 2009)
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (2.418 9 10-06/1.292 9 10-2)
Rom2
This study
58-161
GFLV-IT31-3 9 ArMV-U
RGBMC3sS (1.298 9 10-05/1.529 9 10-3)
It19
This study
58-161
GFLV-IT31-3 9 ArMV-U
RGBMC3sS (1.298 9 10-05/1.529 9 10-3)
It21
This study
41-138
GFLV-F13 9 ArMV-U
RGBMC3sS (1.606 9 10-12/4.865 9 10-2)
Bonab/Takestan
(Zarghani et al., 2013)
46-168
GFLV-F13 9 ArMV-U
RGBMC3sS (3,.770 9 10-14/4.956 9 10-3)
*RDP3-implemented methods supporting the corresponding recombination sites: R (RDP), G (GENECONV), B (BOOTSCAN), M (MAXCHI), C (CHIMAERA), 3Seq (3s) and S (SISCAN). The reported P-values within brackets are the highest and lowest P-values among those calculated using RDP3-implemented methods, and the corresponding methods are shown in italic and bold, respectively
Fig. 2 Amino acid sequence alignment of the 2AHP (partial) of GFLV isolates showing groups of variants found between the isolates analyzed in this study and other GFLV isolates (YM-5, YMC1, YM7,
Bonab and Takestan [10, 34]) associated with YM symptoms. Points indicate conserved amino acids
ArMV isolates, was also found in four additional YM isolates (It34, It20, Tk55 and Urs11) in this study (Fig. 2).
Sequences of the 2AHP gene of the isolates under study were used for constructing a phylogenetic tree. As shown in Fig. 3, there was a clear-cut separation of YM and MF
123
T. Elbeaino et al. Fig. 3 Phylogenetic tree generated by the maximumlikelihood method based on amino acid sequences of partial 2AHP domains of GFLV isolates analyzed in this study (accession numbers: HG421746 to HG421770 and HG939477 to HG939483), together with homologue sequences of GFLV and ArMV retrieved from GenBank (accession numbers: ArMV (Nar [AB279740], Lil [AB279741], NW [AY017339], Ta [EF426853]); GFLV (F13 [NC_003623], YM7 [FJ531806], YMC1 [FJ531814], YM5 [FJ531801], Urmia [JQ071375], Shir-Amin [JQ071374], Takestan [JQ071377], Bonab [JQ071376]). Bootstrap values are shown at branch nodes. YM yellow mosaic, MF malformation, VB vein banding
0.05
ArMV-Nar ArMV-Lil It35-3 YM UrmiaYM 1000 Shir-AminYM F13 781 YM Tu14 810 YM Tu7 755 Bu25YM USA11YM 798 Group 1 It35-2 YM 768 It21-3 YM 800 It31 YM 1000 1000 Gr11YM It24 YM It17-2 YM 833 986 It17-1 YM YM Urs11 It34 YM 788 YM7YM 863 YMC1 YM 964 YM Group 2 876 YM5 810 ArMV- Ta
1000 999
873
ArMV- NW Tk55YM
830
It20-7 YM TakestanVB/YM 998 BonabVB/YM Rom2YM 1000 YM 1000 It19 It21-1 YM It36-3 MF It36-2 MF MF Tk1 It20-4 Tk5MF Tk4-15-2MF Hu26MF Tu27MF 999 Tk4-15-1MF
984
1000
1000
1000
1000 871
968 977
isolates, the former clustering in three groups (groups 1, 2 and 3) distinct from group 4, which included only MF strains. The presence of YM isolate It20-4 in the MF group is apparently incongruent. However, since It20-4 is one of the two isolates whose presence in the same vine was revealed by SSCP analysis (isolate It20-7 belongs to group 2), it could be hypothesized that It20-4 is in fact an MF isolate and that the YM symptoms observed in the field were caused by It20-7. The co-existence of YM and MF
123
Group 3
Group 4
symptoms in a single vine is not rare [13], this perhaps being one of those cases. The presence of some ArMV isolates clustering close to or within group 2 is not surprising because recombination events between GFLV and ArMV at the level of the 2AHP gene have repeatedly been reported [10, 19, 32]. The distribution of our GFLV isolates and their clustering in distinct groups, shown in Fig. 3 (phylogenetic tree obtained by the maximum-likelihood method), was
Homing protein domain of grapevine fanleaf virus
homogeneous and substantially comparable with that shown by both trees generated for the 2AHP genes by the maximum-parsimony and neighbor-joining methods, using highly supported substitution models (data not shown). The nucleotide identity matrix of the 2AHP gene of the 28 viral isolates under study plus numerous additional isolates from GenBank showed a very high level of intergroup variability that, in some cases (e.g., between isolates of groups 2 and 4), reached 41 % and never fell below 31 % between MF (group 4) and the other YM isolates (groups 1, 2 and 3). Nucleotide sequence identity was also very low among YM isolates, in particular between isolates of group 3 and those of group 2 (62-64 %) and 1 (6468 %). Within individual groups, identity levels ranged from 22 % (group 4) and 15 % (groups 1 and 2) to 12 % (group 3). The variability determined in this study was much higher than that (15 %) reported previously [23]. This marked difference can be explained by (i) the larger number of isolates investigated in this study, (ii) the inclusion of a number of GFLV/ArMV recombinants, and (iii) the smaller (469 bp vs 765-774 bp) but more variable 2AHP area explored. The nucleotide sequences of 2AHP of several GFLV isolates, in particular those included in groups 2 and 3, were more closely related to some ArMV isolates (up to 88 % nt sequence identity) than to GFLV (less than 86 %), suggesting the presence of potential recombination events between GFLV and ArMV. This was also confirmed by the clustering of some ArMV isolates with GFLV isolates in group 2 (Fig. 3). Recombination