Plant Physiology and Biochemistry 94 (2015) 130e143

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Physiological and molecular analyses of black and yellow seeded Brassica napus regulated by 5-aminolivulinic acid under chromium stress Rafaqat A. Gill, Basharat Ali, Faisal Islam, Muhammad A. Farooq, Muhammad B. Gill, Theodore M. Mwamba, Weijun Zhou* Institute of Crop Science and Zhejiang Key Laboratory of Crop Germplasm, Zhejiang University, Hangzhou 310058, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 March 2015 Received in revised form 1 June 2015 Accepted 1 June 2015 Available online 3 June 2015

Brassica napus L. is a promising oilseed crop among the oil producing species. So, it is prime concern to screen the metal tolerant genotypes in order to increase the oilseed rape production through the utilization of pollutant soil regimes. Nowadays, use of plant growth regulators against abiotic stress is one of the major objectives of researchers. In this study, an attempt was carried out to analyze the pivotal role of exogenously applied 5-amenolevulinic acid (ALA) on alleviating chromium (Cr)-toxicity in black and yellow seeded B. napus. Plants of two cultivars (ZS 758 e a black seed type, and Zheda 622 e a yellow seed type) were treated with 400 mM Cr with or without 15 and 30 mg/L ALA. Results showed that exogenously applied ALA improved the plant growth and increased ALA contents; however, it decreased the Cr concentration in B. napus leaves under Cr-toxicity. Moreover, exogenous ALA reduced oxidative stress by up-regulating antioxidant enzyme activities and their related gene expression. Further, results suggested that stress responsive protein's transcript level such as HSP90-1 and MT-1 were increased under Cr stress alone in both cultivars. Exogenously applied ALA further enhanced the expression rate in both genotypes and obviously results were found in favor of cultivar ZS 758. The ultrastructural changes were observed more obvious in yellow seeded than black seeded cultivar; however, exogenously applied ALA helped the plants to recover their cell turgidity under Cr stress. The present study describes a detailed molecular mechanism how ALA regulates the plant growth by improving antioxidant machinery and related transcript levels, cellular modification as well as stress related genes expression under Crtoxicity. © 2015 Elsevier Masson SAS. All rights reserved.

Keywords: Bio-chemicals Brassica napus Chromium stress Gene expression qRT-PCR 5-aminolevulinic acid

1. Introduction Brassica napus L. (Oilseed rape, AACC genome) is recently developed through allopolyploidy between two diploid parents, Brassica rapa (AA genome) and Brassica oleracea (CC genome) (Allender and King, 2010). B. napus is considered as well-known source of edible oil and protein around the world (Momoh et al., 2002; Tan, 2010). Due to dual importance, its farming has been increased massively since last decade and now it is ranked as second largest oil producing crop (Tan, 2010). Oilseed rape has a great ability to grow well under heavy metal polluted soils. Due to their fast growth, more biomass and higher capability to tolerate heavy

* Corresponding author. E-mail address: [email protected] (W. Zhou). http://dx.doi.org/10.1016/j.plaphy.2015.06.001 0981-9428/© 2015 Elsevier Masson SAS. All rights reserved.

metals, Brassica species are considered as heavy metal tolerant crops (Meng et al., 2009). Heavy metal stress has become a foremost environmental threat to crop production. Being a potential hazardous factor, toxic metals decrease the plant growth, yield and sustainability of production, thus can cause the alarming situation for food availability. Plants under the stress environment facing the alterations of cellular protein functions, lipid and thylakoid structures. Disturbance or breakage of these structures is directly linked with plant photosystem that can affect the senescence process (Lin et al., 2005; Maksymiec, 2007; Molas, 2002). Chromium (Cr), considered as non-essential trace element, has negative impacts at higher concentrations (Dixit et al., 2002). It directly pollutes the atmosphere through multiple ways, for instance, tanning, electroplating, chromic acid, catalytic manufacturing and steel industry (Dixit et al., 2002; Shanker et al., 2005). Exposure of plants to Cr causes the

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

disturbance in plant nutrient uptake, chlorosis in young leaves, wilting, root injury and a reduction in growth (Chatterjee and Chatterjee, 2000; Dixit et al., 2002; Sharma et al., 2003; Scoccianti et al., 2006). Thus, it can conclude that increased level of Cr decreases the biomass and yield of plants (Shanker et al., 2005). Moreover, Cr also disturbs the plant physiology by inhibiting photosynthesis, mineral uptake and water imbalance in the cells. These metabolic changes can directly trigger the plant defense system, including enzymatic and non-enzymatic antioxidants to cope with overproduce of reactive oxygen species (ROS) in the cell (Shanker et al., 2005). Previously, under unfavorable conditions, activation of genes related to the enzymatic defense system, including superoxide dismutase (SOD), guaicol peroxidase (POD), catalase (CAT) and glutathione reductase (GR) were observed (Swaran, 2009). Similarly, up-regulation of these genes under aluminum (Al) stress was also reported (Ahn et al., 2004). Beside the up-regulation of defense mechanism, plants also activate stress response proteins such as heat shock (HSP90-1), metallothionein (MT-1) and glutathione reductase (GR1) like proteins. A survey of the literature suggests that HSP protein is considered as an environmental toxicology stress marker, MT as metal-binding (dal Corso et al., 2008) and detoxifying protein, which sequesters the metal ions by chelation and GR as a marker of enzymatic ROS scavenging mechanism (Schutzendubel et al., 2002; Apel and Hirt, 2004). The literature evidenced that the compound named 5aminolivulinic acid (ALA) is a key precursor of all tetrapyrroles such as vitamin B12, billins, heme, chlorophyll and other important plant's machinery (Rebeiz et al., 1984; von Wettstein et al., 1995). Several reports have stated that ALA performed a modulating role to regulate the various biosynthesis processes such as ion uptake/accumulation, chlorophyll, photosynthesis, carbon and nitrogen fixation, antioxidant machinery, fruit formation and ultimately the yield (Al-Khateeb, 2006; Zhang et al., 2006; Maruyama-Nakashita et al., 2010; Naeem et al., 2010). It is also known that ALA in low concentration regulates key physiological processes associated with plant growth under various abiotic and biotic stresses, including low or high temperature (Balestrasse et al., 2010), salinity (Naeem et al., 2012), drought (Li et al., 2011) and heavy metals (Ali et al., 2013a, b). On the basis of background information, work done on Cr stress, and importance of this crop, the present study was established to test the hypothesis that ALA alleviates physiological, cell ultrastructural, biochemical and stress responsive protein's gene expression under the Cr-toxicity in B. napus plants. 2. Materials and methods 2.1. Plant material and treatment conditions Two black and yellow seeded cultivars (ZS 758 and Zheda 622) of B. napus L. (oilseed rape) were used in this study based on the previously designed experiments (Gill et al., 2015). Seeds of these B. napus cultivars were obtained from the College of Agriculture and Biotechnology, Zhejiang University. Mature seeds of both cultivars were treated with 70% (v/v) ethanol for 3 min, transferred into 0.1% (m/v) HgCl2 for 8 min and then rinsed with deionized water. The seeds were grown in plastic pots (170
220 mm) filled with peat moss. At the five-leaf stage, morphologically uniform seedlings were selected and plugged into plate holes in plastic pots (five plants per pot) containing a half-strength Hoagland's nutrient solution (Hoagland and Arnon, 1941) aerated continuously with an air pump, and kept in a greenhouse. The composition of Hoagland nutrient solution was as follows (mmol/L): 3000 KNO3, 2000 Ca(NO3)2, 1000 MgSO4, 10 KH2PO4, 12 FeC6H6O7, 500H3BO3, 800

131

ZnSO4, 50 MnCl2, 300 CuSO4, 100 Na2MoO4. The pH of solution was maintained at 6.0. The light intensity was in the range of 250e350 mmol m2 s1, temperature was 16e20  C and the relative humidity was approximately 55%e60%. Each treatment was replicated four times. The nutrient solution was renewed after every 5 days. After two weeks of acclimatization, solutions were adjusted to a desired Cr concentration (0 and 400 mM) and plants were simultaneously sprayed with an aqueous solution of ALA (Cosmo Oil Co. Ltd., Japan) at concentrations of 0, 15 and 30 mg/L. The Cr treatment concentrations were based on our previous findings (Gill et al., 2015) in which we found that Cr at 100 mM level did not show any significant change; however, Cr at 400 mM imposed a significant effect on B. napus growth. It was similar in the case of ALA application, where plants exhibited optimum response with the treatment of 30 mg/L concentration under Cr stress conditions. The potassium dichromate (K2Cr2O7) salt was used to maintain different Cr concentrations and full-strength Hoagland's solution was used as a basal medium, and treatments were replicated four times. The lower and upper leaf surfaces were sprayed with a handheld atomizer until wet, as it was reported that absorption of the lower leaf surface is rapid and effective (Hull et al., 1975). Five days after the first spray, a subsequent application was performed. Plants sprayed with distilled water served as controls. 2.2. Morphological parameters Fifteen days after treatment, plants were harvested and separated into leaves, stem, and roots. The length of the whole plant, stem, root and the leaf area were measured. Dry and fresh biomass of the rapeseed plants was determined separately (Zhang et al., 2008). Fresh leaves, stems, and roots of six plants per treatment were weighed immediately after harvesting and then placed into an oven at 80  C. The dried samples were weighed immediately after removal from the oven until biomass became stable (Momoh and Zhou, 2001). 2.3. Chlorophyll, Cr and relative water contents determinations Chlorophyll contents in leaves and stem were determined according to Porra et al. (1989). For determination of Cr concentration in shoots and roots, samples were dried at 65  C for 24 h; grind the sample into powder form. Uniform 0.6 (g) samples were taken in falcon tube and added 5 mL HNO3 in each tube. After overnight reaction, 0.5 mL H2O2 was added (to speed-up the digestion process) and then ashed in Muffle furnace at 155  C for 4.5 h. After digestion, the samples were diluted with distilled water to make up the total volume to 30 mL. The Cr concentration in the digest was determined using an atomic absorption spectrophotometer (PE100, Perkin Elmer, USA). The relative water content (RWC) of fully expanded fourth leaf from apex per replicate was determined according to Hayat et al. (2007) with some modification. Both sides of fresh leaf, excluding midrib was cut and weighed quickly. Leaf parts were immediately floated on deionized distilled water (DDW) in Petri dishes allow to absorb the water for the next 48 h, in room temperature. The adhering water of the leaf parts was blotted and turgor mass was noted. Dry mass of the leaf was recorded after dehydrating them at 60  C for 48 h. RWC was calculated by placing the values in the following formula:

