1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
PLAPHY4032_proof ■ 26 August 2014 ■ 1/7
Plant Physiology and Biochemistry xxx (2014) 1e7
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.) Q3
Li-feng Wang* Danzhou Investigation & Experiment Station of Tropical Crops, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan 571737, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 April 2014 Accepted 14 August 2014 Available online xxx
Plant drought stress response and tolerance are complex biological processes. In order to reveal the drought tolerance mechanism in rubber tree, physiological responses and expressions of genes involved in energy biosynthesis and reactive oxygen species (ROS) scavenging were systematically analyzed following drought stress treatment. Results showed that relative water content (RWC) in leaves was continuously decreased with the severity of drought stress. Wilting leaves were observed at 7 day without water (dww). Total chlorophyll content was increased at 1 dww, but decreased from 3 dww. However, the contents of malondialdehyde (MDA) and proline were significantly increased under drought stress. Peroxidase (POD) and superoxide dismutase (SOD) activities were markedly enhanced at 1 and 3 dww, respectively. Meanwhile, the soluble sugar content was constant under drought stress. These indicated that photosynthetic activity and membrane lipid integrity were quickly attenuated by drought stress in rubber tree, and osmoregulation participated in drought tolerance mechanism in rubber tree. Expressions of energy biosynthesis and ROS scavenging systems related genes, including HbCuZnSOD, HbMnSOD, HbAPX, HbCAT, HbCOA, HbATP, and HbACAT demonstrated that these genes were significantly up-regulated by drought stress, and reached a maximum at 3 dww, then followed by a decrease from 5 dww. These results suggested that drought stress adaption in rubber tree was governed by energy biosynthesis, antioxidative enzymes, and osmoregulation. © 2014 Published by Elsevier Masson SAS.
Keywords: Antioxidative enzyme Drought Hevea brasiliensis Osmoregulation Photosynthesis Reactive oxygen species
1. Introduction Water deficit is a major constraint to plant growth and productivity (Monclus et al., 2006). Prolonged drought stress leads to severe problems, such as decrease in water flux, closing of stomata and reduction in carbon dioxide fixation. Tree can die of both hydraulic failure and carbon starvation during drought stress (Zeppel et al., 2013). Inhibition of photosynthesis and energy dissipation are common features under drought stress in many plant species, which reflect as Photosystem II thermostability and electron transport changes (Zhou et al., 2007; Brestic et al., 2012; Yan et al., 2013; Zivcak et al., 2014). Plant anti-drought characters are mainly
Abbreviations: ACAT, acetyl-CoA C-acetyltransferase; APX, ascorbate peroxidase; CAT, catalase; CDPK, calcium-dependent protein kinase; COA, a long-chain-fattyacyl-CoA reductase; dww, day without water; MDA, malondialdehyde; POD, peroxidase; ROS, reactive oxygen species; RWC, relative water content; SOD, superoxide dismutase. * Tel.: þ86 898 23300459; fax: þ86 898 23300315. E-mail address: [email protected].
associated with low transpiration co efficiency and osmotic adjustment, etc. Osmotic adjustment involves the accumulation of compatible solutes (low-molecular-weight organic osmolytes), such as proline, mannitol, sorbitol, fructans, sucrose and oligosaccharides (Rhodes and Hanson, 1993). These large amounts of compounds play a key role in maintaining the osmotic equilibrium and protecting membranes as well as macromolecules (Hoekstra et al., 2001; Couee et al., 2006). These regulations were related to abscisic acid (ABA), calcium-dependent protein kinase (CDPK), NADP-malic enzyme (Shao et al., 2013) and phospholipid signaling pathways (Zhu, 2002). Overexpression of key genes in these pathways, such as DREB transcription factor, enhanced drought tolerance in Arabidopsis and Lotus corniculatus (Zhou et al., 2012). In addition, overexpression of soybean ubiquitin-conjugating enzyme gene GmUBC2 can enhance drought tolerance by modulating abiotic stress-responsive genes expression in Arabidopsis (Zhou et al., 2010). Since drought stress doubtless generates reactive oxygen species (ROS) in chloroplasts and mitochondria (Apel and Hirt, 2004; Asada, 2006), so ROS-scavenging enzymes play important roles in drought tolerance responses. ROS-scavenging systems
http://dx.doi.org/10.1016/j.plaphy.2014.08.012 0981-9428/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 2/7
2
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
included superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX), monodehydroascorbate reductase (NADH), catalase (CAT), etc. Natural rubber is obtained from para rubber tree (Hevea brasiliensis Muell. Arg.). Rubber tree originated from the Amazon basin in South America. This area falling between equator and 15 S is characterized by a wet equatorial climate (Gonçalves et al., 2009). The optimal growth conditions of rubber tree are high temperature around 28 ± 2 C and high humidity about 2000e4000 mm rainfall per annum (Webster and Baulkwill, 1989; Priyadarshan et al., 2005). However, unlike traditional plantations in south America and southeast Asia, rubber tree planting in these marginal areas or non-traditional rubber-growing regions, such as northeastern states of India, south China, north and northeast Thailand, usually faces abiotic stress like drought, strong winds, and low temperature, etc. Drought stress results in growth retardation of both rubber tree seedlings and mature tapping trees, shortening tapping period, blocking latex flow for low water supply, decreasing dry latex contents, increasing TPD (tapping panel dryness) occurrence, and even causes tree death at severe conditions (Huang and Pan, 1992). Many strategies and indices were used for selecting and breeding drought-tolerant rubber tree clones, such as droughttolerant rootstock (Ahamad, 1999), leaves with more epicuticular waxes (Gururaja Rao et al., 1988), etc. Hydraulic mechanism was used for explaining drought tolerance mechanism in rubber tree (Ayutthaya et al., 2011). The development of molecular biological techniques in rubber tree provides new functional genes to extend our insights of drought tolerance mechanism. Recently, HbCuZnSOD and HbMnSOD have been cloned in rubber tree, and overexpression of HbCuZnSOD in rubber tree clone PB260 conferred enhanced drought tolerance (Leclercq et al., 2012). These results indicated that ROS-scavenging enzymes played crucial roles in drought tolerance mechanisms. Representative genes in mitochondria, such as HbAPX, an ascorbate peroxidases gene (Mai et al., 2009), and HbATP (Chye and Tan, 1992) were cloned. However, in rubber tree, the functions of most ROS related genes in drought resistance mechanism were not well identified. In this study, expressions of 8 genes involved in energy biosynthesis and ROS scavenging systems were characterized under drought treatment in seedlings of rubber tree clone GT1. The underlying drought tolerance mechanism in rubber tree was discussed. 2. Methods 2.1. Plant material and drought treatment Rubber tree clone GT1 (original clone breed in Indonesia) seedlings were grown in the plastic pots in the chamber with vermiculite and turfy soil (1:3) at the experimental farm of the Chinese Academy of Tropical Agricultural Sciences in Danzhou city, Hainan province, China (19 51051N; 109 550 63E). In growing season, the average temperature was about 30 C, precipitation was about 180 mm, and humidity was around 97.5%. Seedlings with two growth units of leaves were subjected to progressive drought by withholding water, and the leaves in dark green stage were collected at different time points after treatment and used for following assay. 2.2. Relative water content The fresh weight, dry weight and saturated weight of treated leaves were measured. RWC (relative water content) of leaves was calculated according to formula: 100 [(fresh weightedry weight)/ (saturated weight e dry weight)].
2.3. Determination of chlorophyll (Chl) content Chlorophyll was extracted with 80% ice cold acetone from 0.1 g leaves samples. The extract was measured spectrophotometrically at 475, 645 and 663 nm with spectrophotometer (GE Ultrospec™ 2100 pro UV/visible, USA), respectively. Specific chlorophyll and b-carotene contents were determined according to the reported method (Lichtenthaler, 1987).