analysis using the RDP3 program predicted the occurrence of potential interspecies recombination events in the 2AHP of GFLV isolates, with ArMV (NW, Ta, U isolates) and GFLV (F13, IT31-3) as putative parents. Interspecific recombination events were identified in at least seven YM isolates, four of them in group 2 (It34, It20-7, Tk55 and Urs11) and three in group 3 (It21, Rom2 and It19). It is noteworthy that the recombinant isolates of group 2 clustered with the three recombinants found in YM vines studied by Jawhar et al. [10]. Likewise, the recombinant isolates of group 3 clustered with two vein banding isolates (Bonab, Takestan) from Iran [34] in which the analysis conducted in this study predicted putative recombination events in 2AHP. Each of the aforementioned recombination sites was predicted by at least seven different methods included in the RDP3 software package (Table 2). RNA recombination is a natural mechanism involved in genetic variation and evolution of plant virus populations, and based on the results reported here and elsewhere [9, 18], 2AHP seems to be a ‘‘hot spot’’ for interspecies genetic exchanges between GFLV and ArMV, two closely related grapevine-infecting nepoviruses. The occurrence of GFLV/ArMV recombination events in 2AHP of viral isolates recovered consistently
from vines with YM symptoms (groups 2 and 3) and in none of those hosting MF isolates (group 4) may be taken as an indication that 2AHP is the genomic area involved in symptom expression. However, whether ArMV is the carrier of the information somehow responsible for the expression of YM in grapevines remains to be ultimately established by further studies because of the conflicting results provided by the recovery of non-recombinant isolates (group 1) from vines with YM symptoms. The construction of YM- and MF-GFLV infectious cDNA clones, their targeted manipulation and expression in grapevine seedlings could contribute to clarifying the role of 2AHP in infectivity and symptomatology.
References 1. Altschul SF, Stephen F, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410 2. Andret-Link P, Laporte C, Valat L, Ritzenthaler C, Demangeat G, Vigne E, Laval V, Pfeiffer P, Stussi-Garaud C, Fuchs M (2004) Grapevine fanleaf virus: Still a major threat to the grapevine industry. J Plant Path 86:183–195 3. Boni MF, Posada D, Feldman MW (2007) An exact nonparametric method for inferring mosaic structure in sequence triplets. Genetics 176:1035–1047 4. Clark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34:475–483 5. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797 6. Elbeaino T, Digiaro M, Ghebremeskel S, Martelli GP (2012) Grapevine deformation virus: completion of the sequence and evidence on its origin from recombination events between grapevine fanleaf virus and arabis mosaic virus. Virus Res 166:136–140 7. Foissac X, Svanella-Dumas L, Dulucq MJ, Gentit P, Candresse T (2001) Polyvalent detection of fruit tree tricho, capillo and fovea viruses by nested RT-PCR using degenerated and inosine containing primers (PDO RT-PCR). Acta Hortic 550:37–43 8. Garcı´a-Arenal F, Fraile A, Malpica JM (2001) Variability and genetic structure of plant virus populations. Ann Rev Phytopath 39:157–186 9. Gibbs MJ, Armstrong JS, Gibbs AJ (2000) Sister-scanning: a monte carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16:573–582 10. Jawhar J, Minafra A, La Notte P, Pirolo C, Saldarelli P, Boscia D, Savino V, Martelli GP (2009) Recombination events in RNA-2 of Grapevine fanleaf virus and Arabis mosaic virus in grapevines affected by yellow mosaic. In: Boudon-Padieu E. (eds) Extended abstracts 16th Meeting of International Council for the study of virus and virus-like diseases of the grapevine, Le Progre´s Agricole et Viticole, Dijon France, 73–74 11. Marck C (1988) DNA strider: a C programme for the fast analysis of DNA and protein sequences on the Apple Macintosh family computers. Nucleic Acids Res 16:1829–1836 12. Markoff A, Savov A, Vladimirov V, Bogdanova N, Kremensky I, Ganev V (1997) Optimization of single-strand conformation polymorphism analysis in the presence of polyethylene glycol. Clin Chem 43:30–33
123
T. Elbeaino et al. 13. Martelli GP, Boudon-Padieu E (2006) Infectious agents of grapevine. In: Directory of infectious diseases of grapevines, Options Me´diterrane´ennes, Se´rie B: Studies and Research, Bari, Italy, pp 15–38 14. Martin DP (2009) Recombination detection and analysis using RDP3. Methods Mol Biol 537:185–205 15. Martin DP, Williamson C, Posada D (2005) RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21:260–262 16. Martins-Lopes P, Zhang H, Koebner R (2001) Detection of single nucleotide mutations in wheat using single strand conformation polymorphism gels. Plant Mol Biol Rep 19:159–162 17. Mekuria TA, Gutha LR, Martin RR, Naidu RA (2009) Genome diversity and intra and interspecies recombination events in Grapevine fanleaf virus. Phytopathology 99:1394–1402 18. Naraghi-Arani P, Daubert S, Rowhani A (2001) Quasispecies nature of the genome of Grapevine fanleaf virus. J Gen Virol 82:1791–1795 19. Oliver JE, Vigne E, Fuchs M (2010) Genetic structure and molecular variability of Grapevine fanleaf virus populations. Virus Res 152:30–40 20. Padidam M, Sawyer S, Fauquet CM (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218–225 21. Pearson WR, Lipman DJ (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85:2444–2448 22. Perrie`re G, Gouy M (1996) WWW-Query: An on-line retrieval system for biological sequence banks. Biochimie 78:364–369 23. Pompe-Novak M, Gutie´rrez-Aguirre I, Vojvoda J, Blas M, Tomazˇicˇ I, Vigne E, Fuchs M, Ravnikar M, Petrovicˇ N (2007) Genetic variability within RNA2 of grapevine fanleaf virus. Eur J Plant Pathol 117:307–312 24. Posada D, Crandall KA (2001) Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc Natl Acad Sci USA 98:13757–13762