RWC ¼

Fresh mass  dry mass
100 Turgor mass  dry mass

132

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

2.4. ALA contents estimation by LC-MS To quantify the ALA content in Brassica plants, a liquid chromatography-mass spectrometry (LC-MS) method was established on the bases of Harel and Klein (1972) method with some modifications. Fresh leaves (0.5 g FW) of B. napus were preincubated by dissolving 60 mm levulinic acid in 50 mM phosphate buffer with pH 6.0 and allow for 4 h in the dark at 7  C, 25  C, and 42  C, respectively. After the pre-incubation, the leaves were subjected to white fluorescent light (30 mmol m2 s1) for 3 and 6 h, respectively while controls were left in the dark. After series of light treatments, leaves were hand homogenized in a pre-chilled mortar and pestle in 5 mL of 1 M sodium acetate buffer (pH 4.6). The homogenate was centrifuged at 10,000 rpm (12,000 g) for 10 min and the supernatant was taken for assay. The reaction solution consisted of 0.1 mL of supernatant, 0.4 mL of distilled water, and 25 mL of acetyl-acetone. The assay medium was vertexes and heated in a boiling water bath for 10 min. After that, the mixture was cooled at room temperature, and added an equal volume of modified Ehrlich's reagent and vortexed for 2 min. After 10 min of incubation, the solution was filtered (having 0.25 mM pore size) prior to measure the ALA contents in LC/MS. The excretion samples were analyzed by HPLCeMS on an Agilent 1290 infinity HPLC system (including a vacuum degasser, a binary pump and a column oven) coupled to an Agilent 6460 triple Quad LC/MS (Agilent Technologies, Heilbronn, Germany). 2.5. Determination of MDA, ROS activity in leaf and histo-chemical staining of H2O2 and O 2 in root Lipid peroxidation in the leaf measured in terms of malondialdehyde (MDA) content was analyzed according to Zhou and Leul (1999). For determination of hydrogen peroxide (H2O2) contents, leaf (0.5 g FW) was extracted with 5.0 cm3 of tri-chloric acid (0.1%, w/v) in an ice bath, and the homogenate was centrifuged at 12,000 g for 15 min (Velikova et al., 2000). The 0.5 mL supernatant was mixed with 0.5 mL of10 mM potassium phosphate buffer (pH 7.0) and 1 mL of 1 M KI was added. The absorbance was read at 390 nm and the H2O2 content was calculated by using a standard curve. Superoxide radical (O 2 ) was determined as described previously (Jiang and Zhang, 2001) with some modifications. The sample of fresh cotyledons (0.5 g FW) was homogenized in 3 mL of 65 mM potassium phosphate buffer (pH 7.8) and then homogenate was centrifuged at 5000 g for 10 min at 4  C. After that the supernatant (1 mL) was mixed with 0.9 mL of 65 mM potassium phosphate buffer (pH 7.8) and 0.1 mL of 10 mM hydroxylamine hydrochloride, and then incubated at 25  C for 24 h. After incubation, 1 mL of 17 mM sulphanilamide and 1 mL of 7 mM a-naphthylamine were mixed in 1 mL solution for further 20 min at 25  C. After incubation, n-butanol in the same volume was added and centrifuged at 1500 g for 5 min. The absorbance in the supernatant was read at 530 nm. Standard curve was used to calculate the generation rate of O 2. For estimation of extra-cellular hydroxyl radicals (OH), 0.5 g fresh leaves samples were incubated in 1 mL of 10 mM Naphosphate buffer (pH 7.4) consisting 15 mM 2-deoxy-D-ribose (SRL, Mumbai) at 37  C for 2 h (Halliwell et al., 1987). Following incubation an aliquot of 0.7 mL from the above mixture were added to reaction mixture containing 3 mL of 0.5% (w/v) thiobarbuteric acid (TBA, 1% stock solution made in 5 mM NaOH) and 1 mL glacial acetic acid, heated at 100  C in a water bath for 30 min and cooled down to 41  C for 10 min before measurement. The H2O2 and O 2 contents in roots was physically observed by staining with 3, 3diaminobenzidine (DAB) and nitro-blue tetrazolium (NBT), respectively. Both dyes 0.025 g (each) by weight were dissolved in

50 mL PBS buffer and allowed to incubate for 2 h. DAB and NBTstained roots were photographed using an elevated power microscope attached with high resolution digital camera (Leica DM2500). 2.6. Determination of enzymatic defense machinery For enzyme activity, leaf samples (0.5 g FW) were homogenized in 8 mL of 50 mM potassium phosphate buffer (pH 7.8) under ice cold conditions. This homogenize solution was centrifuged at 10,000 g for 20 min at 4  C and the supernatant was used for the determination of the following enzyme activities. Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined with the method of Zhang et al. (2008) following the inhibition of photochemical reduction due to nitro blue tetra-zolium (NBT). The reaction mixture was comprised of 50 mM potassium phosphate buffer (pH 7.8), 13 mM methionine, 75 mM NBT, 2 mM riboflavin, 0.1 mM EDTA and 0.1 mL of enzyme extract in a 3 mL volume. One unit of SOD activity was measured as the amount of enzyme required to cause 50% inhibition of the NBT reduction measured at 560 nm. Guaicol peroxidase (POD, EC 1.11.1.7) activity was assayed according to Zhou and Leul (1999) method with some modifications. The reactant mixture contained 50 mM potassium phosphate buffer (pH 7.0), 1% (m/v) guaicol, 0.4% (v/v) H2O2 and 0.1 mL enzyme extract. Variation due to guaicol in absorbance was measured at 470 nm. Catalase (CAT, EC 1.11.1.6) activity was measured according to Aebi (1984) method with the use of H2O2 (extinction co-efficient 39.4 mM cm1) for 1 min at A240 in3 mL reaction mixture containing 50 mM potassium phosphate buffer (pH 7.0), 2 mM EDTANa2, 10 mM H2O2 and 0.1 mL enzyme extract. The assay for ascorbate peroxidase (APX, EC 1.11.1.11) activity was measured in a reaction mixture of 3 mL containing 100 mM phosphate (pH 7), 0.1 mM EDTA-Na2, 0.3 mM ascorbic acid, 0.06 mM H2O2 and 0.1 mL enzyme extract. The change in absorption was taken at 290 nm 30 s after addition of H2O2 (Nakano and Asada, 1981). Glutathione reductase (GR, EC 1.6.4.2) activity was assayed by Jiang and Zhang (2002) method with the oxidation of NADPH at 340 nm (extinction co-efficient 6.2 mM cm1) for 1 min. The reaction mixture contained 50 mM potassium phosphate buffer (pH 7.0), 2 mM EDTA-Na2, 0.15 mM NADPH, 0.5 mM GSSG and 0.1 mL enzyme extract in a 1 mL volume, the reaction was started by using NADPH. Total soluble protein content was determined according to the method of Bradford (1996) by using bovine serum albumin as a standard. 2.7. Determination of non-enzymatic antioxidants activity Reduced glutathione (GSH) and oxidized glutathione (GSSG) were determined according to Law et al. (1983) with some modifications. Leaf samples (0.5 g FW) were homogenized with 5 mL of 10% (w/v) TCA and homogenate was centrifuged at 15,000 g for 15 min. To assay total glutathione, 150 mL supernatant was added to 100 mL of 6 Mm dithionitrobenzoate (DTNB), 50 mL of glutathione reductase (10 units mL1), and 700 mL 0.3 mM NADPH. The total glutathione contents were calculated from the standard curve. All three agents were prepared in 125 mM NaH2PO4 buffer, containing 6.3 mM EDTA, at pH 7.5. To measure GSSG, 120 mL of supernatant was added to 10 mL of 2-vinylpyridine followed by 20 mL of 50% (v/v) tri-ethanolamine. The solution was vortexmixed for 30 s and incubated at 25  C for 25 min. The mixture was assayed as mentioned above. Calibration curve was developed by using GSSG samples treated exactly as above and GSH was determined by subtracting GSSG from the total glutathione content.

0.04ab 0.03c 0.05ab 0.04a 0.05c 0.06b 0.03ab 0.02e 0.04ab 0.05a 0.03d 0.03c ± ± ± ± ± ± ± ± ± ± ± ±

Root DW

0.84 0.63 0.83 0.86 0.67 0.78 0.82 0.44 0.83 0.87 0.55 0.66 1.08a 1.04bc 1.06a 1.09a 1.09b 1.03ab 1.05a 0.42d 1.03a 1.07a 0.56cd 0.66bc ± ± ± ± ± ± ± ± ± ± ± ±

Root FW

9.88 7.44 9.86 9.89 7.79 8.83 9.80 4.92 9.83 9.87 5.86 7.26 0.06ab 0.02e 0.03ab 0.05a 0.02d 0.04c 0.04bc 0.031f 0.065ab 0.04ab 0.03e 0.03d ± ± ± ± ± ± ± ± ± ± ± ±

Stem DW

0.66 0.41 0.66 0.69 0.48 0.57 0.62 0.31 0.65 0.67 0.41 0.49 1.01a 1.08b 1.03a 1.05a 1.02b 1.04ab 1.02a 0.53c 1.09a 1.06a 0.67c 1.05b ± ± ± ± ± ± ± ± ± ± ± ±

Stem FW

10.71 7.68 10.93 10.85 7.82 9.44 10.62 5.23 10.59 10.66 5.47 7.65 0.69a 0.15bc 0.43a 0.76a 0.48bc 0.61a 0.68a 0.16d 0.82a 0.74a 0.33cd 0.33b ± ± ± ± ± ± ± ± ± ± ± ± 6.49 3.75 5.53 5.56 3.98 5.61 6.48 2.36 6.52 6.54 3.03 4.33

Leaf DW

4.05a 3.03de 5.04a 4.03a 3.01c 3.08b 3.08a 2.04f 4.09a 5.08a 3.19e 2.53cd Zheda 622

þ 15 þ 30

þ 15 þ 30

Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range tests.