2.4. Measurements of activities of SOD and POD SOD (EC 1.15.1.1) was prepared by first freezing 0.5 g of leaves sample in liquid nitrogen to prevent proteolytic activity, followed by grinding with 5 ml extraction buffer (0.1 M phosphate buffer, pH 7.5, containing 0.5 mM EDTA, and 1 mM ascorbic acid). Brie was centrifuged for 20 min at 15 000 g and the supernatant was used as an enzyme. The soluble proteins concentration in the supernatant were determined using the method of Bradford with bovine serum albumin (BSA) as standard (Bradford, 1976). The per unit activity of SOD was estimated by recording the decrease in optical density of nitro blue tetrazolium (NBT) induced by the enzyme (Dhindsa et al., 1981). 3 ml of the reaction mixture contained 13 mM methionine, 75 mM nitroblue tetrazolium chloride, 0.1 mM EDTA, 50 mM phosphate buffer (pH 7.8), 50 mM sodium carbonate, and 0.1 ml enzyme solution. The reaction was started by adding 2 mM riboflavin. The reaction mixtures were illuminated for 15 min at 90 mmol m2 s1 (placing the test tubes under two 15 W fluorescent lamps). A complete reaction mixture without enzyme, which gave the maximal colour, was served as the control. The reaction was stopped by switching off the light and putting the tubes into dark. A non-irradiated complete reaction mixture was served as a blank. POD (EC 1.11.1.7) activity was determined with spectrophotometer. 0.5 g leaves sample was extracted with 5 ml 100 mM phosphate buffer (pH 6.0). Homogenate was centrifuged at 4000 g for 10 min. Reaction mixture was 50 ml 100 mM phosphate buffer (pH 6.0) with 23 mM guaiacol and 1.8 mM hydrogen peroxide. 1 ml supernatant was added into 3 ml reaction mixture. The change of OD was recorded at 470 nm. The per unit activity of enzyme was defined as the increase of 0.1 DOD per minute.
2.5. Measurement of malondialdehyde (MDA) content MDA content was determined by the thiobarbituric acid reaction (Peever and Higgins, 1989). 1.0 g freshleaves sample was homogenized in 5 ml 0.1% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 10 000 g for 5 min and 4 ml of 20% TCA containing 0.5% (w/v) thiobarbituric acid (TBA) were added to 1 ml of the supernatant. The mixture was heated at 95 C for 30 min and then quickly cooled on ice. The contents were centrifuged at 10 000 g for 15 min and absorbance of the supernatant at 532 and 600 nm was read. After subtracting the non-specific absorbance at 600 nm, the MDA concentration was determined by its extinction coefficient of 155 mM1 cm1.
2.6. Analysis of soluble sugar content Soluble sugar content was measured by referring to (Creelman et al., 1990). Take 0.1 g of leaf samples and put it into centrifuging tubes with a volume of 10 ml. Add 5 ml of 80% alcohol to the tube and heat it in water for 30 min at 80 C. Then cool down the tube and centrifuge it at 1000 g for 10 min. Soluble sugar content was determined by the phenol-sulfuric acid method.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 3/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
3
2.7. Determination of free proline content Proline was determined following (Bates et al., 1973). Briefly, 0.5e1.0 g leaves was homogenized in 10 ml of 3% sulfosalicylic acid and the homogenate filtered. The filtrate (2 ml) was treated with 2 ml acid ninhydrin and 2 ml of glacial acetic acid, then with 4 ml of toluene. Absorbance of the colored solutions was read at 520 nm with spectrophotometer. 2.8. Gene expression analysis by real-time PCR Total RNA was extracted from leaves according to the methods of (Qin, 2013). The quality and concentrations of the extracted RNA were detected by agarose gel electrophoresis and measured by a spectrophotometer. First strand cDNA was synthesized from 2 mg of total RNA with MMLV reverse transcriptase and random hexamer primer (Takara) according to the manufacturer's instruction. The cDNA was diluted 1:20 with nuclease-free water. Aliquots of the same cDNA sample were used for real-time PCR with primers designed for the selected genes, and 18S rRNA (Hb18SRNA) was used as a house-keeping gene (Table 1). The PCR reaction was performed in a 20 mL reaction mixture containing 200 nM of each primer, 1 SYBER Green PCR Master Mix (Takara), and about 30 ng cDNA. Real-time RT-PCR was performed using the Bio-RAD CFX96 system (BioRAD, Hercules, CA, USA). The reactions were carried out as follows: 3 min at 95 C for denaturation, 10 s at 94 C, 20 s at 60 C, and 30 s at 72 C for amplification for 45 cycles. The relative abundance of transcripts was calculated according to the Software instructions in Bio-RAD CFX96 Manager. The specificity of each primer pairs was verified by determining the melting curve at the end of each run and sequencing the amplified bands from gel electrophoresis. 2.9. Statistical analysis All data were analyzed with IBM-SPSS analytical software package version 20.0 (IBM Corporation, USA). One-way ANOVA and Tukey text were used to assess the different level. P < 0.01 (probability level) was considered significant difference. Figures were drawn by Origin data analysis and graphing software, OriginPro 9.1 (OriginLab Corporation, USA). For real-time PCR analysis, each value was the average of two biological replicates tested in triplicate, and for the other analyses, 6 replicate samples tested in replicate were used.
Fig. 1. Relative water content in rubber tree GT1 seedling leaves after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate.
3. Results 3.1. The effect of drought stress on relative water, chlorophyll, and b-carotene contents in the leaves of rubber tree The relative water content (RWC) is a key indice for drought stress study. As showed in Fig. 1, the RWC in the seedling leaves of rubber tree clone GT1 was continuously decreased with the severity of drought stress. It decreased by almost 20% at 9 day without water (dww) compared with that at 0 dww. A wilting phenotype was observed in leaves at 7 dww. Since photosynthesis in plants is dependent on capturing light energy in the pigment chlorophyll, and b-carotene (b-Car) is a pigment which assists in light absorption and energy dissipation in chloroplasts. So drought tolerance of rubber tree was tested by evaluating photosynthesis, especially contents of chlorophylls and b-carotene under drought stress. Total chlorophyll content was significantly increased at 1 dww, but showed a sharp decrease at 3 dww, and kept a low level until 9 dww. This variation was associated with both Chl a and Chl b, since significant change was observed in Chl a and b during drought stress. The ratio of Chl a/b was increased until 5 dww, and then decreased from 7 to 9 dww. Since most Chl a located in the reaction center chlorophylleprotein complex, and most Chl b located in light harvesting chlorophylleprotein complex, the attenuations of Chl a, Chl
Table 1 Information of primers used in this study. Genes
Accession number
Primer sequences (50 e30 )
Amplification length (bp)
Amplification efficiency
Reference
HbCOA
AY461413
145
1.872 ± 0.0183
(Deng et al., 2012)
HbACAT
AF429387
119
1.918 ± 0.0099
Direct submission
HbAPX
AF457210
164
1.815 ± 0.0067
(Mai et al., 2009)
HbATP
X58498
112
1.809 ± 0.0079
(Chye and Tan, 1992)
HbCAT
AF151368
153
1.877 ± 0.0093
Direct submission
HbCuZnSOD
AF457209
200
1.901 ± 0.0109
Direct submission
HbMnSOD
L11707
128
1.873 ± 0.00139
(Miao and Gaynor, 1993)
HbRbsS
M60274
123
1.794 ± 0.0256
(Chye et al., 1991)
Hb18SRNA
AY435212
Forward: GGTGACATGGTGGTGAAT Reverse: TGAAGTGACGAATGAGGTAA Forward: GAGTATCCAGTTAGGCATCA Reverse: CTAGTGAATCATGTCCAAGTC Forward: CCAACTGACACCGTTCTT Reverse: CAGCACCATCCTCTACATC Forward: GCTTCACGCAGACTATTATC Reverse: TAGAGGATGGAGATGAGGAA Forward: GGTATTGTGGTTCCTGGTAT Reverse: ATGGTGATTGTTGTGATGAG Forward: GTCCAACCACCGTAACTG Reverse: GCCATCATCACCAACATTG Forward: TGTGCTGTAATGTTGACCTA Reverse: GTTCACCTGTAAGTAGTATGC Forward: GCCAAGGAAGTTGAATACC Reverse: CCAGTAACGACCATCATAGT Forward: GCTCGAAGACGATCAGATACC Reverse: TTCAGCCTTGCGACCATAC
146
2.062 ± 0.011
Direct submission
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 4/7
4
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
Fig. 2. Contents of chlorophylls and becarotene after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate.