123
25. Salminen M, Carr J, Burke D, McCutchan F (1995) Identification of breakpoints in intergenotypic recombinants of HIV type 1 by Bootscanning. AIDS Res Hum Retrovir 11:1423–1425 26. Sanfac¸on H, Iwanami T, Karasev AV, Van der Vlugt R, Wellink J, Wetzel T, Yoshikawa N (2011) Family Secoviridae. In: King AMQ, Adams MJ, Carstend EB, Lefkowitz EJ (eds) Virus Taxonomy. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, San Diego, pp 881–899 27. Sawyer S (1989) Statistical tests for detecting gene conversion. Mol Biol Evol 6:526–538 28. Smith JM (1992) Analyzing the mosaic structure of genes. J Mol Evol 34:126–129 29. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 30. Terlizzi F, Biolchini L, Credi R (2004) Molecular characterization of Italian grapevine fanleaf virus isolates. J Plant Pathol 86:335 31. Vigne E, Bergdoll M, Guyader S, Fuchs M (2004) Population structure and genetic variability within isolates of grapevine fanleaf virus from a naturally infected vineyard in France: evidence for mixed infection and recombination. J Gen Virol 85:2435–2445 32. Vigne E, Marmonier A, Fuchs M (2008) Multiple interspecies recombination events within RNA2 of Grapevine fanleaf virus and Arabis mosaic virus. Arch Virol 153:1771–1776 33. Worobey M, Holmes EC (1999) Evolutionary aspects of recombination in RNA viruses. J Gen Virol 80:2535–2543 34. Zarghani SN, Shams-Bakhsh M, Bashir NS, Wetzel T (2013) Molecular characterization of whole genomic RNA2 from Iranian isolates of Grapevine fanleaf virus. J Phytopathol 161:419–425
BRIEF REPORT
Phylogenetic and recombination analysis of the homing protein domain of grapevine fanleaf virus (GFLV) isolates associated with ‘yellow mosaic’ and ‘infectious malformation’ syndromes in grapevine Toufic Elbeaino • Hulusi Kiyi • Reza Boutarfa • Angelantonio Minafra • Giovanni Paolo Martelli Michele Digiaro
•
Received: 7 February 2014 / Accepted: 29 May 2014 Ó Springer-Verlag Wien 2014
Abstract The RNA2 of seven grapevine fanleaf virus (GFLV) isolates from vines with yellow mosaic (YM) symptoms from different origin were sequenced. These sequences showed a high variability in the homing protein (2AHP) and, in five of them, a putative recombination with arabis mosaic virus (ArMV) was detected. To investigate recombination frequency, the partial sequences of the 2AHP of 28 additional GFLV isolates from nine different countries, showing either YM or infectious malformations (MF) symptoms, were obtained and compared with those of GFLV isolates from GenBank. The analysis confirmed the high level of sequence variability (up to 41 % at the nucleotide level) among isolates. In phylogenetic trees constructed using different approaches, the sequenced isolates always clustered in four conserved groups, three of which comprised YM strains (groups 1, 2 and 3), and one (group 4) the MF strains. Potential interspecific recombination sites between GFLV and ArMV were predicted in the 2AHP gene of several isolates, all of which were associated with YM symptoms.
T. Elbeaino (&) H. Kiyi R. Boutarfa M. Digiaro Istituto Agronomico Mediterraneo di Bari, Via Ceglie 9, 70010 Valenzano, Bari, Italy e-mail: [email protected] A. Minafra Istituto di Virologia Vegetale del CNR, sezione di Bari, Via Amendola 165/A, 70126 Bari, Italy G. P. Martelli Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Universita` degli Studi di Bari, Via Amendola 165/A, 70126 Bari, Italy
Infectious degeneration, one of the most relevant and widespread virus diseases of grapevine, is characterized by two distinct field syndromes, known as infectious malformations (MF) and yellow mosaic (YM) [13], which are induced, respectively, by distorting and chromogenic strains of grapevine fanleaf virus (GFLV), a member of the genus Nepovirus, family Secoviridae [26]. As repeatedly reviewed (see, among others, refs. [2] and [19]), the GFLV genome is made of two separately encapsidated positivesense, single-stranded RNA molecules. RNA-1 is 7,342 nt long and has a single ORF of 6,885 nt coding for a 253-kDa polypeptide (P1), which is cleaved by the viral proteinase into five individual proteins, i.e., proteinase cofactor (1A), helicase (1BHel), genome-linked protein (1CVPg), proteinase (1DPro) and RNA-dependent RNA polymerase (1EPol). RNA-2 is 3,774 nt long and has a single ORF of 3,330 nt coding for a 122-kDa polypeptide (P2), which is cleaved into three individual mature products, i.e., the homing protein (2AHP), which is