± ± ± ± ± ± ± ± ± ± ± ± 93.40 60.63 95.24 97.43 69.21 82.38 91.98 44.64 92.29 95.38 55.68 65.35

Leaf FW

15.08ab 9.02de 18.08ab 28.05a 15.01d 14.05bc 20.05a 6.08ef 14.02ab 15.03a 7.03de 10.04cd ± ± ± ± ± ± ± ± ± ± ± ±

Leaf area

200.48 146.92 198.98 218.25 155.31 184.25 210.25 124.68 194.92 207.63 139.93 159.24 0.9a 0.5cd 0.8a 1.05a 0.25c 0.55b 0.65ab 0.25d 0.45ab 0.45ab 0.35cd 0.35c ± ± ± ± ± ± ± ± ± ± ± ±

No. of leaves/plant

7.00 4.00 7.00 7.20 4.30 5.80 6.50 3.10 6.20 6.40 3.60 4.40 2.05ab 1.02c 2.02a 2.05a 1.04c 1.05b 2.04a 1.05d 1.04a 2.05a 1.08d 1.05c ± ± ± ± ± ± ± ± ± ± ± ±

Plant height

25.6 18.72 26.12 28.4 20.14 23.3 27.64 14.1 26.34 26.4 15.28 18.7 1.20a 1.08cd 1.18a 1.15a 1.05bc 1.06ab 1.16a e1.06 1.17a 1.15a 1.05de 1.15cee ± ± ± ± ± ± ± ± ± ± ± ±

Root length

14.30 10.78 14.38 14.45 11.4 13.16 14.26 8.46 13.97 14.35 8.95 10.25 0.56a 0.23cd 0.58a 0.6a 0.38c 0.43ab 0.48a 0.23d 0.43a 0.66a 0.34d 0.32c ± ± ± ± ± ± ± ± ± ± ± ± 5.36 3.23 5.38 5.40 3.48 4.53 5.38 2.43 5.33 5.36 2.64 3.52

The significance of differences between black and yellow seeded B. napus cultivars in physiological, biochemical and gene expressions was examined. The experiment was carried out through a randomized design. The analysis of variance was computed for statistically significant differences determined based on the appropriate two-way variance analysis (ANOVA). The results are the mean ± SD of at least four independent replicates and were analyzed using data processing system (DPS) statistical software package, followed by the Duncan's Multiple Range Test (DMRT). The difference at P  0.05 and 0.01 is considered as significant and highly significant, respectively.

Stem length

2.10. Statistical approaches

Ck 400 15 30 400 400 Ck 400 15 30 400 400

Total RNA was extracted from 0.18 g of leaf tissues using manual (Trizol) method. Prime Script™RT reagent kit with gDNA eraser was used to remove the genomic DNA and cDNA synthesis. cDNA samples from different treatments were assayed by quantitative real time PCR (qRT-PCR) in the Thermal Cycler Dice® Real Time System (Bio-Rad, Hercules, CA, USA) using SYBR® Premix Ex Taq™ II (Perfect Real Time, Cat. # PRO81 A/B, Takara Co. Ltd). Shuttle PCR standard protocol were used, the reaction conditions consisted denaturation or hold on at 95  C for 30 s, followed by 40 cycles of denaturation at 95  C for 0.5 s, annealing at 60  C for 30 s and finally in dissociation process, denatured at 95  C for 15 s, annealing at 60  C for 30 s and denaturation at 95  C for 15 s. Gene-targeting primers were designed based on mRNA or expressed sequence tag (EST) for the corresponding genes as follows; SOD (F: 50 ACGGTGTGACCACTGTGACT 30 , R:50 GCACCGTGTTGTTTACCATC30 ), POD (F: 50 ATGTTTCGTGCGTCTCTGTC30 , R: 50 TACGAGGGTCCGATCTTAGC 30 ), CAT (F: 50 TCGCCATGCTGAGAAGTATC 30 , R: 50 TCTCCAGGCTCCTTGAAGTT 30 ), APX (F:50 ATGAGGTTTGA CGGTGAGC30 , R:50 CAGCATGGGAGATGGTAGG30 ), GR (F: 50 AAGCTGGAGCTGTGAAGGTT 30 , R: 50 AGACAGTGTTCGCAAAGCAG 30 ), HSP 90-1 (F:50 GCTGCTGGTGCTGATGTTAG30 , R:50 AGGAAGA GGGTCATTTTGGT30 ) MP-1 (F:50 TCTTGCTGTGGAGGAAACTG 30 , R: 50 AGCCCAAGTCTGGGTACATC 30 ), GR1 (F:50 GGGTCTAATGCAGCCAACTT 30 , R: 50 GCCAAACTTGTTTGTGGATG 30 ) and Actin gene (F:50 TTGGGATGGACCAGAAGG30 , R:50 TCAGGAGCAATACGGAGC30 ) as an internal control. The software given with the PCR system was used to calculate the threshold cycle values and quantification of mRNA levels was performed according to the method of Livak and Schmittgen (2001). The threshold cycle (Ct) value of actin was subtracted from that of the gene of interest to obtain DCt value. B. napus actin gene was used as an internal control.

Treatment

2.9. Total RNA extraction, cDNA synthesis, and quantitative realtime PCR (qRT-PCR) assays

ZS 758

For electron-microscopic study, leaf fragments without veins (about 1 mm2) and root tips (about 2e3 mm) were fixed in 2.5% (v/ v) glutaraldehyde in 0.1 M sodium phosphate buffer (PBS, pH 7.4) overnight and then washed three times with PBS. The samples were post fixed in 1% (m/v) OsO4 for 1 h and washed again three times with PBS. After that, the samples were dehydrated in a graded series of ethanol (50%, 60%, 70%, 80%, 90%, 95%, and 100%, v/v) for 15e20 min each and then in absolute acetone for 20 min. After dehydration, the samples were embedded in Spurr's resin overnight. After heating the specimens at 70  C for 9 h, the ultra-thin sections (80 nm) were cut and mounted on copper grids for observation in the transmission electron microscope (TEM 1230EX, JEOL, Japan) at 60.0 kV.

133

Cultivar

2.8. Cell structural observations

Table 1 Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on the length (cm) of stem, root and plant height, number of leaves per plant, leaf area (cm2) and biomass (mg plant1) of black (ZS 758) and yellow (Zheda 622) seeded Brassica napus.

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

134

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

3. Results Results related to growth parameters (fresh weight, dry weight and length of shoots, roots, and leaf area) of treated and untreated plants of two B. napus cultivars (ZS 758 and Zheda 622) are shown in Table 1. Addition of Cr (400 mM) into solution significantly reduced the stem and root length, plant height, number of leaves per plant and leaf area as compared to control. Cr-toxicity clearly decreased the above mentioned parameters by 40%, 25%, 27%, 43% and 27%, in cultivar ZS 758, and 55%, 48%, 43%, 52% and 41% in Zheda 622, respectively. Furthermore, data regarding the fresh and dry biomass stated that both fresh and dry matter contents were significantly decreased under Cr (400 mM) stress as compared to control. The application of Cr (400 mM) significantly reduced the fresh weight of leaf, stem and root of cultivar ZS 758 to 35%, 28% and 25% and the dry weight by 42%, 38% and 23%, respectively. Similarly, in Zheda 622 the fresh weight of leaf, stem and root was decreased by 51%, 49%, and 40% and the dry weight to 64%, 44% and 46%, respectively. Exogenous application of ALA (15 mg/L and 30 mg/L) caused the significant improvement in plant fresh and dry matter contents under Cr (400 mM). Both ALA treatments played a pivotal role to recover the negative effects of heavy metal, however higher level of ALA (30 mg/L) showed better effects. Beside this, addition of ALA together with Cr exhibited the significant alleviations as compare with Cr induced reduction in these growth parameters (Table 1). In the present study, Cr stress decreased the pigment contents in both cultivars, while ALA contents significantly increased under Cr stress (Table 2). Data showed that Cr stress reduced chlorophyll attributes and carotenoid contents of cultivar ZS 758 by 26%, 23%, 26% and 18% in leaf and in stem by 33%, 41%, 35% and 40%. Correspondingly, chlorophyll parameters of Zheda 622 deteriorated by 42%, 43%, 44% and 30% in leaf and in stem by 46%, 62%, 49% and 66%, respectively. Results indicated that cultivar ZS 758 showed more tolerance than Zheda 622. However, exogenous application of ALA significantly increased the chlorophyll contents at both concentrations but impact was more obvious with 30 mg/L. Moreover, results showed that chlorophyll recovery in stem was prominent as compared with leaf in both cultivars (Table 2). The statistical analysis (ANOVA followed by DMRT) of Cr, ALA, cell death and relative water contents (RWC) showed the significant differences between cultivars and treatments for all parameters under control, Cr alone and Cr þ ALA treatments (Table 3). Data regarding the Cr contents of cultivar ZS 758 showed that Cr

contents were increased by 125% in leaf and 118% in root as compared to control. Addition of ALA significantly decreased its accumulation upto 13% and 40% in leaf and 14% and 40% in roots (ALA 15 and 30 mg/L, respectively). Higher accumulation of Cr was observed in cultivar Zheda 622 in all treatments as compared to ZS 758. The results showed that application of ALA significantly reduced the Cr contents in leaf and roots of cultivar Zheda 622 as compared to Cr alone treatment. In both cultivars, the higher level of ALA (30 mg/L) reduced the Cr accumulation in plants than lower dose of ALA (15 mg/L). Similarly, LC-MS data verified the toxic effect of Cr and showed that ALA contents significantly decreased under Cr stress as compared to control (Table 3). Exogenously applied ALA improved ALA contents upto 42% and 107% in both cultivars ZS 758 and Zheda 622 respectively. Likewise, data regarding cell death contents using Evans Blue dye as a marker have been shown in Table 3. Amount of dead cells were higher in roots as compared to leaf in both cultivars under 400 mM Cr level; while, application of ALA under Cr stress decreased cell death contents in both root and shoot as compared to 400 mM Cr treatment. Moreover, the dead/live cell ratio was more in cultivar Zheda 622 than ZS 758. Data regarding the relative water content (RWC) presented that Cr significantly decreased the water holding capacity of leaf in both cultivars as compared to relative controls. Furthermore, results suggested that negative impact of Cr was more in cultivar Zheda 622. Exogenous application of ALA significantly reduced the toxic effects of Cr and recovered the corresponding parameters to significant level (Table 3). The results showed that MDA and ROS contents were more obvious in cultivar Zheda 622 (Table 3). The MDA and eOH contents were more prominent in cultivar ZS 758 but in Zheda 622, all these parameters were significantly increased than cultivar ZS 758 under Cr stress. Thus, results indicated that increased level of H2O2 and O. 2 in cultivar Zheda 622 as compared to ZS 758 was the deciding factor. The histochemical detections of H2O2 and O 2 in roots with DAB and NBT staining methods also supported the agreement of ROS results. Furthermore, the colored spots (red and blue) also indicated the physical presence of ROS production. Fig. 1 described that both color spots were more visible in cultivar Zheda 622 than in ZS 758 under the Cr stress as compared to control. Exogenous application of ALA significantly reduced the negative effects of lipid peroxidation and ROS. ALA at 30 mg/L significantly reduced the MDA and ROS in both cultivars but positive impact was more on ZS 758 (see Fig. 2). The data regarding the antioxidant and non-enzymatic antioxidant enzymes are presented in Table 4. Activities of antioxidant