b, and Chl a/b were resulted by the degradation of chlorophylleprotein complex under severe drought condition. The b-Car content was increased slightly at 1 dww, but quickly decreased from 3 dww (Fig. 2). These results suggested that b-Car did not take part in quenching excess excited energy after chlorophylleprotein complex broken down under drought stress in rubber tree. 3.2. The effect of drought stress on membrane oxidation and osmosis indices Since MDA, a cytotoxic product of lipid peroxidation is generally taken as an index of ROS level. Therefore, the change of MDA
content in the leaves of rubber tree was determined to reveal the level of ROS under drought stress. As showed in Fig. 3, MDA content in leaves was continuously increased as prolonged drought stress. However, proline content increased slightly at 1 dww, but dropped at 3 dww, and then underwent a sudden increase at 9 dww. As for the soluble sugar content, it reduced by nearly 50% at 1 dww, but recovered to the untreated level (0 dww) at 3 dww, then decreased from 5 to 7 dww, and suddenly increased at 9 dww. Under drought stress condition, the accumulation of MDA usually leads to the damage of cell membrane in plant and animal. Changes of MDA and RWC suggested that drought induced osmotic stress response in rubber tree seedlings. However, the soluble sugar took part in drought response as we previously found in chilling stress response (Luo et al., 2012). The plant POD enzyme can decompose hydrogen peroxide, decrease oxygen radical production, and prevent plant damaged by peroxide. Under drought stress, POD activity increased slightly at 1 dww, but experienced a continuous decrease from 3 to 9 dww. The SOD activity increased at 3 dww, but decreased from 5 to 9 dww. These suggested that rubber tree seedling was susceptible to drought stress, and the protection role of physiological responses only lasted for 3e5 days after withholding water. 3.3. Expressions of key genes involved in energy biosynthesis and ROS scavenging under drought stress As showed in Fig. 4, drought stress induced the transcripts of antioxidative enzyme genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD with nearly the same pattern. Their expressions reached a maximum (100-fold over the untreated control) at 3 dww after withholding water. The expression patterns of ROS scavenging systems related genes were coincided with variations in their enzyme activities. For instance, the gene expression of HbCuZnSOD and HbMnSOD were reached their peaks at 3 dww, while SOD enzyme activities were highest at 3 dww.
Fig. 3. Changes of physiological indices in rubber tree after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 5/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
5
Fig. 4. Expressions of ROS scavenging systems related genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD after withholding water Values represent the mean ± SD of two biological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
Expressions analyses of energy biosynthesis related genes revealed that HbCOA, HbRbsS, and HbACAT transcripts were increased at the first 3 dww, but decreased from 5 dww. HbATP showed instant response at 1 dww then attenuate its gene expression from 3 dww. These suggested that these genes involved in energy biosynthesis and ROS scavenging were response to drought stress, and drought stress responses were occurred at 3e5 days after withholding water in rubber tree seedling. 4. Discussion 4.1. Short-term drought stress caused leaves dysfunction in rubber tree seedlings In the sub-optical rubber tree plantation in China, drought inhibits rubber tree growth. Research on rubber tree drought resistance mechanism mainly concentrated in the area of anatomy and physiological response (Nair et al., 1996). The effect of drought varied on different physiological metabolism in various growth and development stages of rubber tree (Devakumar et al., 1988). Transpiration coefficient (Nair et al., 1996), membrane integrity (Reddy, 2000), osmoregulation, laticifer turgor pressure (Ranasinghe and Milburn, 1995), low solute potential (Ayutthaya et al., 2011) were found related to drought tolerance in rubber tree. Drought significantly reduced the relative growth rate and RWC, and inhibited photosynthesis in plant seedlings (Li et al., 2011). Our studies found similar physiological responses in rubber tree seedlings under drought stress (Figs. 1 and 3). Under stresses conditions, the accumulation of MDA usually leads to the damage of cell membrane in plant and animal. The increase of MDA content was coincided to broken down in rubber tree seedlings. Besides of RWC, changes of chlorophyll contents also indicated that drought reshaped the structure of chloroplasts, and influenced photosynthesis and HbRbsS gene expression (Figs. 2 and 5). Similar results were confirmed by wheat leaves under moderate drought stress, which
found that thylakoid lumen acidification in drought-stressed leaves could be associated with the activity of an enhanced fraction of PSI. 4.2. Osmoregulation was a physiological response to drought stress in rubber tree The accumulation of proline was involved in regulating the osmotic. The accumulation of proline in leaves of rubber tree seedlings at later stage after withholding water suggested that rubber tree seedlings had the ability to regulate the osmotic under drought stress. Stress situations where soluble sugars are involved, such as chilling, herbicide injury, or pathogen attack, are related to important changes in reactive oxygen species balance (Couee et al., 2006). Fluctuations of soluble sugar content in rubber tree seedlings under drought stress suggested that soluble sugar involved in the drought tolerance. These results were similar with our previous study in rubber tree seedling under chilling stress. These results suggested its soluble sugar play an important role in osmoregulation under drought stress in rubber tree seedlings rather than proline. 4.3. ROS scavenging systems related genes function earlier than physiological responses under drought stress but limited by ATP formation The effect of drought on chloroplasts and mitochondria were well documented (Bigras, 2005). Changes of chlorophyll contents and gene expression of HbRbsS indicated that the integrity of chloroplast had been broken down under drought stress. The important role of chloroplasts and mitochondria is ATP generation. HbATP gene encodes the beta subunit of mitochondrial ATP synthase (EC 3.6.3.14), which is the most commonly used “energy currency” of cells in most organisms. HbCOA encodes a long-chainfatty-acyl-CoA reductase (EC 1.2.1.50), which takes part in biosynthesis of secondary metabolites and cuticular wax biosynthesis. HbACAT encodes an acetyl-CoA C-acetyltransferase (EC 2.3.1.9),
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 6/7
6
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
Fig. 5. Expressions of energy biosynthesis related genes HbCOA, HbATP, HbRbsS, and HbACAT after withholding water Values represent the mean ± SD of two biological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
which mainly takes part in fatty acid and amino acid metabolism. Drought influenced mitochondria function since decreases of HbATP, HbCOA and HbACAT transcripts were occurred from 3 to 5 dww (Fig. 5.). These suggested that drought induced several metabolism pathways synchronously but first inhibited energy formation. ROS may play two different roles: exacerbating damage or activating defense responses. The numerous ROS generation sources and complex scavenging systems provide the flexibility necessary for these functions (Dat et al., 2000). Mitochondria is an important place for ROS production in cell (Møller, 2001). The intimate relationship between antioxidant enzyme activities and drought stress were found in woody plant in karst habitats in Southern China. Transcripts of CAT, MnSOD, and CuZnSOD are likely to reflecting the ability of mitochondria to scavenging ROS and delaying the aging process. In this study, we found that the changes of ROS scavenging related genes expressions was tightly related to the changes of corresponding enzymes activities. MnSOD is an integral mitochondrial protein known as a first-line antioxidant defense against superoxide radical anions produced as by-products of the electron transport chain. In our study, HbMnSOD gene expression was later than that of HbCuZnSOD gene expression. These suggested that HbCuZnSOD was more important for drought resistance in rubber tree clone GT1, which was similar with previous study in rubber tree clone PB260 (Leclercq et al., 2012). 5. Conclusion Taken together, these results suggested that rubber tree seedling was susceptible to drought stress, and the protection role of physiological and molecular responses only lasted for 3e5 days after withholding water. Moreover, adaptation to drought stress was a complex process involved in osmoregulation, antioxidative enzymes and energy biosynthesis related genes in mitochondria and chloroplasts in rubber tree seedling.
Acknowledgments This work was supported by the National Natural Science Foundation of China (31270643).
Contributions Conceived and designed the experiments: LF Wang. Performed the experiments: LF Wang. Analyzed the data: LF Wang. Wrote the paper: LF Wang.