required for RNA2 replication, the movement protein (2BMP), and the coat protein (2CCP). Both RNAs are polyadenylated at their 30 end and have a small protein (VPg) covalently linked to their 50 end. Like other RNA viruses infecting perennial crops, GFLV has great potential for genetic variation because host plants remain infected for a long time and the viral genome is subjected to high mutation rates due to the lack of proofreading activity of RNA polymerases [8]. Thus, each GFLV isolate consists of a population of genetically related variants [18]. Sequence comparisons revealed that GFLV 2AHP is not as genetically conserved as proteins 2BMP and 2CCP, has a variable size (765-774 nt) and a high amino acid diversity (up to 15 %) [23, 32]. The genetic variability of GFLV isolates, particularly at the 2AHP level, was reported as possibly responsible for the range of symptoms expressed by infected vines [18, 30]. RNA recombination,
123
T. Elbeaino et al. Table 1 List of primers used in RT-PCR to amplify RNA2 of GFLV isolates of this study
s, sense; a, antisense; S, C/G; Y, C/T; R, A/G; W, A/T; N, A/C/ G/T; V, G/C/A
Primer
Primer sequence (50 -30 )
Position (nt)
Size (bp)
HP1-s
CAGGCGNCTNGCCTGYTGGGC
1-21
469
HP1-a
TTCGGCAAASAGTGCCGCAGCT
448-469
HPRi-s
AGCTGCGGCACTSTTTGCCGAA
448-469
MPRi-a
CCCATCATAGTRGCCCTGAG
1580-1599
MPRi-s
CTCAGGGCYACTATGATGGG
1580-1599
998
CPRi-a
TCCATNGTGGTCCCGTYCCACWC
2556-2578
CPRi-s
GWGTGGRACGGGACCACNATGGA
2556-2578
968
OligodT
TTTTTTTTTTTTTTTTTTTTV
NCR2 s
GCGAAGAGTTTAAGAAACTCA
108-128
593
HP1-a
TTCGGCAAASAGTGCCGCAGCT
448-469
one of the mechanisms that may drive genetic variation and evolution of plant viruses [8, 33], is very common with GFLV, as substantiated by the many cases of intraspecies [18, 23, 31] and interspecies recombination events [10, 17, 19, 32] reported in the literature. In GFLV, recombination involves preferentially the 50 -proximal region of RNA-2, and more rarely, the 30 -terminal region, which comprises the CP cistron [32]. An exception is the case of grapevine deformation virus (GDeV), which apparently originated from interspecific recombination between GFLV and ArMV at the CP level [6]. Even though a large number of sequenced GFLV isolates are available in GenBank, for most of them little is known about the symptoms they induce on grapevines. Consequently, it is difficult to establish possible correlations between YM or MF syndromes with genomic features of their causal agents. In this study, the complete RNA2 coding region (RNA2CR) and the 30 non-coding region (NCR) of seven GFLV isolates associated with YM-affected vines of different geographical origins were sequenced and compared with the RNA2 sequences of several GFLV isolates from GenBank. The evidence of interspecific recombination events with ArMV in five of them at the 2AHP level suggested that it was necessary to extend the investigation to a larger number of GFLV isolates and to analyze in more detail the possible implication of recombination in the YM syndrome. The GFLV isolates utilised in this study came in part from vineyards in Apulian (southern Italy) and in part from the collection plots of the Mediterranean Agronomic Institute of Bari (MAIB) and of the Experimental Farm of the Faculty of Agriculture of the University of Bari (UBA), where GFLV isolates from different countries are maintained. Mature canes were collected from 22 vines from Bulgaria (Bu25YM), Greece (Gr11YM), Hungary (Hu26MF), Italy (It17YM, It19YM, It20YM, It21YM, It24YM, It31YM, It34YM, It35YM, It36MF), Romania (Rom2YM), Russia (Urs11YM), Tunisia (Tu7YM, Tu14YM, Tu27MF), Turkey
123
1151
(Tk1MF, Tk4MF, Tk5MF, Tk55YM) and the USA (USA11YM) showing either YM or MF symptoms. Samples were stored for three weeks at 4 °C, forced in a greenhouse at 24-25 °C and then checked for the presence of GFLV and ArMV by DAS-ELISA [4] using commercial kits (Agritest, Italy). The RNA2 sequences of several GFLV isolates were retrieved from GenBank (NCBI) and aligned, and the highly conserved genomic areas in 2AHP, 2BMP, and 2CCP were selected for designing primers (Table 1). Because of the high variability existing at the 2AHP gene level, a second forward primer (NCR2s) was designed in a conserved area in the 50 NCR to detect isolates that were not amplified by the first set of primers. Total nucleic acids (TNA) were extracted from 100 mg of leaves according to Foissac et al. [7]. First-strand cDNA was synthesized using 1 lg of TNA extracts, 0.1 lg of random hexamer primers (Roche Diagnostics, Italy) and 200 units of Moloney murine leukaemia virus (MMLV) reverse transcriptase following the manufacturer’s instructions (Life Technologies, Italy). A cDNA mixture (2.5 ll) was subjected to PCR amplification in a 25-ll reaction mixture containing 1X Taq polymerase buffer (Promega, USA), 1 lM MgCl2, 0.5 mM dNTPs, 0.25 ll of Taq polymerase (5 U/ll) and 0.2 lM each pair of sense and anti-sense primers. PCR amplification consisted of an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 35 s, 52 °C for 45 s and 72 °C for 50 s. PCR products were electrophoresed in 6 % polyacrylamide gels and visualized by silver nitrate staining. The presence of more than one GFLV isolate in infected grapevine sources was investigated by single-strand conformation polymorphism assay (SSCP). An aliquot (3 ll) of the PCR product generated from cDNA or DNA recombinant plasmids was added to 3 volumes of loading buffer prior to denaturation [16]. Denatured ssDNAs of the amplified GFLV-2AHP fragment were subjected to electrophoresis in a non-denaturing 10 % polyacrylamide gel [12]. DNA conformation patterns were visualized by silver