Table 2 Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on chlorophyll and carotenoid contents [(mg g1(FW)] in the leaves of black (ZS 758) and yellow (Zheda 622) seeded Brassica napus. Cultivar

Treatment

Chlorophyll content in leaf Chl a

ZS 758

Zheda 622

Ck 400 15 30 400 400 Ck 400 15 30 400 400

þ 15 þ 30

þ 15 þ 30

49.10 36.17 48.00 50.20 39.22 44.83 48.90 28.25 48.50 49.00 31.88 35.07

Chl b ± ± ± ± ± ± ± ± ± ± ± ±

2.05ab 2.07c 2.05ab 3.05a 2.02c 3.03b 3.05ab 2.16e 2.05ab 2.5ab 2.08de 2.07cd

8.46 6.51 8.60 8.84 6.84 7.75 8.37 4.76 8.38 8.42 5.36 6.58

± ± ± ± ± ± ± ± ± ± ± ±

Chlorophyll content in stem Total Chl

1.06ab 0.41cd 1.05a 1.04a 0.64bed 0.65aec 1.07ab 0.46e 1.08ab 1.02ab 0.56de 1.08cd

57.56 42.68 56.60 59.04 46.06 52.58 57.27 32.34 56.88 57.42 37.24 41.65

± ± ± ± ± ± ± ± ± ± ± ±

4.06a 2.08bc 4.05a 4.04a 3.06b 4.06a 5.07a 4.04d 4.08a 5.02a 2.04cd 3.05bc

Carotenoid

Chl a

± ± ± ± ± ± ± ± ± ± ± ±

13.9 9.25 13.87 14.05 10.24 11.49 13.76 7.44 13.74 13.88 8.16 9.20

3.44 2.83 3.43 3.49 3.04 3.33 3.42 2.41 3.45 3.53 2.61 2.88

0.34a 0.23cd 0.43a 0.29a 0.24bc 0.23b 0.22a 0.21d 0.25a 0.23a 0.21cd 0.28c

Chl b ± ± ± ± ± ± ± ± ± ± ± ±

1.05a 1.05cd 1.07a 1.05a 1.04bc 1.09b 1.06a 1.04d 1.04a 1.08a 1.06d 1.05cd

3.84 2.26 3.87 3.86 2.69 3.41 3.79 1.46 3.76 3.82 2.22 2.61

Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range tests.

± ± ± ± ± ± ± ± ± ± ± ±

Total Chl 0.24a 0.16c 0.37a 0.26a 0.19b 0.11a 0.39a 0.16d 0.16a 0.32a 0.12c 0.21bc

17.74 11.51 17.74 17.91 12.93 14.90 17.55 8.90 17.50 17.70 10.38 11.81

± ± ± ± ± ± ± ± ± ± ± ±

1.04a 1.01cd 1.04a 1.01a 1.03c 1.05b 1.05a 1.05e 1.05a 1.05a 1.08de 1.01cd

Carotenoid 0.8 0.48 0.83 0.84 0.57 0.68 0.83 0.28 0.81 0.84 0.36 0.52

± ± ± ± ± ± ± ± ± ± ± ±

0.05a 0.03d 0.08a 0.04a 0.04c 0.05b 0.05a 0.02f 0.03a 0.04a 0.03e 0.04cd

78.0 128 79.0 76.0 116 102 81.0 153 82.0 81.0 138 122 ± ± ± ± ± ± ± ± ± ± ± ± 3.11 5.21 3.22 3.09 4.72 4.01 3.14 7.08 3.11 3.05 6.43 5.69

OH

± ± ± ± ± ± ± ± ± ± ± ± 0.04f 0.03f 1.06d 1.02e 0.04f 2.07a 0.04f 0.06f 1.05b 1.06cd

5.5 3.1 5.4 5.9 36 4.4 4.8 1.4 4.6 5.2 2.3 2.9 0.04f

1.12 ± 16.711.01c± 1.09 ± 0.70 ± 14.36 ± 10.02 ± 1.26 ± 21.17 ± 1.14 ± 0.94 ± 19.35 ± 15.76 ± Zheda 622

þ 15 þ 30

þ 15 þ 30

Ck 400 15 30 400 400 Ck 400 15 30 400 400 ZS 758

0.08 0.62 0.12 0.11 0.54 0.37 0.09 0.85 0.10 0.07 0.76 0.56

± ± ± ± ± ± ± ± ± ± ± ±

0.01gh 0.04c 0.01f 0.01fg 0.02d 0.02e 0.01feh 0.02a 0.02feh 0.01h 0.03bh 0.02d

Root Leaf

Cr content Treatment

Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range test.

0.50 10.54 0.49 0.51 7.39 5.14 0.48 14.68 0.51 0.47 12.52 9.08 0.005e 0.47bc 0.004e 0.002e 0.19c 0.28d 0.006e 1.06a 0.002e 0.002e 1.04a 0.46b ± ± ± ± ± ± ± ± ± ± ± ± 0.04 4.97 0.04 0.02 4.29 2.48 0.05 7.56 0.03 0.03 6.84 5.36 0.3ab 0.2fg 0.04 a-c 0.6 a 0.2 f 0.4 e 0.5 cee 0.01 i 0.3 de 0.6 bed 0.2 h 0.3 gh

Leaf

ALA cont.

Cell death

Root

± ± ± ± ± ± ± ± ± ± ± ±

0.02g 1.04c 0.01g 0.02g 1.09e 0.34f 0.03g 1.08a 0.03g 0.01g 1.02b 1.08d

RWC

86.19 68.72 87.14 89.08 72.35 77.19 84.37 56.28 83.06 88.3 60.97 65.78

± ± ± ± ± ± ± ± ± ± ± ±

4.09a 3.02cd 4.04a 4.08a 3.05bc 3.09b 4.07a 3.08f 3.06a 4.05a 3.07ef 2.08de

MDA

94.28 240.61 89.60 90.42 190.07 136.77 97.70 370.14 96.23 91.67 316.48 254.97

± ± ± ± ± ± ± ± ± ± ± ±

4.08f 10.01c 5.0f 5.02f 10.07d 6.07e 5.05f 20.04a 6.03f 6.07f 16.08b 9.07c

H2O2

ROS

0.21e 0.41bc 0.22e 0.24e 0.22c 0.21d 0.14e 1.08a 0.21e 0.25e 0.33a 0.39b

O 2

± ± ± ± ± ± ± ± ± ± ± ±

3.5f 8.0bc 4.5f 4.5f 6.0d 7.0e 6.0f 12.5a 3.0f 5.0f 7.5b 6.5cd



0.18 0.50 0.19 0.16 0.41 0.34 0.20 0.80 0.21 0.18 0.73 0.64

± ± ± ± ± ± ± ± ± ± ± ±

0.02g 0.05d 0.02g 0.01g 0.03e 0.03f 0.02g 0.05a 0.02g 0.01gb 0.05b 0.04c

135

Cultivar

enzymes such as superoxide dismutase (SOD), guaicol peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) were significantly enhanced in both cultivars under 400 mM Cr treatment as compared with respective controls. Furthermore, activities of these enzymes were increased to 72%, 185%, 149%, 149% and 342% in cultivar ZS 758 and 38%, 90%, 93%, 76% and 135% in Zheda 622 under 400 mM Cr treatment, respectively. Application of exogenous ALA at 30 mg/L significantly improved all enzymatic activities in both cultivars but impact was more obvious in ZS 758. Dissimilarly, the data regarding total soluble protein (TSP) stated that protein contents statistically decreased under stress conditions (400 mM Cr) in both cultivars as compared with untreated respective controls (Table 4) but impact was more prominent in Zheda 622. Furthermore, the results stated that TSP contents were decreased by 21% in ZS 758 and 34% in Zheda 622 under 400 mM Cr treatment; while, ALA application increased TSP contents in both cultivars under Cr stress. Besides the enzymatic defense machinery, we also studied non-enzymatic antioxidant response under different treatments of Cr and ALA (Table 4). Nonenzymatic antioxidant named as glutathione reduced (GSH) and glutathione oxidized (GSSG) levels were increased in both cultivars under Cr stress as compared to control. Under the Cr stress alone, GSH contents were increased by 37% and 16%; GSSG contents were increased by 139% and 60% in ZS 758 and Zheda 622, respectively. Exogenously applied ALA further improved this secondary defense mechanism in both cultivars by enhancing GSSG contents under Cr stress (Table 4). Anatomical observations showed that Cr (VI) adversely affected the internal structures of leaf as compared to the control in both cultivars. However, addition of ALA under Cr stress improved the damaged parts of the cells as compared to the Cr treatment alone (Fig. 3). The TEM micrographs of leaf mesophyll cells of both cultivars (ZS 758 and Zheda 622) at control respectively showed a well-developed mitochondria with visible cristae, a clear cell wall, appropriately arranged grana, a perforate receptor called peroxidase (Fig. 3A and D). Furthermore, ultrastructural micrographs showed a rough endoplasmic reticulum (RER), plasmodesmata, a starch grain and noticeable chloroplast membrane. Dissimilarly, under the Cr concentration (400 mM), there were increased number of and/or clustering of plastoglobuli structures (Zheda 622) embedded in starch grains (ZS 758), swollen cristae in immature mitochondria, swelling and rupturing of grana structures, disruption of cell wall, thylakoid membranes and non-visibleness of chloroplast membrane (Fig. 3B and E). Exogenously applied ALA (30 mg/L) along with Cr (400 mM) considerably recovered the cell structural damages as having appearance of grana structure along with thylakoid membranes, cell wall and well developed mitochondrion structures (Fig. 3C and F). It can be observed that thylakoid structures of Zheda 622 still not fully clear or visible (Fig. 3F). Thus, it can be suggested that cultivar Zheda 622 was less responsive to ALA application. The TEM ultrastructure of root tip cells of both cultivars at control showed well developed nucleus with visible nucleolus and nuclear membrane, clear and smooth cell wall, mature mitochondria with clear cristae structures, well developed plastid, Golgi bodies and RER (Fig. 6A and D). Cr induced considerable ultrastructural damages in root tip cells of both cultivars as compared to control (Fig. 4B and E). It can be noted that Cr significantly succeeded to break the cell wall, scattering of nucleolus in nucleus, irregularity in mitochondrion shape and swelling of cristae but nucleus is still clear and visible (Fig. 4B). Dissimilarly, Cr badly damaged cell structure, broke the nuclear membrane thus the chromosome moved-out to cytoplasm and also cell showed immature mitochondria with swollen cristae in Zheda 622 (Fig. 4E). Observations showed that ALA at 30 mg/L