References Ahamad, B., 1999. Effect of rootstock on growth and water use efficiency of Hevea during water stress. J. Rubber Res. 2, 99e119. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. plant biol. 55, 373e399. Asada, K., 2006. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 141, 391e396. Ayutthaya, S.I.N., Do, F.C., Pannangpetch, K., Junjittakarn, J., Maeght, J.-L., Rocheteau, A., Cochard, H., 2011. Water loss regulation in mature Hevea brasiliensis: effects of intermittent drought in the rainy season and hydraulic regulation. Tree physiol. 31, 751e762. Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for water-stress studies. Plant Soil. 39, 205e207. Bigras, F.J., 2005. Photosynthetic response of white spruce families to drought stress. New. For. 29, 135e148. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., 2012. Photosystem II thermostability in situ: environmentally induced acclimation and genotype-specific reactions in Triticum aestivum L. Plant physiol. Biochem. PPB/ Soc. francaise De. physiologie Veg. 57, 93e105. Chye, M.L., Tan, C.T., 1992. Isolation and nucleotide sequence of a cDNA clone encoding the beta subunit of mitochondrial ATP synthase from Hevea brasiliensis. Plant Mol. Biol. 18, 611e612. Chye, M.L., Tan, S., Tan, C.T., Kush, A., Chua, N.H.i., 1991. Nucleotide sequence of a cDNA clone encoding the precursor of ribulose-1, 5-bisphosphate carboxylase small subunit from Hevea brasiliensis (rubber tree). Plant Mol. biol. 16, 1077e1078.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
Q1
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
PLAPHY4032_proof ■ 26 August 2014 ■ 7/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7 Couee, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. bot. 57, 449e459. Creelman, R.A., Mason, H.S., Bensen, R.J., Boyer, J.S., Mullet, J.E., 1990. Water deficit and abscisic acid cause differential inhibition of shoot versus root growth in soybean seedlings: analysis of growth, sugar accumulation, and gene expression. Plant Physiol. 92, 205e214. Dat, J., Vandenabeele, S., Vranova, E., Van Montagu, M., Inze, D., Van Breusegem, F., 2000. Dual action of the active oxygen species during plant stress responses. Cell. Mol. life Sci. : CMLS 57, 779e795. Deng, L.H., Luo, M.W., Zhang, C.F., Zeng, H.C., 2012. Extraction of high-quality RNA from rubber tree leaves. Biosci. Biotechnol. Biochem. 76, 1394e1396. Devakumar, A., Gururaja Rao, G., Rajagopal, R., Sanjeeva Rao, P., George, M., Vijayakumar, K., Sethuraj, M., 1988. Studies on soil-plant-atmosphere system in Hevea: II. Seasonal effects on water relations and yield. Indian J. Nat. Rubber Res. 1, 45e60. Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. bot. 32, 93e101. Gonçalves, P.d.S., Aguiar, A.T.d.E., Costa, R.B.d., Gonçalves, E.C.P., Scaloppi Júnior, E.J., Branco, R.B.F., 2009. Genetic variation and realized genetic gain from rubber tree improvement. Sci. Agric. 66, 44e51. Gururaja Rao, G., Devakumar, A., Rajagopal, R., Annamma, Y., Vijayakumar, K., Sethuraj, M., 1988. Clonal variations in leaf epicuticular waxes and reflectance: possible role in drought tolerance in Hevea. Indian J. Nat. Rubb Res. 1, 84e87. Hoekstra, F.A., Golovina, E.A., Buitink, J., 2001. Mechanisms of plant desiccation tolerance. Trends Plant Sci. 6, 431e438. Huang, Z.D., Pan, Y.Q., 1992. Rubber Cultivation Under Climatic Stresses in China. Elsevier, Amsterdam. ment-Vidal, A., Fabre, D., Oliver, G., Lardet, L., Leclercq, J., Martin, F., Sanier, C., Cle Ayar, A., Peyramard, M., Montoro, P., 2012. Over-expression of a cytosolic isoform of the HbCuZnSOD gene in Hevea brasiliensis changes its response to a water deficit. Plant Mol. Biol. 80, 255e272. Li, Y., Zhao, H.X., Duan, B.L., Korpelainen, H., Li, C.Y., 2011. Effect of drought and ABA on growth, photosynthesis and antioxidant system of Cotinus coggygria seedlings under two different light conditions. Environ. Exp. Bot. 71, 107e113. Lichtenthaler, H.K., 1987. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 148, 350e382. Luo, P., He, J.J., Yao, Y.L., Dai, X.H., Cheng, R.X., Wang, L.F., 2012. Differential responses of two rubber tree clones to chilling stress. Afr. J. Biotechnol. 11, 13466e13471. Mai, J., Herbette, S., Vandame, M., Kositsup, B., Kasemsap, P., Cavaloc, E., Julien, J.L., glio, T., Roeckel-Drevet, P., 2009. Effect of chilling on photosynthesis and Ame antioxidant enzymes in Hevea brasiliensis Muell. Arg. Trees 23, 863e874. Miao, Z.H., Gaynor, J.J., 1993. Molecular cloning, characterization and expression of Mn-superoxide dismutase from the rubber tree (Hevea brasiliensis). Plant Mol. Biol. 23, 267e277. Møller, I.M., 2001. Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant Biol. 52, 561e591.
7
Monclus, R., Dreyer, E., Villar, M., Delmotte, F.M., Delay, D., Petit, J.M., Barbaroux, C., Le Thiec, D., Brechet, C., Brignolas, F., 2006. Impact of drought on productivity and water use efficiency in 29 genotypes of Populus deltoides x Populus nigra. New. Phytol. 169, 765e777. Nair, D.B., Dey, S.K., Rajagopal, R., Vijayakumar, K.R., Sethuraj, M.R., 1996. Synergistic effect of heat and osmotic stress in causing membrane injury in Hevea brasiliensis. J. Plant Biol. 39, 177e181. Peever, T.L., Higgins, V.J., 1989. Electrolyte leakage, lipoxygenase, and lipid peroxidation induced in tomato leaf tissue by specific and nonspecific elicitors from Cladosporium fulvum. Plant Physiol. 90, 867e875. Priyadarshan, P.M., Hoa, T.T.T., Huasun, H., de Gonçalves, P.S., 2005. Yielding potential of rubber (Hevea brasiliensis) in sub-pptimal environments. J. Crop Improv. 14, 221e247. Qin, B., 2013. The function of Rad6 gene in Hevea brasiliensis extends beyond DNA repair. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 66, 134e140. Ranasinghe, M.S., Milburn, J.A., 1995. Xylem conduction and cavitation in Hevea brasiliensis. J. Exp. bot. 46, 1693e1700. Reddy, Y., 2000. Effect of moisture stress on stability of membrane integrity in Hevea brasiliensis across temperature regimes. Indian J. For. 23, 110e111. Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant Biol. 44, 357e384. Shao, H.B., Liu, Z.H., Zhang, Z.B., Chen, Q.J., Chu, L.Y., Brestic, M., 2013. Biological roles of crop NADP-malic enzymes and molecular mechanisms involved in abiotic stress. Afr. J. Biotechnol. 10, 4947e4953. Webster, C.C., Baulkwill, W.J., 1989. Rubber. Longman scientific & technical. Yan, K., Shao, H., Shao, C., Chen, P., Zhao, S., Brestic, M., Chen, X., 2013. Physiological adaptive mechanisms of plants grown in saline soil and implications for sustainable saline agriculture in coastal zone. Acta Physiol. Plant. 35, 2867e2878. Zeppel, M.J., Anderegg, W.R., Adams, H.D., 2013. Forest mortality due to drought: latest insights, evidence and unresolved questions on physiological pathways and consequences of tree death. New. phytol. 197, 372e374. Zhou, Y.H., Lam, H.M., Zhang, J.H., 2007. Inhibition of photosynthesis and energy dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58, 1207e1217. Zhou, G.A., Chang, R.Z., Qiu, L.J., 2010. Overexpression of soybean ubiquitinconjugating enzyme gene GmUBC2 confers enhanced drought and salt tolerance through modulating abiotic stress-responsive gene expression in Arabidopsis. Plant Mol. Biol. 72, 357e367. Zhou, M.L., Ma, J.T., Zhao, Y.M., Wei, Y.H., Tang, Y.X., Wu, Y.M., 2012. Improvement of drought and salt tolerance in Arabidopsis and Lotus corniculatus by overexpression of a novel DREB transcription factor from Populus euphratica. Gene 506, 10e17. Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53, 247e273. Zivcak, M., Kalaji, H.M., Shao, H.-B., Olsovska, K., Brestic, M., 2014. Photosynthetic proton and electron transport in wheat leaves under prolonged moderate drought stress. J. Photochem. Photobiol. B Biol.. Q2
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80
PLAPHY4032_proof ■ 26 August 2014 ■ 1/7
Plant Physiology and Biochemistry xxx (2014) 1e7
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.) Q3
Li-feng Wang* Danzhou Investigation & Experiment Station of Tropical Crops, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan 571737, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 April 2014 Accepted 14 August 2014 Available online xxx
Plant drought stress response and tolerance are complex biological processes. In order to reveal the drought tolerance mechanism in rubber tree, physiological responses and expressions of genes involved in energy biosynthesis and reactive oxygen species (ROS) scavenging were systematically analyzed following drought stress treatment. Results showed that relative water content (RWC) in leaves was continuously decreased with the severity of drought stress. Wilting leaves were observed at 7 day without water (dww). Total chlorophyll content was increased at 1 dww, but decreased from 3 dww. However, the contents of malondialdehyde (MDA) and proline were significantly increased under drought stress. Peroxidase (POD) and superoxide dismutase (SOD) activities were markedly enhanced at 1 and 3 dww, respectively. Meanwhile, the soluble sugar content was constant under drought stress. These indicated that photosynthetic activity and membrane lipid integrity were quickly attenuated by drought stress in rubber tree, and osmoregulation participated in drought tolerance mechanism in rubber tree. Expressions of energy biosynthesis and ROS scavenging systems related genes, including HbCuZnSOD, HbMnSOD, HbAPX, HbCAT, HbCOA, HbATP, and HbACAT demonstrated that these genes were significantly up-regulated by drought stress, and reached a maximum at 3 dww, then followed by a decrease from 5 dww. These results suggested that drought stress adaption in rubber tree was governed by energy biosynthesis, antioxidative enzymes, and osmoregulation. © 2014 Published by Elsevier Masson SAS.