Homing protein domain of grapevine fanleaf virus
staining. In the case of multiple DNA conformation patterns, further amplifications of recombinant DNA were made, and the products were subjected to a new SSCP analysis. Finally, representatives of each SSCP pattern were sequenced. All PCR amplicons were ligated in StrataCloneTM PCR Cloning vector pSC-A (Stratagene, USA), subcloned into Escherichia coli SoloPACK cells and custom sequenced (Primm, Italy). Nucleotide and protein sequences were analysed with the assistance of the DNA Strider 1.1 program [11]. Search for homologies with proteins from the Protein Information Resources database (PIR, release 47.0) was done with the programs FASTA [21], BlastX and BlastP [1]. For phylogenetic analysis, nucleotide and amino acid sequences were aligned using MUSCLE [5], and trees supported by bootstrapping were generated by the maximum-parsimony, maximum-likelihood and standard neighbour-joining methods [22], applying the JTT matrix and pairwise gap deletion options implemented in MEGA 5.05 [29]. Branches with less than 50 % bootstrap support were collapsed. The aligned sequences of the complete RNA2-CR of seven YM-GFLV isolates and, subsequently, of the 2AHP domain of 21 GFLV isolates (either YM or MF) were checked using RDP3 [15], which allows sequence analysis for recombination using seven different detection methods: the original RDP, BOOTSCAN/RECSCAN [14, 15, 25], GENECONV [20, 27], MaxiChi [24, 28], Chimaera [24], Siscan [9] and 3SEQ [3]. ELISA confirmed the presence of GFLV in the totality of the 22 samples analysed, none of which was positive for ArMV. The sets of primers designed in the conserved regions of GFLV-RNA2 successfully amplified the entire 2AHP, 2BMP, 2CCP and the 30 NCR from the entire set of tested samples. The RNA2-CR and the 30 NCR of seven GFLV-YM isolates (It20, It21, It24, It34, Tk55, Urs11 and USA11) were sequenced completely. The CR length ranged from 3324 to 3348 nt, whereas the 30 NCR, excluding the poly(A) tail, ranged from 210 to 213 nt. The comparison with comparable GenBank sequences of 35 other GFLV isolates using the BLAST algorithm revealed an overall nucleotide sequence identity from 79 to 99 %. Maximum-likelihood phylogenetic trees with 1000 bootstrap replicates generated from the complete RNA2-CR sequences of the 42 isolates revealed segregation into at least eight distinct clades (Fig. 1). Of the YM isolates sequenced in the present study, four (Urs11, Tk55, It20-7 and It34) grouped together with the French isolate A17d and the American isolate WACF2142, two (USA11 and It24) clustered with several Slovenian and French isolates, and isolate It21 clustered with the Slovenian isolate Vol57c5 (Fig. 1). Analyzing the nucleotide sequences of the different domains in the RNA2-CR separately, 2AHP
appeared to be the most variable (up to 33 % divergence), followed by 2BMP (up to 22 %) and 2CCP (up to 16 %). Interestingly, the 2AHP of some of the GFLV isolates under study showed a nucleotide sequence identity level with ArMV that was higher than that with GFLV isolates from GenBank, suggesting that interspecific recombination events had occurred in 2AHP. Recombination analysis using the RDP3 program predicted the occurrence of potential interspecies recombination events in five isolates (It20, It21, It34, Tk55, and Urs11) out of the seven sequenced in this study, having ArMV as minor parent. In all these cases, the crossover region was localised in 2AHP and involved the N-terminus, comprising the first 444 nt (Table 2). This result prompted a further analysis for recombination on a subset of 15 GFLV isolates (nine YM and six MF), which were also sequenced in the course of this study. These 15 additional GFLV isolates were sequenced only in the region of the N-terminus of 2AHP (469 bp), which has been shown to be more frequently involved in this phenomenon. Electropherograms of SSCP analysis of infected grapevine samples revealed different haplotype patterns and lengths of the viral fragments, indicating that, in at least six cases, two different viral molecular variants co-existed in the same vine (It17 [It 17-1 and It17-2], It20 [It20-4 and It20-7], It21 [It21-1 and It21-3], It35 [It35-2 and It35-3], It36 [It36-2 and It36-3], Tk4 [Tk4-15-1 and Tk4-15-2]). More often, the nucleotide sequences of molecular variants from the same plant varied by a few nucleotides only and therefore clustered closely in the phylogenetic tree. In other instances, e.g., It20 and It21, variants from the same vine had a sequence divergence wide enough to separate them from each other in the phylogenetic tree. This may be the outcome of subsequent infections by