Table 3 Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on Cr contents (mg Kg1 DW), cell death content (dead/live cell ratio), ALA contents (mg/g FW), RWC, contents of MDA (nmol mg1 protein) and ROS (mmol g1 FW) in the leaves of black (ZS 758) and yellow (Zheda 622) seeded Brassica napus.

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

136

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

successfully recovered the negative impacts of Cr stress with the unbroken cell wall, nucleus along with nuclear membrane and nucleolus, mitochondria with visible cristae and plastid (Fig. 4C and F). Moreover, in Zheda 622, large numbers of vacuoles were noticed having black spots that indicating presence of metal contents. Results of root micrographs also presented that cultivar ZS 758 showed the tolerance attitude towards adverse conditions than Zheda 622. The relative mRNA level of SOD, POD, CAT, APX and GR was up-regulated with Cr alone and both ALA þ Cr treatments than control (Fig. 5). Moreover, the expression of all these enzymatic related genes was highly expressed under ALA þ Cr treatments as compared to Cr alone. Transcript level of genes was increased by 77%, 76%, 177%, 63% and 51%, respectively in cultivar ZS 758 and 37%, 25%, 113%, 47% and 22% in Zheda 622 under Cr stress as compared with their respective controls. Exogenous application of both ALA treatments further enhanced the expression levels than Cr-treated plants. Furthermore, data also suggested that genes expression of all above mentioned antioxidants were more pronounced in ZS 758 than Zheda 622 (Fig. 5). Besides, transcripts level of stress related protein's genes such as HSP90-1, MT-1 and GR1 were studied in the leaves of both cultivars

when subjected to Cr stress alone and/or in combination with ALA treatments. Cr stress increased the gene expression of cultivar ZS 758 by 42%, 64% and 25% and Zheda 622 by 21%, 40% and 24%, respectively to all protein's gene as compared to control (Fig. 6). Moreover results showed that mRNA of MT-1 was up-regulated more than other protein's gene and its higher expression was observed in both ALA treatments as compared to Cr alone. GR1 gene was down-regulated under Cr stress as compared to control in cultivar Zheda 622. However, ALA treatments significantly recovered the GR1 transcript level upto 100% and 195%, respectively. 4. Discussion In nature, plants have an inherent competency to sequester or scavenge the wide spectrum of heavy metals to make them inactive or less toxic forms (Coleman et al., 1997). Till yet, plant scientists are unable to determine which concentration of Cr-exposure can activate the stress response mechanism in B. napus that is similar to all kinds of environmental stressors in other plants. Recent reports suggest the alleviating roles of ALA in plants against various abiotic stresses (Akram et al., 2012; Watanabe et al., 2000; Awad, 2008). To

Fig. 1. Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, and 30 mg/L) on root tip of ZS 758 (A: CK, B: 400 mM Cr, and C: 400 mM Cr þ 30 mg/L ALA) and Zheda 622 (D: CK, E: 400 mM Cr, and F: 400 mM Cr þ 30 mg/L ALA) treated with nitro-blue tetrazolium (NBT). Strength of color showed the negative effect of O 2 . (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

date the promotive role of ALA in alleviation of Cr stress has not been explored. In the current study, an increased tolerance and detoxification of Cr by foliar application of ALA in black and yellow seeded B. napus has been investigated. The present study indicated that Cr-toxicity significantly inhibited the plant growth parameters (Table 1). Deterioration in plant growth is possibly due to the adverse effect of Cr on physiology and changes in plant mineral uptake profile. Besides, reduction in leaf and stem growth might be due to Cr-induced alteration in photosystem, lead to limitation of biosynthesis activities that result in biomass reduction (Pandey et al., 2009; Ali et al., 2013c). Moreover, Cr-caused stunted root growth and development possibly due to the lessening of cell division and its size (Sharma and Dubey, 2005). In contrast, exogenously applied ALA significantly improved the plant growth under Cr stress conditions (Table 1). This effect might be linked to the fact that ALA has a promotive role in regulating a number of metabolic processes, thereby improving the growth and yield of most plants under abiotic stresses (Akram et al., 2012). Furthermore, ALA is found to be a growth promoter by increasing the macroelements (Na, P, K and Ca) accumulation in the plants under the stress regimes (Naeem et al., 2010). Recently, it has been

137

reported that ALA improved the growth of B. napus plants by mitigating the deleterious effects of cadmium (Cd) (Ali et al., 2013a). The data regarding chlorophyll and carotenoid contents showed that Cr-toxicity had the negative impacts on both cultivars in leaf and stem as compared to untreated plants (Table 2). Deterioration of Chl parameters may be due to the disturbance of related protein complex, thylakoid structures in chloroplast and photosynthetic machinery (Vassilev et al., 1995) and restrain in photosynthetic electron transport movement (Mohanty et al., 1989). Furthermore, reduction of Chl attributes might be due to that heavy metal induced up-regulation of chlophyllase activity (Heged et al., 2001). It was noted that both ALA treatments showed significant alleviating effects however, 30 mg/L had more positive effects. Previously, Wang et al. (2004) reported similar results by using ALA as an elevator in melons (Cucumis melo) seedlings when subjected to low light and chilling stress. Furthermore, their results are in favor of our study that improvements in Chl parameters by ALA foliar application may be due to up-raising of photosynthesis related attributes because it is the key biosynthetic precursor of all tetrapyrrole compounds, and has been suggested to contribute in increase of photosynthesis. In

Fig. 2. Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, and 30 mg/L) on root tip of ZS 758 (A: CK, B: 400 mM Cr, and C: 400 mM Cr þ 30 mg/L ALA) and Zheda 622 (D: CK, E: 400 mM Cr, and F: 400 mM Cr þ 30 mg/L ALA) treated with 3, 3-diaminobenzidine (DAB). Strength of color showed the negative effect of H2O2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

1.07a 0.43d 1.01a 1.08a 0.26d 0.25d 1.01a 0.61bc 1.08a 1.03 ab 0.44cd 0.37d ± ± ± ± ± ± ± ± ± ± ± ± 8.07 4.63 7.81 7.58 4.16 3.75 8.41 6.11 8.08 7.33 4.94 4.57 1.04f 1.02b 1.08ef 1.05ef 1.09b 1.06a 1.06f 1.08de 1.05f 1.05ef 1.03cd 1.04bc ± ± ± ± ± ± ± ± ± ± ± ± 10.34 15.32 10.48 10.55 15.99 17.86 10.26 12.38 10.35 10.5 13.43 14.94 ± ± ± ± ± ± ± ± ± ± ± ± 1.14 2.72 1.19 1.23 3.1 3.76 1.09 1.74 1.14 1.26 2.26 2.68 9.2 12.6 9.29 9.32 12.89 14.1 9.17 10.64 9.21 9.24 11.17 12.26 Zheda 622

þ 15 þ 30

þ 15 þ 30

Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range tests.

59.7 264 66 69.1 303 437 63.4 149 65.9 68.4 181.9 268.2 861 682 864 871 733 816 858 567 853 861 613 680 1.07 2.66 1.13 1.26 3.19 4.27 1.03 1.81 1.17 1.22 2.24 2.78 69.2 172 74 88 224 285 67 129 69 76 162 217 0.89 2.54 0.97 1.09 3.18 4.01 0.83 1.58 0.88 1.12 1.95 2.68 Ck 400 15 30 400 400 Ck 400 15 30 400 400 ZS 758

380 654 394 415 728 817 373 514 407 419 544 613

Treatment Cultivar

SOD

± ± ± ± ± ± ± ± ± ± ± ±

25e 44c 24e 25c 58b 47a 23e 44d 27e 29e 44d 33c

POD

± ± ± ± ± ± ± ± ± ± ± ±

0.5g 0.1c 0.07fg 0.09f 0.08b 0.21a 0.03g 0.08e 0.04 g 0.07f 0.15d 0.18c

CAT

± ± ± ± ± ± ± ± ± ± ± ±

5.2f 12c 4ef 8e 14b 15a 7f 9d 9f 6ef 7c 7b

APX

± ± ± ± ± ± ± ± ± ± ± ±

0.05gh 0.06c 0.08feh 0.06f 0.14b 0.17a 0.08h 0.11e 0.07feh 0.07 fg 0.09d 0.08c

TSP

± ± ± ± ± ± ± ± ± ± ± ±

31 ab 22d 14ab 31a 23c 26b 28 ab 37e 33 ab 31 ab 23e 30d

GR

± ± ± ± ± ± ± ± ± ± ± ±

4.7f 14c 6f 5.1f 13b 27a 8.4f 9e 5.9f 6.4f 6.9d 18.2c

GSH

± ± ± ± ± ± ± ± ± ± ± ±

1.05d 1.05 ab 1.09d 1.02d 1.09 ab 1.05a 1.07d 1.04cd 1.01d 1.04d 1.07bed 1.06aec

GSSG

0.04f 0.07c 0.05f 0.08f 0.15b 0.16a 0.05f 0.09e 0.07f 0.06f 0.16d 0.13c

GSH þ GSSG

GSH/GSSG

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143 Table 4 Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on enzymatic [SOD (U g1 FW), POD, CAT, APX and GR (mmol min1 mg1 protein)], non-enzymatic [GSH and GSSG (mmol min1 mg1 protein)] antioxidant activities and TSP contents (mg g1 FW) in the leaves of black (ZS 758) and yellow (Zheda 622) seeded Brassica napus.