Keywords: Antioxidative enzyme Drought Hevea brasiliensis Osmoregulation Photosynthesis Reactive oxygen species
1. Introduction Water deficit is a major constraint to plant growth and productivity (Monclus et al., 2006). Prolonged drought stress leads to severe problems, such as decrease in water flux, closing of stomata and reduction in carbon dioxide fixation. Tree can die of both hydraulic failure and carbon starvation during drought stress (Zeppel et al., 2013). Inhibition of photosynthesis and energy dissipation are common features under drought stress in many plant species, which reflect as Photosystem II thermostability and electron transport changes (Zhou et al., 2007; Brestic et al., 2012; Yan et al., 2013; Zivcak et al., 2014). Plant anti-drought characters are mainly
Abbreviations: ACAT, acetyl-CoA C-acetyltransferase; APX, ascorbate peroxidase; CAT, catalase; CDPK, calcium-dependent protein kinase; COA, a long-chain-fattyacyl-CoA reductase; dww, day without water; MDA, malondialdehyde; POD, peroxidase; ROS, reactive oxygen species; RWC, relative water content; SOD, superoxide dismutase. * Tel.: þ86 898 23300459; fax: þ86 898 23300315. E-mail address: [email protected].
associated with low transpiration co efficiency and osmotic adjustment, etc. Osmotic adjustment involves the accumulation of compatible solutes (low-molecular-weight organic osmolytes), such as proline, mannitol, sorbitol, fructans, sucrose and oligosaccharides (Rhodes and Hanson, 1993). These large amounts of compounds play a key role in maintaining the osmotic equilibrium and protecting membranes as well as macromolecules (Hoekstra et al., 2001; Couee et al., 2006). These regulations were related to abscisic acid (ABA), calcium-dependent protein kinase (CDPK), NADP-malic enzyme (Shao et al., 2013) and phospholipid signaling pathways (Zhu, 2002). Overexpression of key genes in these pathways, such as DREB transcription factor, enhanced drought tolerance in Arabidopsis and Lotus corniculatus (Zhou et al., 2012). In addition, overexpression of soybean ubiquitin-conjugating enzyme gene GmUBC2 can enhance drought tolerance by modulating abiotic stress-responsive genes expression in Arabidopsis (Zhou et al., 2010). Since drought stress doubtless generates reactive oxygen species (ROS) in chloroplasts and mitochondria (Apel and Hirt, 2004; Asada, 2006), so ROS-scavenging enzymes play important roles in drought tolerance responses. ROS-scavenging systems
http://dx.doi.org/10.1016/j.plaphy.2014.08.012 0981-9428/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 2/7
2
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
included superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX), monodehydroascorbate reductase (NADH), catalase (CAT), etc. Natural rubber is obtained from para rubber tree (Hevea brasiliensis Muell. Arg.). Rubber tree originated from the Amazon basin in South America. This area falling between equator and 15 S is characterized by a wet equatorial climate (Gonçalves et al., 2009). The optimal growth conditions of rubber tree are high temperature around 28 ± 2 C and high humidity about 2000e4000 mm rainfall per annum (Webster and Baulkwill, 1989; Priyadarshan et al., 2005). However, unlike traditional plantations in south America and southeast Asia, rubber tree planting in these marginal areas or non-traditional rubber-growing regions, such as northeastern states of India, south China, north and northeast Thailand, usually faces abiotic stress like drought, strong winds, and low temperature, etc. Drought stress results in growth retardation of both rubber tree seedlings and mature tapping trees, shortening tapping period, blocking latex flow for low water supply, decreasing dry latex contents, increasing TPD (tapping panel dryness) occurrence, and even causes tree death at severe conditions (Huang and Pan, 1992). Many strategies and indices were used for selecting and breeding drought-tolerant rubber tree clones, such as droughttolerant rootstock (Ahamad, 1999), leaves with more epicuticular waxes (Gururaja Rao et al., 1988), etc. Hydraulic mechanism was used for explaining drought tolerance mechanism in rubber tree (Ayutthaya et al., 2011). The development of molecular biological techniques in rubber tree provides new functional genes to extend our insights of drought tolerance mechanism. Recently, HbCuZnSOD and HbMnSOD have been cloned in rubber tree, and overexpression of HbCuZnSOD in rubber tree clone PB260 conferred enhanced drought tolerance (Leclercq et al., 2012). These results indicated that ROS-scavenging enzymes played crucial roles in drought tolerance mechanisms. Representative genes in mitochondria, such as HbAPX, an ascorbate peroxidases gene (Mai et al., 2009), and HbATP (Chye and Tan, 1992) were cloned. However, in rubber tree, the functions of most ROS related genes in drought resistance mechanism were not well identified. In this study, expressions of 8 genes involved in energy biosynthesis and ROS scavenging systems were characterized under drought treatment in seedlings of rubber tree clone GT1. The underlying drought tolerance mechanism in rubber tree was discussed. 2. Methods 2.1. Plant material and drought treatment Rubber tree clone GT1 (original clone breed in Indonesia) seedlings were grown in the plastic pots in the chamber with vermiculite and turfy soil (1:3) at the experimental farm of the Chinese Academy of Tropical Agricultural Sciences in Danzhou city, Hainan province, China (19 51051N; 109 550 63E). In growing season, the average temperature was about 30 C, precipitation was about 180 mm, and humidity was around 97.5%. Seedlings with two growth units of leaves were subjected to progressive drought by withholding water, and the leaves in dark green stage were collected at different time points after treatment and used for following assay. 2.2. Relative water content The fresh weight, dry weight and saturated weight of treated leaves were measured. RWC (relative water content) of leaves was calculated according to formula: 100 [(fresh weightedry weight)/ (saturated weight e dry weight)].
2.3. Determination of chlorophyll (Chl) content Chlorophyll was extracted with 80% ice cold acetone from 0.1 g leaves samples. The extract was measured spectrophotometrically at 475, 645 and 663 nm with spectrophotometer (GE Ultrospec™ 2100 pro UV/visible, USA), respectively. Specific chlorophyll and b-carotene contents were determined according to the reported method (Lichtenthaler, 1987).