different isolates following grafting or transmission by nematode vectors. The six isolates identified in mixed infections using SSCP analysis were also cloned and sequenced, thus bringing to 28 the total number of isolates with sequenced 2AHP. When the 2AHP amino acid sequences were aligned, they assembled in distinct groups characterized by the presence of different conserved blocks of residues (Fig. 2). Marked differences were found between groups 1, 2 and 3, comprising YM isolates, and group 4, comprising MF isolates. The MF group was compact and characterized by the occurrence of some exclusive conserved residue blocks (e.g., at position 13-15 [AxC], 20-21 [GR], 32 [C], 39-40 [KE], 59-74 [ExPxxRxxxEGxAGxA], and 80-88 [HxHTLGLVP]) that were absent in YM isolates. By contrast, YM isolates clustered in three different groups (1, 2 and 3) based on the types of residue blocks that were conserved only in some isolates. For example, group 2, including isolates Rom2, It19 and It21, showed characteristic conserved
123
T. Elbeaino et al. 0.05
1000
1000
ArMV-TA ArMV-NW 3138-07 WAME1492 837 1000 SAPC53 SACH44 870 1000 WAPN8133 WAPN173 826 984 WAPN57 CAZINA1 970 CACSC1 757 863 CACSC2 CAZINA4 992 F13 1000 1000 CACSB5 776 Nw Usa11 Vol45c1 Vol50c2 1000 885 1000 Vol47c1 It24 B19a A10a 972 1000 A17a 787 WACF2142 943 Urs11 A17d It34 757 903 Tk55 815 It20 885 WACH911 WAPN165 1000 1000 WAPN6132 870 Vol57c5 It21 752 1000 Urmia Shir-Amin Takestan 1000 Bonab 1000 Ghu 999 CACSC3 1000 CACSB3 CAZINA3 1000 CACSC4 1000 GDefV
Fig. 1 Phylogenetic tree generated by the maximum-likelihood method from the nucleotide sequence alignment of the complete RNA2 coding region of GFLV isolates considered in this study, together with homologue sequences of GFLV, ArMV and GDeV retrieved from GenBank. The accession numbers of the sequences that were used are as follows: ArMV (Ta [EF426853], NW [AY017339]); GFLV (3138-07 [JX559643], WAME1492 [GQ332370], SAPCS3 [JF968121], SACH44 [KC900163], WAPN8133 [GQ332369], WAPN173 [GQ332368], WAPN57 [GQ332367], CAZINA1 [GU972571], CACSC1 [GU972581], CACSC2 [GU972582], CAZINA4 [GU972574], F13 [NC_003623], CACSB5 [GU972580], Nw [AY017338], Vol45c1 [DQ922652],
Vol50c2 (DQ922661), Vol 47c1 (DQ922653), B19a (AY780903), A10a (AY780902), A17a (AY780899), WACF2142 [GQ332371], A17d [AY780901], WACH911 [GQ332364], WAPN165 [GQ332365], WAPN6132 [GQ332366], Vol57c5 [DQ922678], Urmia [JQ071375], Shir-Amin [JQ071374], Takestan [JQ071377], Bonab [JQ071376], Ghu [EF426852], CACSC3 [GU972583], CACSB3 [GU972578], CAZINA3 [GU972573], CACSC4 [GU972584]); GDeV [NC_017938]. The accession numbers for the GFLV isolate sequenced in this study are USA11 (HG939481), It24 (HG939478), Urs11 (HG939482), It34 (HG939479), Tk55 (HG939483), It20 (HG939477), and It21 (HG939480). Bootstrap values are shown at branch nodes
residues at positions 13-20 (VxxQAQSR), 26 (Y), 32-56 (CxSGxSAxxAExxARxxKxxSLERV), 63-94 (PxxQxxTE CxITPGGIxxExxTxxTTxTSRVV) and 104 (H) (Fig. 2). The same amino acid blocks were common to the Iranian isolates Bonab and Takestan, which came from
vines with vein banding symptoms [34]. The amino acid block at position 96-119 of group 3 (QxxxxPx VxxxxxxxMxRxxxxP), which was suggested by Jawhar et al. [10] as potentially characterizing the YM strains (YM5, YM7 and YMC1) and was common to some
123
Homing protein domain of grapevine fanleaf virus Table 2 Recombination crossover events in 2AHP of GFLV isolates detected using the Recombination Detection Program (RDP3) Isolates
Reference
Nt. position in 2AHP
Parental isolates (Major 9 minor)
RDP3 (P-value) *
Urs11
This study
107-440
GFLV-F13 9 ArMV-Ta
RGBMC3 sS (5.397 9 10-11/2.301 9 10-3)
Tk55
This study
271-444
GFLV-F13 9 ArMV-Ta
RGBMC3sS (4.965 9 10-12/5.515 9 10-3)
It34
This study
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (4.512 9 10-15/2.329 9 10-7)
It20-7
This study
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (4.512 9 10-15/2.329 9 10-7)
YM7-YM5 - YMC1
(Jawhar et al., 2009)
286-379
GFLV-IT31-3 9 ArMV-NW
RGBMC3sS (2.418 9 10-06/1.292 9 10-2)
Rom2
This study
58-161
GFLV-IT31-3 9 ArMV-U
RGBMC3sS (1.298 9 10-05/1.529 9 10-3)
It19
This study
58-161
GFLV-IT31-3 9 ArMV-U
RGBMC3sS (1.298 9 10-05/1.529 9 10-3)
It21
This study
41-138
GFLV-F13 9 ArMV-U
RGBMC3sS (1.606 9 10-12/4.865 9 10-2)
Bonab/Takestan
(Zarghani et al., 2013)
46-168
GFLV-F13 9 ArMV-U
RGBMC3sS (3,.770 9 10-14/4.956 9 10-3)
*RDP3-implemented methods supporting the corresponding recombination sites: R (RDP), G (GENECONV), B (BOOTSCAN), M (MAXCHI), C (CHIMAERA), 3Seq (3s) and S (SISCAN). The reported P-values within brackets are the highest and lowest P-values among those calculated using RDP3-implemented methods, and the corresponding methods are shown in italic and bold, respectively
Fig. 2 Amino acid sequence alignment of the 2AHP (partial) of GFLV isolates showing groups of variants found between the isolates analyzed in this study and other GFLV isolates (YM-5, YMC1, YM7,
Bonab and Takestan [10, 34]) associated with YM symptoms. Points indicate conserved amino acids
ArMV isolates, was also found in four additional YM isolates (It34, It20, Tk55 and Urs11) in this study (Fig. 2).