138

another report, it is stated that ALA enhances the photosynthetic efficiency and significantly improves Chl a, thus, ultimately enhancing the light-harvesting capacity of plants (Ali et al., 2013b). The results indicated that Cr contents were enhanced in different plant organs; however, ALA, cell death and RWC contents were decreased under Cr stress alone (Table 3). The higher Cr contents in roots than shoots stated the scavenging capability of plants against metal-induced changes (Najeeb et al., 2011). Furthermore, LC-MS data evidenced that Cr reduced the endogenous ALA level. It is well spoken that ALA is precursor of photosynthesis process of most of plants. Thus, it can deduce that deterioration of endogenous ALA is directly related with reduction in plant growth and development. Similarly, Tewari and Tripathy (1988) described that chilling and heat stress significantly reduced the endogenous ALA contents in cucumber and wheat that is the agreement with our results. In the present work, we noted that exogenous application of ALA decreased the movement of Cr across different organs and in the same time it recovered the cells from injury, ALA and RWC under Cr stress. It may be due to that ALA enhances the plant defense system thus preventing the uptake or movement of heavy metal in plant tissues (Ali et al., 2013a, b). So, it is proposed that exogenously applied ALA can be useful for the purpose of phyto-remediation. Further, Cr stress increased the levels of MDA and ROS in the leaves of both cultivars (Table 3). MDA and ROS contents were found higher in cultivar Zheda 622 which showed that cultivar ZS 758 had more resistance against Cr stress. Besides, histochemical observations were also in the favor of ZS 758 and depicted more colored spots in roots of Zheda 622. However, exogenously applied ALA successfully reduced the MDA and ROS contents in both cultivars. It might be due to that ALA increased the dismutation activity of SOD against ROS in plant cells (Bowler et al., 1992). ROS reduction under Cr stress may be due to the reason that ALA is a precursor of heme biosynthesis, so it can boast up the activities of heme-based molecules and can help in scavenging the ROS under metal toxicity. It is also noted that ALA has been found to be a ROS scavenger under stress conditions i.e. salinity (Naeem et al., 2010) and drought (Li et al., 2011), that is in agreement with our results. Certainly, plants activated their defense mechanism to scavenge and detoxify the heavy metals (Liu et al., 2009; Masood et al., 2012). Results described that content of antioxidants activities (SOD, POD, CAT, APX and GR) were induced by Cr alone or combined with ALA treatments. Moreover, transcript level of these enzymatic antioxidants was also up-regulated when subjected to Cr stress alone and further by ALA treatments. Similarly, Nishihara et al. (2001) reported that ALA enhanced the activities of CAT, APX and GR under the salinity stress. Li et al. (2011) also described that foliar application of ALA statistically increased the plant defense machinery such as APX, SOD, CAT, GR, in cucumber plants (Cucumis sativus) under drought environment. In the present study, both Cr and ALA treatments showed an additive upregulation of all above mentioned activities and their genes expression which indicated the post transcriptional activation of corresponding enzymes activities that could scavenge different ROS in plant cells. Interestingly, spectrophotometric data also showed prominence of POD, CAT and APX but qRT-PCR mentioned the SOD and CAT among all described antioxidants activities. ALA is an essential biosynthetic precursor of heme which is a necessary component for the activity of APX, CAT and POD (Tsiftsoglou et al., 2006) and enhanced heme accumulation under ALA application can modulate the H2O2 eliminating enzyme activities in Cr stressed plants (Table 4). Recently, Ahammed et al. (2013) reported the similar results that CAT activity decreased but transcript level

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

was enhanced under the Cd stress. Furthermore, Mittler (2002) stated that increased level of antioxidants has a pivotal role in deteriorating the ROS activity, thus plants could be able to maintain their physiological functions under the stress environment. Besides, Ahammed et al. (2013) described that brassinosteroids induced the up-regulation of antioxidant enzymes activities and related genes level under the phenanthrene and Cd stress which proved our results. Consequently, the up-regulation of these transcripts level possibly is the outcome of de-novosynthesis and/ or increased activity of related enzymes against ALA-mediated transcription and/or translation of corresponding genes (Bajguz, 2000). The increase of ALA-mediated gene expression in Cr stress plants showed the triggering effect of ALA at the gene level to enhance metal stress tolerance in Brassica plants. Along with primary defense mechanism, plants also activated their nonenzymatic antioxidant system named as GSH and GSSG to further strengthen the shield against stressful regime. Moreover, Gossett et al. (1994) published similar results and described the protective role of reduced/oxidized ratio in alleviating the damages in cotton leaves. Activities of these antioxidants were induced under the Cr alone, and with ALA as compared to their respective controls which was also proved earlier by Nishihara et al. (2001, 2003). Thus, ALA contributed to reduce oxidative stress via higher antioxidant concentrations and antioxidant enzyme activities in Cr stress plants, thereby improving restricted plant growth

139

under Cr-induced oxidative stress. In current work, B. napus mesophyll cells and root tip cells showed significant alterations under Cr toxic environment. Cell chloroplasts are extensively prone to the negative effects of ROS (Zhang et al., 2003). According to the results, Cr caused the marked changes in the form of enhanced number of and/or clustering of plastoglobuli, swelling and damaging of grana and non-visibleness of chloroplast membrane. Recently, Qian et al. (2014) stated similar findings that aluminum toxicity badly disrupts the thylakoid membranes in B. napus plants. Moreover, metal badly damaged the root ultrastructure likewise the dilution of nucleolus and breakage of nuclear membrane, hence chromosome moved out to the cytoplasm. Previously, it is well documented that heavy metal induced the cell structural damages in different organs and increased the metal uptake in plants (Gill et al., 2014; Sanita et al., 2003). On the other hand, exogenous application of ALA significantly improved these cell alterations under Cr stress. These results proposed that ALA has the capability to enhance the synthesis of chloroplasts by increasing and repairing the grana lamellae, and chlorophyll biosynthesis which can contribute to photosynthesis mechanism in plants (Zhang et al., 2008). As compared with Cr treatment, ALA application noticeably reduced the number of plastoglobuli structures that is the additional ameliorative role of ALA that may be due to the reduction of lipid peroxidation level and

Fig. 3. Electron micrographs of leaf mesophyll of 14-days hydroponic treated seedlings with different concentrations of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, and 30 mg/L) of black seeded (ZS 758) and yellow seeded (Zheda 622) Brassica napus cultivars. (A) TEM micrograph of leaf mesophyll cells of ZS 758 under control (CK) show clear cell wall (CW), mitochondria (M), peroxidase (Po), rough endoplasmic reticulum (RER), thylakoid (Thy) and plasmodesmata (Pd). (B) TEM micrographs of leaf mesophyll cells of ZS 758 under 400 mM Cr alone show plastoglobuli (PG), chloroplast membrane (Chl M), cell wall (CW), starch granules (SG) and thylakoids (Thy). (C) TEM micrograph of leaf mesophyll cells of ZS 758 under combined treatment of ALA (30 mg/L) and Cr (400 mM) shows increased starch grain (SG), plastoglobuli (PG), thylakoids (Thy) and well developed cell wall (CW). (D) TEM micrographs of leaf mesophyll cells of Zheda 622 under control show the continuous cell wall (CW), mitochondria (M), thylakoid (Thy) and starch grain (SG). (E) TEM micrographs of leaf mesophyll cells of Zheda 622 under 400 mM of Cr show immature mitochondria (M) with swollen cristae (Ct), thylakoids (Thy), and plastoglobuli (PG). (F) TEM micrographs of leaf mesophyll cells of Zheda 622 under combined treatment of ALA (30 mg/L) and Cr (400 mM) also show recovered cell wall (CW) and thylakoid membrane (Thy).

140

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

Fig. 4. TEM micrographs of root tip cells of 14-days hydroponically grown seedlings treated with different concentration of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, and 30 mg/L) of black seeded (ZS 758) and yellow seeded (Zheda 622) Brassica napus cultivars. (A) Root tip cells of ZS 758 under control (CK) show well developed cell wall (CW), clear and oval shaped mitochondria (M), plastids (P), golgibodies (GB), starch grain, rough endoplasmic reticulum (RER), nuclear membrane (NM), nucleus (N) and nucleolus (Nue). (B) TEM micrographs of root tip cells of ZS 758 under 400 mM Cr alone show immature mitochondria (M), plastids (P), nucleus (N) along with nucleolus (Nue) and discontinues cell wall (CW). (C) TEM micrographs of root tip cells of ZS 758 under combined stress of ALA (30 mg/L) and Cr (400 mM) show well developed cell wall (CW), rough endoplasmic reticulum (RER), clearly recovered nucleus (N) along with nucleolus (Nue), visible nuclear membrane (NM), mitochondria and plastids (P). (D) TEM micrographs of root tip cells of Zheda 622 under control show well developed cell wall (CW), nucleus (N) and nucleolus (Nue), clear nuclear membrane (NM) and mitochondria (M). (E) TEM micrographs of root tip cells of Zheda 622 under 400 mM Cr alone show broken cell wall (CW), scattered nucleus (N) and nucleolus (Nue). (F) TEM micrographs of root tip cells of Zheda 622 under combined stress of ALA (30 mg/L) and Cr (400 mM) show recovered cell wall (CW) and nucleus (N) along with nucleolus (Nue).