2.4. Measurements of activities of SOD and POD SOD (EC 1.15.1.1) was prepared by first freezing 0.5 g of leaves sample in liquid nitrogen to prevent proteolytic activity, followed by grinding with 5 ml extraction buffer (0.1 M phosphate buffer, pH 7.5, containing 0.5 mM EDTA, and 1 mM ascorbic acid). Brie was centrifuged for 20 min at 15 000 g and the supernatant was used as an enzyme. The soluble proteins concentration in the supernatant were determined using the method of Bradford with bovine serum albumin (BSA) as standard (Bradford, 1976). The per unit activity of SOD was estimated by recording the decrease in optical density of nitro blue tetrazolium (NBT) induced by the enzyme (Dhindsa et al., 1981). 3 ml of the reaction mixture contained 13 mM methionine, 75 mM nitroblue tetrazolium chloride, 0.1 mM EDTA, 50 mM phosphate buffer (pH 7.8), 50 mM sodium carbonate, and 0.1 ml enzyme solution. The reaction was started by adding 2 mM riboflavin. The reaction mixtures were illuminated for 15 min at 90 mmol m2 s1 (placing the test tubes under two 15 W fluorescent lamps). A complete reaction mixture without enzyme, which gave the maximal colour, was served as the control. The reaction was stopped by switching off the light and putting the tubes into dark. A non-irradiated complete reaction mixture was served as a blank. POD (EC 1.11.1.7) activity was determined with spectrophotometer. 0.5 g leaves sample was extracted with 5 ml 100 mM phosphate buffer (pH 6.0). Homogenate was centrifuged at 4000 g for 10 min. Reaction mixture was 50 ml 100 mM phosphate buffer (pH 6.0) with 23 mM guaiacol and 1.8 mM hydrogen peroxide. 1 ml supernatant was added into 3 ml reaction mixture. The change of OD was recorded at 470 nm. The per unit activity of enzyme was defined as the increase of 0.1 DOD per minute.
2.5. Measurement of malondialdehyde (MDA) content MDA content was determined by the thiobarbituric acid reaction (Peever and Higgins, 1989). 1.0 g freshleaves sample was homogenized in 5 ml 0.1% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 10 000 g for 5 min and 4 ml of 20% TCA containing 0.5% (w/v) thiobarbituric acid (TBA) were added to 1 ml of the supernatant. The mixture was heated at 95 C for 30 min and then quickly cooled on ice. The contents were centrifuged at 10 000 g for 15 min and absorbance of the supernatant at 532 and 600 nm was read. After subtracting the non-specific absorbance at 600 nm, the MDA concentration was determined by its extinction coefficient of 155 mM1 cm1.
2.6. Analysis of soluble sugar content Soluble sugar content was measured by referring to (Creelman et al., 1990). Take 0.1 g of leaf samples and put it into centrifuging tubes with a volume of 10 ml. Add 5 ml of 80% alcohol to the tube and heat it in water for 30 min at 80 C. Then cool down the tube and centrifuge it at 1000 g for 10 min. Soluble sugar content was determined by the phenol-sulfuric acid method.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 3/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
3
2.7. Determination of free proline content Proline was determined following (Bates et al., 1973). Briefly, 0.5e1.0 g leaves was homogenized in 10 ml of 3% sulfosalicylic acid and the homogenate filtered. The filtrate (2 ml) was treated with 2 ml acid ninhydrin and 2 ml of glacial acetic acid, then with 4 ml of toluene. Absorbance of the colored solutions was read at 520 nm with spectrophotometer. 2.8. Gene expression analysis by real-time PCR Total RNA was extracted from leaves according to the methods of (Qin, 2013). The quality and concentrations of the extracted RNA were detected by agarose gel electrophoresis and measured by a spectrophotometer. First strand cDNA was synthesized from 2 mg of total RNA with MMLV reverse transcriptase and random hexamer primer (Takara) according to the manufacturer's instruction. The cDNA was diluted 1:20 with nuclease-free water. Aliquots of the same cDNA sample were used for real-time PCR with primers designed for the selected genes, and 18S rRNA (Hb18SRNA) was used as a house-keeping gene (Table 1). The PCR reaction was performed in a 20 mL reaction mixture containing 200 nM of each primer, 1 SYBER Green PCR Master Mix (Takara), and about 30 ng cDNA. Real-time RT-PCR was performed using the Bio-RAD CFX96 system (BioRAD, Hercules, CA, USA). The reactions were carried out as follows: 3 min at 95 C for denaturation, 10 s at 94 C, 20 s at 60 C, and 30 s at 72 C for amplification for 45 cycles. The relative abundance of transcripts was calculated according to the Software instructions in Bio-RAD CFX96 Manager. The specificity of each primer pairs was verified by determining the melting curve at the end of each run and sequencing the amplified bands from gel electrophoresis. 2.9. Statistical analysis All data were analyzed with IBM-SPSS analytical software package version 20.0 (IBM Corporation, USA). One-way ANOVA and Tukey text were used to assess the different level. P < 0.01 (probability level) was considered significant difference. Figures were drawn by Origin data analysis and graphing software, OriginPro 9.1 (OriginLab Corporation, USA). For real-time PCR analysis, each value was the average of two biological replicates tested in triplicate, and for the other analyses, 6 replicate samples tested in replicate were used.
Fig. 1. Relative water content in rubber tree GT1 seedling leaves after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate.
3. Results 3.1. The effect of drought stress on relative water, chlorophyll, and b-carotene contents in the leaves of rubber tree The relative water content (RWC) is a key indice for drought stress study. As showed in Fig. 1, the RWC in the seedling leaves of rubber tree clone GT1 was continuously decreased with the severity of drought stress. It decreased by almost 20% at 9 day without water (dww) compared with that at 0 dww. A wilting phenotype was observed in leaves at 7 dww. Since photosynthesis in plants is dependent on capturing light energy in the pigment chlorophyll, and b-carotene (b-Car) is a pigment which assists in light absorption and energy dissipation in chloroplasts. So drought tolerance of rubber tree was tested by evaluating photosynthesis, especially contents of chlorophylls and b-carotene under drought stress. Total chlorophyll content was significantly increased at 1 dww, but showed a sharp decrease at 3 dww, and kept a low level until 9 dww. This variation was associated with both Chl a and Chl b, since significant change was observed in Chl a and b during drought stress. The ratio of Chl a/b was increased until 5 dww, and then decreased from 7 to 9 dww. Since most Chl a located in the reaction center chlorophylleprotein complex, and most Chl b located in light harvesting chlorophylleprotein complex, the attenuations of Chl a, Chl
Table 1 Information of primers used in this study. Genes
Accession number
Primer sequences (50 e30 )
Amplification length (bp)
Amplification efficiency
Reference
HbCOA
AY461413
145
1.872 ± 0.0183
(Deng et al., 2012)
HbACAT
AF429387
119
1.918 ± 0.0099
Direct submission
HbAPX
AF457210
164
1.815 ± 0.0067
(Mai et al., 2009)
HbATP
X58498
112
1.809 ± 0.0079
(Chye and Tan, 1992)
HbCAT
AF151368
153
1.877 ± 0.0093
Direct submission
HbCuZnSOD
AF457209
200
1.901 ± 0.0109
Direct submission
HbMnSOD
L11707
128
1.873 ± 0.00139
(Miao and Gaynor, 1993)
HbRbsS
M60274
123
1.794 ± 0.0256
(Chye et al., 1991)
Hb18SRNA
AY435212
Forward: GGTGACATGGTGGTGAAT Reverse: TGAAGTGACGAATGAGGTAA Forward: GAGTATCCAGTTAGGCATCA Reverse: CTAGTGAATCATGTCCAAGTC Forward: CCAACTGACACCGTTCTT Reverse: CAGCACCATCCTCTACATC Forward: GCTTCACGCAGACTATTATC Reverse: TAGAGGATGGAGATGAGGAA Forward: GGTATTGTGGTTCCTGGTAT Reverse: ATGGTGATTGTTGTGATGAG Forward: GTCCAACCACCGTAACTG Reverse: GCCATCATCACCAACATTG Forward: TGTGCTGTAATGTTGACCTA Reverse: GTTCACCTGTAAGTAGTATGC Forward: GCCAAGGAAGTTGAATACC Reverse: CCAGTAACGACCATCATAGT Forward: GCTCGAAGACGATCAGATACC Reverse: TTCAGCCTTGCGACCATAC
146
2.062 ± 0.011
Direct submission
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 4/7
4
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
Fig. 2. Contents of chlorophylls and becarotene after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate.