Sequences of the 2AHP gene of the isolates under study were used for constructing a phylogenetic tree. As shown in Fig. 3, there was a clear-cut separation of YM and MF
123
T. Elbeaino et al. Fig. 3 Phylogenetic tree generated by the maximumlikelihood method based on amino acid sequences of partial 2AHP domains of GFLV isolates analyzed in this study (accession numbers: HG421746 to HG421770 and HG939477 to HG939483), together with homologue sequences of GFLV and ArMV retrieved from GenBank (accession numbers: ArMV (Nar [AB279740], Lil [AB279741], NW [AY017339], Ta [EF426853]); GFLV (F13 [NC_003623], YM7 [FJ531806], YMC1 [FJ531814], YM5 [FJ531801], Urmia [JQ071375], Shir-Amin [JQ071374], Takestan [JQ071377], Bonab [JQ071376]). Bootstrap values are shown at branch nodes. YM yellow mosaic, MF malformation, VB vein banding
0.05
ArMV-Nar ArMV-Lil It35-3 YM UrmiaYM 1000 Shir-AminYM F13 781 YM Tu14 810 YM Tu7 755 Bu25YM USA11YM 798 Group 1 It35-2 YM 768 It21-3 YM 800 It31 YM 1000 1000 Gr11YM It24 YM It17-2 YM 833 986 It17-1 YM YM Urs11 It34 YM 788 YM7YM 863 YMC1 YM 964 YM Group 2 876 YM5 810 ArMV- Ta
1000 999
873
ArMV- NW Tk55YM
830
It20-7 YM TakestanVB/YM 998 BonabVB/YM Rom2YM 1000 YM 1000 It19 It21-1 YM It36-3 MF It36-2 MF MF Tk1 It20-4 Tk5MF Tk4-15-2MF Hu26MF Tu27MF 999 Tk4-15-1MF
984
1000
1000
1000
1000 871
968 977
isolates, the former clustering in three groups (groups 1, 2 and 3) distinct from group 4, which included only MF strains. The presence of YM isolate It20-4 in the MF group is apparently incongruent. However, since It20-4 is one of the two isolates whose presence in the same vine was revealed by SSCP analysis (isolate It20-7 belongs to group 2), it could be hypothesized that It20-4 is in fact an MF isolate and that the YM symptoms observed in the field were caused by It20-7. The co-existence of YM and MF
123
Group 3
Group 4
symptoms in a single vine is not rare [13], this perhaps being one of those cases. The presence of some ArMV isolates clustering close to or within group 2 is not surprising because recombination events between GFLV and ArMV at the level of the 2AHP gene have repeatedly been reported [10, 19, 32]. The distribution of our GFLV isolates and their clustering in distinct groups, shown in Fig. 3 (phylogenetic tree obtained by the maximum-likelihood method), was
Homing protein domain of grapevine fanleaf virus
homogeneous and substantially comparable with that shown by both trees generated for the 2AHP genes by the maximum-parsimony and neighbor-joining methods, using highly supported substitution models (data not shown). The nucleotide identity matrix of the 2AHP gene of the 28 viral isolates under study plus numerous additional isolates from GenBank showed a very high level of intergroup variability that, in some cases (e.g., between isolates of groups 2 and 4), reached 41 % and never fell below 31 % between MF (group 4) and the other YM isolates (groups 1, 2 and 3). Nucleotide sequence identity was also very low among YM isolates, in particular between isolates of group 3 and those of group 2 (62-64 %) and 1 (6468 %). Within individual groups, identity levels ranged from 22 % (group 4) and 15 % (groups 1 and 2) to 12 % (group 3). The variability determined in this study was much higher than that (15 %) reported previously [23]. This marked difference can be explained by (i) the larger number of isolates investigated in this study, (ii) the inclusion of a number of GFLV/ArMV recombinants, and (iii) the smaller (469 bp vs 765-774 bp) but more variable 2AHP area explored. The nucleotide sequences of 2AHP of several GFLV isolates, in particular those included in groups 2 and 3, were more closely related to some ArMV isolates (up to 88 % nt sequence identity) than to GFLV (less than 86 %), suggesting the presence of potential recombination events between GFLV and ArMV. This was also confirmed by the clustering of some ArMV isolates with GFLV isolates in group 2 (Fig. 3). Recombination analysis using the RDP3 program predicted the occurrence of potential interspecies recombination events in the 2AHP of GFLV isolates, with ArMV (NW, Ta, U isolates) and GFLV (F13, IT31-3) as putative parents. Interspecific recombination events were identified in at least seven YM isolates, four of them in group 2 (It34, It20-7, Tk55 and Urs11) and three in group 3 (It21, Rom2 and It19). It is noteworthy that the recombinant isolates of group 2 clustered with the three recombinants found in YM vines studied by Jawhar et al. [10]. Likewise, the recombinant isolates of group 3 clustered with two vein banding isolates (Bonab, Takestan) from Iran [34] in which the analysis conducted in this study predicted putative recombination events in 2AHP. Each of the aforementioned recombination sites was predicted by at least seven different methods included in the RDP3 software package (Table 2). RNA recombination is a natural mechanism involved in genetic variation and evolution of plant virus populations, and based on the results reported here and elsewhere [9, 18], 2AHP seems to be a ‘‘hot spot’’ for interspecies genetic exchanges between GFLV and ArMV, two closely related grapevine-infecting nepoviruses. The occurrence of GFLV/ArMV recombination events in 2AHP of viral isolates recovered consistently
from vines with YM symptoms (groups 2 and 3) and in none of those hosting MF isolates (group 4) may be taken as an indication that 2AHP is the genomic area involved in symptom expression. However, whether ArMV is the carrier of the information somehow responsible for the expression of YM in grapevines remains to be ultimately established by further studies because of the conflicting results provided by the recovery of non-recombinant isolates (group 1) from vines with YM symptoms. The construction of YM- and MF-GFLV infectious cDNA clones, their targeted manipulation and expression in grapevine seedlings could contribute to clarifying the role of 2AHP in infectivity and symptomatology.