enhancement of antioxidant enzyme activities. In the support of this assumption, Nishihara et al. (2003) and Nakano and Asada (1981) found that ALA enhanced the levels of the antioxidants like APX and CAT, and APX regulation caused the deterioration of H2O2 in Halliwell-Asada chloroplast pathway, respectively. Therefore, ALA may be employed as effective approach to improve plant growth by repairing and protecting vital internal structures under stress conditions. In addition to genes regarding the enzymatic oxidants, we also studied the expression pattern of stress related proteins under Cr stress. Moreover, these proteins genes such as HSP90-1, MT-1 and GR1 were induced except GR1 that was decreased in cultivar Zheda 622. ALA further enhanced the expression level of these genes (HSP90-1 and MT-1) and recovered the transcript level of GR1 as compared with Cr stress. The increased transcripts level of MT-1 and then HSP90-1 showed that B. napus plants successfully activated their stress respond mechanism to cope with metal stress as Cr, and mitigated the protein damage and preserved the cellular homeostasis. Our results are in line with Hall (2002) and Goupil et al. (2009) who also conclude that MTs and HSP90-1 play a key role to protect the plants from metal stress. Furthermore, MTs were also projected to deal with both metal chaperoning and ROS scavenging (Wang et al., 2010). It is well documented that As and Cd stress induce MTs gene expression and accumulation (Goupil et al., 2009). Data showed that GR1 fold level was decreased in Zheda 622, which might be due to that this cultivar proved to be a less tolerant or might not activate molecular

mechanism against Cr stress via GR pathway (Goupil et al., 2009). Moreover, it has been reported that GR activity enhanced under boron and Cd-toxicity in plants, respectively (Tombuloglu et al., 2012; Gill and Tuteja, 2010). Up-regulation of GR1 in cultivar ZS 758 indicates that Cr-induced ROS can stimulate the corresponding gene. Thus, ALA can regulate the expression of the different stress related genes in B. napus plants under Cr stress. The results of the present study are consistent with the physiological responses of Cr-stressed plants to ALA, indicating that ALA mitigates Cr stress in B. napus plants through improving gene expression and plant physiology. 5. Conclusions Exogenously applied ALA pretreatment is proposed to alleviate the negative effect of Cr as revealed by significantly improved morpho-phsyiological and related genes profile, cell structural damages and stress related protein's genes. The present study suggested that genotypes responded differentially regarding their defense mechanism to cope with pollutant. Moreover, ALA proved to be a pivotal elevator thus, it significantly recovered the ultrastructural cracks. Data also mentioned that black seeded cultivar ZS 758 showed better tolerance under Cr stress as compared to yellow seeded cultivar Zheda 622 across all above mentioned parameters. Besides, this study proposes the negative effects of Cr and mitigation with ALA by using Hoagland's solution as a basal medium, and thus these findings would

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

141

Fig. 5. Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on transcript level of SOD (A), POD (B), CAT (C), APX (D) and GR (E) related genes expression in leaves of black seeded (ZS 758) and yellow seeded (Zheda 622) Brassica napus cultivars. Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range tests.

Fig. 6. Effect of different treatments of chromium (Cr) (0 and 400 mM) and 5-aminolevulinic acid (ALA) (0, 15 and 30 mg/L) on expression rate of stress responsive proteins related genes like MT-1 (A), HSP90-1 (B) and GR1 (C) in leaves of black seeded (ZS 758) and yellow seeded (Zheda 622) Brassica napus cultivars. Means followed by same small letters are not significantly different at P  0.05 by using the Duncan's multiple range tests.

be helpful to the researchers investigating on bioremediation. Furthermore, plants have the different isoforms of stress responsive protein's genes that are available in the data base. So, further studies could establish that can produce more valuable results to compare which isoform would prove efficient against the metal toxicity.

Acknowledgments Authors would like to appreciate the National High Technology Research and Development Program of China (2013AA103007), Jiangsu Collaborative Innovation Center for Modern Crop Production, Special Fund for Agro-scientific Research in the Public Interest

142

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143

(201303022), the Science and Technology Department of Zhejiang Province (2012C12902-1, 2011R50026-25), and China Postdoctoral Science Foundation (2015M570512) to provide the financial support for this study. We thank Xiaodan Wu from the Center of Analysis & Measurement, Zhejiang University for her assistance during the experiment. References Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121e126. Ahammed, G.J., Choudhary, S.P., Chen, S., Xia, X., Shi, K., Zhou, Y., Yu, J., 2013. Role of brassinosterods in alleviation of phenanthrene-cadmium co-contaminationinduced photosynthetic inhibition and oxidative stress in tomato. J. Exp. Bot. 64, 199e213. Ahn, S.J., Rengel, Z., Matsumoto, H., 2004. Aluminium-induced plasma membrane surface potential and Hþ- ATPase activity in near-isogenic wheat lines differing in tolerance to aluminum. New. Phytol. 162, 71e79. Akram, N.A., Ashraf, M., Al-Qurainy, F., 2012. Aminolevulinic acid induced regulation in some key physiological attributes and activities of antioxidant enzymes in sunflower (Helianthus annuus L.) under saline regimes. Sci. Hort. 142, 143e148. Ali, B., Huang, C.R., Qi, Z.Y., Ali, S., Daud, M.K., Geng, X.X., Liu, H.B., Zhou, W.J., 2013a. 5-Aminolevulinic acid ameliorates cadmium-induced morphological, biochemical and ultrastructural changes in seedlings of oilseed rape. Environ. Sci. Pollut. Res. 72, 7256e7267. Ali, B., Wang, B., Ali, S., Ghani, M.A., Hayat, M.T., Yang, C., Xu, L., Zhou, W.J., 2013b. 5Aminolevulinic acid ameliorates the growth, photosynthetic gas exchange capacity and ultrastructural changes under cadmium stress in Brassica napus L. J. Plant Growth Regul. 32, 604e614. Ali, S., Farooq, M.A., Hussain, S., Yasmeen, T., Abbasi, G.H., Zhang, G.P., 2013c. Alleviation of chromium toxicity by hydrogen sulfide in barley. Environ. Toxicol. Chem. 32, 2234e2239. Allender, C., King, G.J., 2010. Clarifying the origins of the amphiploid species Brassica napus L. using chloroplast and nuclear molecular markers. BMC Plant Biol. 2010, 10e54. Al-Khateeb, S.A., 2006. Promotive effect of 5-aminolevulinic acid on growth, yield and gas exchange capacity of barley (Hordeum vulgare L.) grown under different irrigation regimes. J. King Saud. Uni. Agric. Sci. 18, 103e111. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Ann. Rev. Plant Biol. 55, 373e399. Awad, M.A., 2008. Promotive effects of 5-aminolevulinic acid based fertilizer on growth of tissue culture derived date palm plants (Phoenix dactylifera L.) during acclimization. Sci. Hort. 118, 48e52. Balestrasse, K.B., Tomaro, M.L., Batlle, A., Noriega, G.,O., 2010. The role of 5- aminolevulinic acid in the response to cold stress in soybean plants. Photochemistry 71, 2038e2045. Bajguz, A., 2000. Effect of brassinosteroids on nucleic acids and protein content in cultured cells of Chlorella vulgaris. Plant Physiol. Biochem. 38, 209e215. , D., 1992. Superoxide dismutase and stress tolerance. Bowler, C., Montagu, V.M., Inze Ann. Rev. Plant Physiol. Plant Mol. Biol. 43, 83e116. Bradford, N.M., 1996. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Anal. Biochem. 72, 248e254. Chatterjee, J., Chatterjee, C., 2000. Phytotoxicity of cobalt, chromium and copper in cauliflower. Environ. Pollut. 109, 69e74. Coleman, J., Blake-Kalff, M., Davies, E., 1997. Detoxification of xenobiotics by plants: chemical modification and vacuolar compartmentation. Trends Plant Sci. 2, 144e151. dal Corso, G., Farinati, S., Maistri, S., Furini, A., 2008. How plants cope with cadmium: Staking all on metabolism and gene expression. J. Integ. Plant Biol. 50, 1268e1280. Dixit, V., Pandey, V., Shyam, R., 2002. Chromium ions inactivate electron transport and enhance superoxide generation in vivoin pea (Pisum sativum L. cv: Azad) root mitochondria. Plant Cell Environ. 25, 687e693. Gill, R.A., Hu, X.Q., Ali, B., Yang, C., Shou, J.Y., Wu, Y.Y., Zhou, W.J., 2014. Genotypic variation of the responses to chromium toxicity in four oilseed rape cultivars. Biol. Plant. 58, 539e550. Gill, R.A., Zhang, L., Ali, B., Farooq, M.A., Cui, P., Yang, S., Ali, S., Zhou, W.J., 2015. Chromium-induced physio-chemical and ultrastructural changes in four cultivars of Brassica napus L. Chemosphere 20, 154e164. Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48, 909e930. Gossett, D.R., Millhollon, E.P., Lucas, M.C., 1994. Antioxidant response to NaCl stress in salt-tolerant and salt-sensitive cultivars of cotton. Crop Sci. 34, 706e714. Goupil, P., Souguir, D., Ferjani, E., Faure, O., Hitmi, A., Ledoigt, G., 2009. Expression of stress-related genes in tomato plants exposed to arsenic and chromium in nutrient solution. J. Plant Physiol. 166, 1446e1452. Hall, J.L., 2002. Cellular mechanisms for heavy metal detoxification and tolerance. J. Exp. Bot. 53, 1e11. Halliwell, B., Gutteridge, J.M.C., Aruoma, O., 1987. The deoxyribose method: asimple ‘test tube’ assay for determination of rate constants for reactions of hydroxyl radicals. Anal. Biochem. 165, 215e219. Harel, E., Klein, S., 1972. Light dependent formation of 5-aminolevulinic acid in