b, and Chl a/b were resulted by the degradation of chlorophylleprotein complex under severe drought condition. The b-Car content was increased slightly at 1 dww, but quickly decreased from 3 dww (Fig. 2). These results suggested that b-Car did not take part in quenching excess excited energy after chlorophylleprotein complex broken down under drought stress in rubber tree. 3.2. The effect of drought stress on membrane oxidation and osmosis indices Since MDA, a cytotoxic product of lipid peroxidation is generally taken as an index of ROS level. Therefore, the change of MDA
content in the leaves of rubber tree was determined to reveal the level of ROS under drought stress. As showed in Fig. 3, MDA content in leaves was continuously increased as prolonged drought stress. However, proline content increased slightly at 1 dww, but dropped at 3 dww, and then underwent a sudden increase at 9 dww. As for the soluble sugar content, it reduced by nearly 50% at 1 dww, but recovered to the untreated level (0 dww) at 3 dww, then decreased from 5 to 7 dww, and suddenly increased at 9 dww. Under drought stress condition, the accumulation of MDA usually leads to the damage of cell membrane in plant and animal. Changes of MDA and RWC suggested that drought induced osmotic stress response in rubber tree seedlings. However, the soluble sugar took part in drought response as we previously found in chilling stress response (Luo et al., 2012). The plant POD enzyme can decompose hydrogen peroxide, decrease oxygen radical production, and prevent plant damaged by peroxide. Under drought stress, POD activity increased slightly at 1 dww, but experienced a continuous decrease from 3 to 9 dww. The SOD activity increased at 3 dww, but decreased from 5 to 9 dww. These suggested that rubber tree seedling was susceptible to drought stress, and the protection role of physiological responses only lasted for 3e5 days after withholding water. 3.3. Expressions of key genes involved in energy biosynthesis and ROS scavenging under drought stress As showed in Fig. 4, drought stress induced the transcripts of antioxidative enzyme genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD with nearly the same pattern. Their expressions reached a maximum (100-fold over the untreated control) at 3 dww after withholding water. The expression patterns of ROS scavenging systems related genes were coincided with variations in their enzyme activities. For instance, the gene expression of HbCuZnSOD and HbMnSOD were reached their peaks at 3 dww, while SOD enzyme activities were highest at 3 dww.
Fig. 3. Changes of physiological indices in rubber tree after withholding water Values represent the mean ± SD of 6 replicate samples tested in replicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 5/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
5
Fig. 4. Expressions of ROS scavenging systems related genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD after withholding water Values represent the mean ± SD of two biological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
Expressions analyses of energy biosynthesis related genes revealed that HbCOA, HbRbsS, and HbACAT transcripts were increased at the first 3 dww, but decreased from 5 dww. HbATP showed instant response at 1 dww then attenuate its gene expression from 3 dww. These suggested that these genes involved in energy biosynthesis and ROS scavenging were response to drought stress, and drought stress responses were occurred at 3e5 days after withholding water in rubber tree seedling. 4. Discussion 4.1. Short-term drought stress caused leaves dysfunction in rubber tree seedlings In the sub-optical rubber tree plantation in China, drought inhibits rubber tree growth. Research on rubber tree drought resistance mechanism mainly concentrated in the area of anatomy and physiological response (Nair et al., 1996). The effect of drought varied on different physiological metabolism in various growth and development stages of rubber tree (Devakumar et al., 1988). Transpiration coefficient (Nair et al., 1996), membrane integrity (Reddy, 2000), osmoregulation, laticifer turgor pressure (Ranasinghe and Milburn, 1995), low solute potential (Ayutthaya et al., 2011) were found related to drought tolerance in rubber tree. Drought significantly reduced the relative growth rate and RWC, and inhibited photosynthesis in plant seedlings (Li et al., 2011). Our studies found similar physiological responses in rubber tree seedlings under drought stress (Figs. 1 and 3). Under stresses conditions, the accumulation of MDA usually leads to the damage of cell membrane in plant and animal. The increase of MDA content was coincided to broken down in rubber tree seedlings. Besides of RWC, changes of chlorophyll contents also indicated that drought reshaped the structure of chloroplasts, and influenced photosynthesis and HbRbsS gene expression (Figs. 2 and 5). Similar results were confirmed by wheat leaves under moderate drought stress, which
found that thylakoid lumen acidification in drought-stressed leaves could be associated with the activity of an enhanced fraction of PSI. 4.2. Osmoregulation was a physiological response to drought stress in rubber tree The accumulation of proline was involved in regulating the osmotic. The accumulation of proline in leaves of rubber tree seedlings at later stage after withholding water suggested that rubber tree seedlings had the ability to regulate the osmotic under drought stress. Stress situations where soluble sugars are involved, such as chilling, herbicide injury, or pathogen attack, are related to important changes in reactive oxygen species balance (Couee et al., 2006). Fluctuations of soluble sugar content in rubber tree seedlings under drought stress suggested that soluble sugar involved in the drought tolerance. These results were similar with our previous study in rubber tree seedling under chilling stress. These results suggested its soluble sugar play an important role in osmoregulation under drought stress in rubber tree seedlings rather than proline. 4.3. ROS scavenging systems related genes function earlier than physiological responses under drought stress but limited by ATP formation The effect of drought on chloroplasts and mitochondria were well documented (Bigras, 2005). Changes of chlorophyll contents and gene expression of HbRbsS indicated that the integrity of chloroplast had been broken down under drought stress. The important role of chloroplasts and mitochondria is ATP generation. HbATP gene encodes the beta subunit of mitochondrial ATP synthase (EC 3.6.3.14), which is the most commonly used “energy currency” of cells in most organisms. HbCOA encodes a long-chainfatty-acyl-CoA reductase (EC 1.2.1.50), which takes part in biosynthesis of secondary metabolites and cuticular wax biosynthesis. HbACAT encodes an acetyl-CoA C-acetyltransferase (EC 2.3.1.9),
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
PLAPHY4032_proof ■ 26 August 2014 ■ 6/7
6
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7
Fig. 5. Expressions of energy biosynthesis related genes HbCOA, HbATP, HbRbsS, and HbACAT after withholding water Values represent the mean ± SD of two biological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.
which mainly takes part in fatty acid and amino acid metabolism. Drought influenced mitochondria function since decreases of HbATP, HbCOA and HbACAT transcripts were occurred from 3 to 5 dww (Fig. 5.). These suggested that drought induced several metabolism pathways synchronously but first inhibited energy formation. ROS may play two different roles: exacerbating damage or activating defense responses. The numerous ROS generation sources and complex scavenging systems provide the flexibility necessary for these functions (Dat et al., 2000). Mitochondria is an important place for ROS production in cell (Møller, 2001). The intimate relationship between antioxidant enzyme activities and drought stress were found in woody plant in karst habitats in Southern China. Transcripts of CAT, MnSOD, and CuZnSOD are likely to reflecting the ability of mitochondria to scavenging ROS and delaying the aging process. In this study, we found that the changes of ROS scavenging related genes expressions was tightly related to the changes of corresponding enzymes activities. MnSOD is an integral mitochondrial protein known as a first-line antioxidant defense against superoxide radical anions produced as by-products of the electron transport chain. In our study, HbMnSOD gene expression was later than that of HbCuZnSOD gene expression. These suggested that HbCuZnSOD was more important for drought resistance in rubber tree clone GT1, which was similar with previous study in rubber tree clone PB260 (Leclercq et al., 2012). 5. Conclusion Taken together, these results suggested that rubber tree seedling was susceptible to drought stress, and the protection role of physiological and molecular responses only lasted for 3e5 days after withholding water. Moreover, adaptation to drought stress was a complex process involved in osmoregulation, antioxidative enzymes and energy biosynthesis related genes in mitochondria and chloroplasts in rubber tree seedling.
Acknowledgments This work was supported by the National Natural Science Foundation of China (31270643).
Contributions Conceived and designed the experiments: LF Wang. Performed the experiments: LF Wang. Analyzed the data: LF Wang. Wrote the paper: LF Wang.