References 1. Altschul SF, Stephen F, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410 2. Andret-Link P, Laporte C, Valat L, Ritzenthaler C, Demangeat G, Vigne E, Laval V, Pfeiffer P, Stussi-Garaud C, Fuchs M (2004) Grapevine fanleaf virus: Still a major threat to the grapevine industry. J Plant Path 86:183–195 3. Boni MF, Posada D, Feldman MW (2007) An exact nonparametric method for inferring mosaic structure in sequence triplets. Genetics 176:1035–1047 4. Clark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34:475–483 5. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797 6. Elbeaino T, Digiaro M, Ghebremeskel S, Martelli GP (2012) Grapevine deformation virus: completion of the sequence and evidence on its origin from recombination events between grapevine fanleaf virus and arabis mosaic virus. Virus Res 166:136–140 7. Foissac X, Svanella-Dumas L, Dulucq MJ, Gentit P, Candresse T (2001) Polyvalent detection of fruit tree tricho, capillo and fovea viruses by nested RT-PCR using degenerated and inosine containing primers (PDO RT-PCR). Acta Hortic 550:37–43 8. Garcı´a-Arenal F, Fraile A, Malpica JM (2001) Variability and genetic structure of plant virus populations. Ann Rev Phytopath 39:157–186 9. Gibbs MJ, Armstrong JS, Gibbs AJ (2000) Sister-scanning: a monte carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16:573–582 10. Jawhar J, Minafra A, La Notte P, Pirolo C, Saldarelli P, Boscia D, Savino V, Martelli GP (2009) Recombination events in RNA-2 of Grapevine fanleaf virus and Arabis mosaic virus in grapevines affected by yellow mosaic. In: Boudon-Padieu E. (eds) Extended abstracts 16th Meeting of International Council for the study of virus and virus-like diseases of the grapevine, Le Progre´s Agricole et Viticole, Dijon France, 73–74 11. Marck C (1988) DNA strider: a C programme for the fast analysis of DNA and protein sequences on the Apple Macintosh family computers. Nucleic Acids Res 16:1829–1836 12. Markoff A, Savov A, Vladimirov V, Bogdanova N, Kremensky I, Ganev V (1997) Optimization of single-strand conformation polymorphism analysis in the presence of polyethylene glycol. Clin Chem 43:30–33
123
T. Elbeaino et al. 13. Martelli GP, Boudon-Padieu E (2006) Infectious agents of grapevine. In: Directory of infectious diseases of grapevines, Options Me´diterrane´ennes, Se´rie B: Studies and Research, Bari, Italy, pp 15–38 14. Martin DP (2009) Recombination detection and analysis using RDP3. Methods Mol Biol 537:185–205 15. Martin DP, Williamson C, Posada D (2005) RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21:260–262 16. Martins-Lopes P, Zhang H, Koebner R (2001) Detection of single nucleotide mutations in wheat using single strand conformation polymorphism gels. Plant Mol Biol Rep 19:159–162 17. Mekuria TA, Gutha LR, Martin RR, Naidu RA (2009) Genome diversity and intra and interspecies recombination events in Grapevine fanleaf virus. Phytopathology 99:1394–1402 18. Naraghi-Arani P, Daubert S, Rowhani A (2001) Quasispecies nature of the genome of Grapevine fanleaf virus. J Gen Virol 82:1791–1795 19. Oliver JE, Vigne E, Fuchs M (2010) Genetic structure and molecular variability of Grapevine fanleaf virus populations. Virus Res 152:30–40 20. Padidam M, Sawyer S, Fauquet CM (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218–225 21. Pearson WR, Lipman DJ (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85:2444–2448 22. Perrie`re G, Gouy M (1996) WWW-Query: An on-line retrieval system for biological sequence banks. Biochimie 78:364–369 23. Pompe-Novak M, Gutie´rrez-Aguirre I, Vojvoda J, Blas M, Tomazˇicˇ I, Vigne E, Fuchs M, Ravnikar M, Petrovicˇ N (2007) Genetic variability within RNA2 of grapevine fanleaf virus. Eur J Plant Pathol 117:307–312 24. Posada D, Crandall KA (2001) Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc Natl Acad Sci USA 98:13757–13762
123
25. Salminen M, Carr J, Burke D, McCutchan F (1995) Identification of breakpoints in intergenotypic recombinants of HIV type 1 by Bootscanning. AIDS Res Hum Retrovir 11:1423–1425 26. Sanfac¸on H, Iwanami T, Karasev AV, Van der Vlugt R, Wellink J, Wetzel T, Yoshikawa N (2011) Family Secoviridae. In: King AMQ, Adams MJ, Carstend EB, Lefkowitz EJ (eds) Virus Taxonomy. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, San Diego, pp 881–899 27. Sawyer S (1989) Statistical tests for detecting gene conversion. Mol Biol Evol 6:526–538 28. Smith JM (1992) Analyzing the mosaic structure of genes. J Mol Evol 34:126–129 29. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 30. Terlizzi F, Biolchini L, Credi R (2004) Molecular characterization of Italian grapevine fanleaf virus isolates. J Plant Pathol 86:335 31. Vigne E, Bergdoll M, Guyader S, Fuchs M (2004) Population structure and genetic variability within isolates of grapevine fanleaf virus from a naturally infected vineyard in France: evidence for mixed infection and recombination. J Gen Virol 85:2435–2445 32. Vigne E, Marmonier A, Fuchs M (2008) Multiple interspecies recombination events within RNA2 of Grapevine fanleaf virus and Arabis mosaic virus. Arch Virol 153:1771–1776 33. Worobey M, Holmes EC (1999) Evolutionary aspects of recombination in RNA viruses. J Gen Virol 80:2535–2543 34. Zarghani SN, Shams-Bakhsh M, Bashir NS, Wetzel T (2013) Molecular characterization of whole genomic RNA2 from Iranian isolates of Grapevine fanleaf virus. J Phytopathol 161:419–425