etiolated leaves of higher plants. Biochem. Biophys. Res. Comm. 49, 364e370. Hayat, S., Ali, B., Hasan, S.A., Ahmad, A., 2007. Brassinosteroid enhanced the level of antioxidants under cadmium stress in Brassica juncea. Environ. Exp. Bot. 60, 33e41. Heged, A., Erdei, S., Horvath, G., 2001. Comparative studies of H2O2 detoxifying enzymes in green and greening barley seedlings under cadmium stress. Plant Sci. 160, 1085e1093. Hoagland, D., Arnon, D., 1941. Physiological aspects of availability of nutrients for plant growth. Soil Sci. 51, 431e444. Hull, H.M., Morton, H.L., Wharrie, J.R., 1975. Environmental influence on cuticle development and resultant foliar penetration. Bot. Rev. 41, 421e451. Jiang, M., Zhang, J., 2001. Effect of abscisic acid on active oxygen species, antioxidative defence system and oxidative damage in leaves of maize seedlings. Plant Cell Physiol. 42, 1265e1273. Jiang, M., Zhang, J., 2002. Water stress-induced abscisic acid accumulation triggers the increased generation of reactive oxygen species and up-regulates the activities of antioxidant enzymes in maize leaves. J. Exp. Bot. 53, 2401e2410. Law, M.Y., Charles, S.A., Halliwell, B., 1983. Glutathione and ascorbic-acid in spinach (Spinacia oleracea) chloroplasts, the effect of hydrogen-peroxide and of paraquat. Biochem. J. 210, 899e903. Li, D., Zhang, J., Sun, W., Li, Q., Dai, A., Bai, J., 2011. 5-Aminolevulinic acid pretreatment mitigates drought stress of cucumber leaves through altering antioxidant enzyme activity. Sci. Hortic. 130, 820e828. Lin, C.C., Chen, L.M., Liu, Z.H., 2005. Rapid effect of copper on lignin biosynthesis in soybean roots. Plant Sci. 168, 855e861.  n-Carmona, A., Wang, Z.H., Liu, H., Weisman, D., Ye, Y.B., Cui, B., Huang, Y.H., Colo 2009. An oxidative stress response to polycyclic aromatic hydrocarbon exposure is rapid and complex in Arabidopsis thaliana. Plant Sci. 176, 375e382. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCt method. Methods 25, 402e408. Maksymiec, W., 2007. Signalling responses in plants to heavy metal stress. Acta Physiol. Plant. 29, 177e187. Maruyama-Nakashita, A., Hira, M.Y., Funada, S., Fuek, S., 2010. Exogenous application of 5-aminolevulinic acid increases the transcript levels of sulfur transport and assimilatory genes, sulfate uptake, and cysteine and glutathione contents in Arabidopsis thaliana. Soil Sci. Plant Nutr. 56, 281e288. Masood, A., Iqbal, N., Khan, N.A., 2012. Role of ethylene in alleviation of cadmiuminduced photosynthetic capacity inhibition by sulphur in mustard. Plant Cell Environ. 35, 524e533. Meng, H.B., Hua, S.J., Shamsi, I.H., Jilani, G., Li, Y.L., Jiang, L.X., 2009. Cadmium induced stress on the seed germination and seedling growth of Brassica napus L., and its alleviation through exogenous plant growth regulators. Plant Growth Regul. 58, 47e59. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405e410. Mohanty, N., Vass, I., Demeter, S., 1989. Impairment of photosystem 2 activity at the level of secondary quinine electron acceptor in chloroplasts treated with cobalt, nickel and zinc ions. Physiol. Plant. 76, 386e390. Molas, J., 2002. Changes of chloroplast ultrastructure and total chlorophyll concentration in cabbage leaves caused by excess of organic Ni (II) complexes. Environ. Exp. Bot. 47, 115e126. Momoh, E.J.J., Zhou, W.J., Kristiansson, B., 2002. Variation in the development of secondary dormancy in oilseed rape genotypes under conditions of stress. Weed Res. 42, 446e455. Momoh, E.J.J., Zhou, W.J., 2001. Growth and yield responses to plant density and stage of transplanting in winter oilseed rape (Brassica napus L.). J. Agron. Crop Sci. 186, 253e259. Naeem, M.S., Jin, Z.L., Wan, G.L., Liu, D., Liu, H.B., Yoneyama, K., Zhou, W.J., 2010. 5Aminolevulinic acid improves photosynthetic gas exchange capacity and ion uptake under salinity stress in oilseed rape (Brassica napus L.). Plant Soil 332, 405e415. Naeem, M.S., Warusawitharana, H., Liu, H., Liu, D., Ahmad, R., 2012. 5- Aminolevulinic acid alleviates the salinity-induced changes in Brassica napus as revealed by the ultrastructural study of chloroplast. Plant Physiol. Biochem. 57, 84e92. Najeeb, U., Jilani, G., Ali, S., Sarwar, M., Xu, L., Zhou, W.J., 2011. Insights into cadmium induced physiological and ultrastructural disorders in Juncus effusus L. and its remediation through exogenous citric acid. J. Hazard. Mater. 186, 565e574. Nakano, Y., Asada, K., 1981. Hydrogen-peroxide is scavenged by ascorbate-specific peroxidase in spinach-chloroplasts. Plant Cell Physiol. 22, 867e880. Nishihara, E., Kondo, K., Parvez, N.M., Takahashi, K., Watanabe, K., Tanaka, K., 2003. Role of 5-aminolevulinic acid (ALA) on active oxygen-scavenging system in NaCl-treated spinach (Spinacia oleracea). J. Plant Physiol. 160, 1085e1091. Nishihara, E., Takahashi, K., Tanaka, N., Tanaka, K., Watanabe, K., 2001. Effect of 5aminolevulinic acid (ALA) on photosynthetic rate, hydrogen peroxide content, antioxidant level and active oxygen-scavenging enzymes in spinach (Spinacia oleracea L). J. Jpn. Soc. Hort. Sci. 70, 346e352. Pandey, V., Dixit, V., Shyam, R., 2009. Chromium (VI) induced changes in growth and root plasma membrane redox activities in pea plants. Protoplasma 235, 49e55. Porra, R.J., Thompson, W.A., Kriedemann, P.E., 1989. Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls and extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim. Biophys. Acta 975, 384e394.

R.A. Gill et al. / Plant Physiology and Biochemistry 94 (2015) 130e143 Qian, P., Sun, R., Ali, B., Gill, R.A., Xu, L., Zhou, W.J., 2014. Effects of hydrogen sulfide on growth, antioxidative capacity, and ultrastructural changes in oilseed rape seedlings under aluminum toxicity. J. Plant Growth Regul. 33, 526e538. Rebeiz, C.A., Montazer-Zouhoor, A., Jopen, H.J., Wu, S.M., 1984. Photodynamic herbicides: concepts and phenomenology. Enzyme Microbiol. Technol. 6, 390e401. Sanita, D.T.L., Gremigni, P., Pawlik-Skowronska, B., Prasad, M.N.V., Cobbett, C.S., 2003. Response to heavy metals in plants: amolecular approach. In: Sanita, D.T.L., Pawlik-Skowronska, B. (Eds.), Abiotic Stresses in Plants. Kluwer Academic Publishers, Dordrecht, pp. 133e156. Schutzendubel, A., Nikolova, P., Rudolf, C., Polle, A., 2002. Cadmium and H2O2induced oxidative stress in Populus canescens roots. Plant Physiol. Biochem. 40, 577e584. Scoccianti, V., Crinelli, R., Tirillini, B., Mancinelli, V., Speranza, A., 2006. Uptake and toxicity of Cr (Cr3þ) in celery seedlings. Chemosphere 64, 1695e1703. Shanker, A.K., Cervantes, C., Loza-Tavera, H., Avudainayagam, S., 2005. Chromium toxicity in plants. Environ. Int. 31, 739e753. Sharma, D.C., Sharma, C.P., Tripathi, R.D., 2003. Phytotoxic lesions of chromium in maize. Chemosphere 51, 63e68. Sharma, P., Dubey, R.S., 2005. Lead toxicity in plants. Braz. J. Plant Physiol. 17, 35e52. Swaran, J.S.F., 2009. Structural, chemical and biological aspects of antioxidants for strategies against metal and metalloid exposure. Oxid. Med. Cell. Long. 2, 191e206. Tan, H., 2010. Enhanced seed oil production in canola by conditional expression of Brassica napus LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds. Plant Physiol. 156, 1577e1588. Tewari, A.K., Tripathy, B.C., 1988. Temperature-stress-induced impairment of chlorophyll biosynthetic reactions in cucumber and wheat. Plant Physiol. 117, 851e858. Tombuloglu, H., Semizoglu, N., Sakcali, S., Kekec, G., 2012. Boron induced expression of some stress-related genes in tomato. Chemosphere 86, 433e438. Tsiftsoglou, A.S., Tsamadou, A.I., Papadopoulou, L.C., 2006. Heme as key regulator of

143

major mammalian cellular functions: molecular, cellular, and pharmacological aspects. Pharmacol. Ther. 111, 327e345. Vassilev, A., Iordanov, I., Chakalova, E., Kerin, V., 1995. Effect of cadmium stress on growth and photosynthesis of young barley (H. vulgare L.) plants and structural and functional changes in the photosynthetic apparatus. Bulg. J. Plant Physiol. 21, 2e21. Velikova, V., Yordanov, I., Edreva, A., 2000. Oxidative stress and some antioxidant systems in acid rain-treated bean plants. Plant Sci. 151, 59e66. von Wettstein, D., Gough, S., Kannangara, C.G., 1995. Chlorophyll biosynthesis. Plant Cell 7, 1039e1057. Wang, L., Yang, L., Yang, F., Li, X., Song, Y., Wang, X., Hu, X., 2010. Involvements of H2O2 and metallothionein in NO-mediated tomato tolerance to copper toxicity. J. Plant Physiol. 167, 1298e1306. Wang, L.J., Jiang, W.B., Huang, B.J., 2004. Promotion of 5-aminolevulinic acid on photosynthesis of melon (Cucumis melo) seedlings under low light and chilling stress conditions. Physiol. Plant 121, 258e264. Watanabe, K., Tanaka, T., Kuramochi, H., Takeuchi, Y., 2000. Improving salt tolerance of cotton seedling with 5-aminolevulinic acid. Plant Growth Regul. 32, 97e101. Zhang, G.Q., Zhou, W.J., Gu, H.H., Song, W.J., Momoh, E.J.J., 2003. Plant regeneration from the hybridization of Brassica juncea and B. napus through embryo culture. J. Agron. Crop Sci. 189, 347e350. Zhang, W.F., Zhang, F., Raziuddin, R., Gong, H.J., Yang, Z.M., Lu, L., Ye, Q.F., Zhou, W.J., 2008. Effects of 5-aminolevulinic acid on oilseed rape seedling growth under herbicide toxicity stress. J. Plant Growth Regul. 27, 159e169. Zhang, Z.J., Li, H.Z., Zhou, W.J., Takeuchi, Y., Yoneyama, K., 2006. Effect of 5-aminolevulinic acid on development and salt tolerance of potato (Solanum tuberosum L.) microtubers in vitro. Plant Growth Regul. 49, 27e34. Zhou, W.J., Leul, M., 1999. Uniconazole-induced tolerance of rape plants to heat stress in relation to changes in hormonal levels, enzyme activities and lipid peroxidation. Plant Growth Regul. 27, 99e104.