References Ahamad, B., 1999. Effect of rootstock on growth and water use efficiency of Hevea during water stress. J. Rubber Res. 2, 99e119. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. plant biol. 55, 373e399. Asada, K., 2006. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 141, 391e396. Ayutthaya, S.I.N., Do, F.C., Pannangpetch, K., Junjittakarn, J., Maeght, J.-L., Rocheteau, A., Cochard, H., 2011. Water loss regulation in mature Hevea brasiliensis: effects of intermittent drought in the rainy season and hydraulic regulation. Tree physiol. 31, 751e762. Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for water-stress studies. Plant Soil. 39, 205e207. Bigras, F.J., 2005. Photosynthetic response of white spruce families to drought stress. New. For. 29, 135e148. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., 2012. Photosystem II thermostability in situ: environmentally induced acclimation and genotype-specific reactions in Triticum aestivum L. Plant physiol. Biochem. PPB/ Soc. francaise De. physiologie Veg. 57, 93e105. Chye, M.L., Tan, C.T., 1992. Isolation and nucleotide sequence of a cDNA clone encoding the beta subunit of mitochondrial ATP synthase from Hevea brasiliensis. Plant Mol. Biol. 18, 611e612. Chye, M.L., Tan, S., Tan, C.T., Kush, A., Chua, N.H.i., 1991. Nucleotide sequence of a cDNA clone encoding the precursor of ribulose-1, 5-bisphosphate carboxylase small subunit from Hevea brasiliensis (rubber tree). Plant Mol. biol. 16, 1077e1078.
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
Q1
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
PLAPHY4032_proof ■ 26 August 2014 ■ 7/7
L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7 Couee, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. bot. 57, 449e459. Creelman, R.A., Mason, H.S., Bensen, R.J., Boyer, J.S., Mullet, J.E., 1990. Water deficit and abscisic acid cause differential inhibition of shoot versus root growth in soybean seedlings: analysis of growth, sugar accumulation, and gene expression. Plant Physiol. 92, 205e214. Dat, J., Vandenabeele, S., Vranova, E., Van Montagu, M., Inze, D., Van Breusegem, F., 2000. Dual action of the active oxygen species during plant stress responses. Cell. Mol. life Sci. : CMLS 57, 779e795. Deng, L.H., Luo, M.W., Zhang, C.F., Zeng, H.C., 2012. Extraction of high-quality RNA from rubber tree leaves. Biosci. Biotechnol. Biochem. 76, 1394e1396. Devakumar, A., Gururaja Rao, G., Rajagopal, R., Sanjeeva Rao, P., George, M., Vijayakumar, K., Sethuraj, M., 1988. Studies on soil-plant-atmosphere system in Hevea: II. Seasonal effects on water relations and yield. Indian J. Nat. Rubber Res. 1, 45e60. Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. bot. 32, 93e101. Gonçalves, P.d.S., Aguiar, A.T.d.E., Costa, R.B.d., Gonçalves, E.C.P., Scaloppi Júnior, E.J., Branco, R.B.F., 2009. Genetic variation and realized genetic gain from rubber tree improvement. Sci. Agric. 66, 44e51. Gururaja Rao, G., Devakumar, A., Rajagopal, R., Annamma, Y., Vijayakumar, K., Sethuraj, M., 1988. Clonal variations in leaf epicuticular waxes and reflectance: possible role in drought tolerance in Hevea. Indian J. Nat. Rubb Res. 1, 84e87. Hoekstra, F.A., Golovina, E.A., Buitink, J., 2001. Mechanisms of plant desiccation tolerance. Trends Plant Sci. 6, 431e438. Huang, Z.D., Pan, Y.Q., 1992. Rubber Cultivation Under Climatic Stresses in China. Elsevier, Amsterdam. ment-Vidal, A., Fabre, D., Oliver, G., Lardet, L., Leclercq, J., Martin, F., Sanier, C., Cle Ayar, A., Peyramard, M., Montoro, P., 2012. Over-expression of a cytosolic isoform of the HbCuZnSOD gene in Hevea brasiliensis changes its response to a water deficit. Plant Mol. Biol. 80, 255e272. Li, Y., Zhao, H.X., Duan, B.L., Korpelainen, H., Li, C.Y., 2011. Effect of drought and ABA on growth, photosynthesis and antioxidant system of Cotinus coggygria seedlings under two different light conditions. Environ. Exp. Bot. 71, 107e113. Lichtenthaler, H.K., 1987. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 148, 350e382. Luo, P., He, J.J., Yao, Y.L., Dai, X.H., Cheng, R.X., Wang, L.F., 2012. Differential responses of two rubber tree clones to chilling stress. Afr. J. Biotechnol. 11, 13466e13471. Mai, J., Herbette, S., Vandame, M., Kositsup, B., Kasemsap, P., Cavaloc, E., Julien, J.L., glio, T., Roeckel-Drevet, P., 2009. Effect of chilling on photosynthesis and Ame antioxidant enzymes in Hevea brasiliensis Muell. Arg. Trees 23, 863e874. Miao, Z.H., Gaynor, J.J., 1993. Molecular cloning, characterization and expression of Mn-superoxide dismutase from the rubber tree (Hevea brasiliensis). Plant Mol. Biol. 23, 267e277. Møller, I.M., 2001. Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant Biol. 52, 561e591.
7
Monclus, R., Dreyer, E., Villar, M., Delmotte, F.M., Delay, D., Petit, J.M., Barbaroux, C., Le Thiec, D., Brechet, C., Brignolas, F., 2006. Impact of drought on productivity and water use efficiency in 29 genotypes of Populus deltoides x Populus nigra. New. Phytol. 169, 765e777. Nair, D.B., Dey, S.K., Rajagopal, R., Vijayakumar, K.R., Sethuraj, M.R., 1996. Synergistic effect of heat and osmotic stress in causing membrane injury in Hevea brasiliensis. J. Plant Biol. 39, 177e181. Peever, T.L., Higgins, V.J., 1989. Electrolyte leakage, lipoxygenase, and lipid peroxidation induced in tomato leaf tissue by specific and nonspecific elicitors from Cladosporium fulvum. Plant Physiol. 90, 867e875. Priyadarshan, P.M., Hoa, T.T.T., Huasun, H., de Gonçalves, P.S., 2005. Yielding potential of rubber (Hevea brasiliensis) in sub-pptimal environments. J. Crop Improv. 14, 221e247. Qin, B., 2013. The function of Rad6 gene in Hevea brasiliensis extends beyond DNA repair. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 66, 134e140. Ranasinghe, M.S., Milburn, J.A., 1995. Xylem conduction and cavitation in Hevea brasiliensis. J. Exp. bot. 46, 1693e1700. Reddy, Y., 2000. Effect of moisture stress on stability of membrane integrity in Hevea brasiliensis across temperature regimes. Indian J. For. 23, 110e111. Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant Biol. 44, 357e384. Shao, H.B., Liu, Z.H., Zhang, Z.B., Chen, Q.J., Chu, L.Y., Brestic, M., 2013. Biological roles of crop NADP-malic enzymes and molecular mechanisms involved in abiotic stress. Afr. J. Biotechnol. 10, 4947e4953. Webster, C.C., Baulkwill, W.J., 1989. Rubber. Longman scientific & technical. Yan, K., Shao, H., Shao, C., Chen, P., Zhao, S., Brestic, M., Chen, X., 2013. Physiological adaptive mechanisms of plants grown in saline soil and implications for sustainable saline agriculture in coastal zone. Acta Physiol. Plant. 35, 2867e2878. Zeppel, M.J., Anderegg, W.R., Adams, H.D., 2013. Forest mortality due to drought: latest insights, evidence and unresolved questions on physiological pathways and consequences of tree death. New. phytol. 197, 372e374. Zhou, Y.H., Lam, H.M., Zhang, J.H., 2007. Inhibition of photosynthesis and energy dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58, 1207e1217. Zhou, G.A., Chang, R.Z., Qiu, L.J., 2010. Overexpression of soybean ubiquitinconjugating enzyme gene GmUBC2 confers enhanced drought and salt tolerance through modulating abiotic stress-responsive gene expression in Arabidopsis. Plant Mol. Biol. 72, 357e367. Zhou, M.L., Ma, J.T., Zhao, Y.M., Wei, Y.H., Tang, Y.X., Wu, Y.M., 2012. Improvement of drought and salt tolerance in Arabidopsis and Lotus corniculatus by overexpression of a novel DREB transcription factor from Populus euphratica. Gene 506, 10e17. Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53, 247e273. Zivcak, M., Kalaji, H.M., Shao, H.-B., Olsovska, K., Brestic, M., 2014. Photosynthetic proton and electron transport in wheat leaves under prolonged moderate drought stress. J. Photochem. Photobiol. B Biol.. Q2
Please cite this article in press as: Wang, L.-f., Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016/j.plaphy.2014.08.012
41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80
