Accepted Manuscript Physiological response of Clostridium ljungdahlii DSM 13528 of ethanol production under different fermentation conditions Bin-Tao Xie, Zi-Yong Liu, Lei Tian, Fu-Li Li, Xiao-Hua Chen PII: DOI: Reference:
S0960-8524(14)01715-5 http://dx.doi.org/10.1016/j.biortech.2014.11.101 BITE 14307
To appear in:
Bioresource Technology
Received Date: Revised Date: Accepted Date:
10 October 2014 24 November 2014 25 November 2014
Please cite this article as: Xie, B-T., Liu, Z-Y., Tian, L., Li, F-L., Chen, X-H., Physiological response of Clostridium ljungdahlii DSM 13528 of ethanol production under different fermentation conditions, Bioresource Technology (2014), doi: http://dx.doi.org/10.1016/j.biortech.2014.11.101
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Physiological responseof Clostridium ljungdahliiDSM 13528 of ethanol production underdifferent fermentation conditions Bin-Tao Xiea,b, Zi-Yong Liu a, Lei Tiana, Fu-Li Lia,Xiao-Hua Chena*
a
Key laboratory of Biofuels, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Songling Road 189, Qingdao 266101, China b University of Chinese Academy of Sciences, Yuquan Road 19A, Beijing 100049, China
Author for correspondence: Xiao-Hua Chen, Key laboratory of Biofuels, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Songling Road 189, Qingdao 266101, China, Tel: +86-532-80662655, Fax: +86-532-80662778, E-mail: [email protected]
1
Abstract In this study, cell growth, gene expressionand ethanol productionwere monitored under different fermentationconditions. Like its heterotrophicalABE-producingrelatives, a switch
fromacidogenesis
tosolventogenesisofC.ljungdahliiduring
the
autotrophic
fermentationwith CO/CO2 could be observed, which occurred surprisingly in the late-log phase rather than in the transition phase. The gene expression profiles indicated thataor1,one of the putative aldehyde oxidoreductasesin its genome played a critical role in the formation of ethanol, and its transcription could be induced by external acids. Moreover, a low amount of CaCO3 was proved to have positive influences on the cell density and substrate utilization, followed by an increase of over 40% ethanol and 30% acetate formation.
Keywords: Clostridium ljungdahlii;CO/CO2 fermentation;Ethanol synthesis;Acid induction;CaCO3 effect.
2
1. Introduction As an important renewable energy, ethanol production has been broadly studied in different organisms, such as yeast, Clostridia, Caldicellulosiruptoretc.by using variant carbohydrates as carbon sources(Sanchez & Cardona, 2008; Sun & Cheng, 2002; Ying et al., 2013; Yuan et al., 2013; Zhang et al., 2014).Recently, fermentations with CO2 containing gases are in the focus, which are important components in waste gases from steel mills, power plants, and refineries as well as syngas produced by gasification of biomass (Munasinghe & Khanal, 2010a). Acetogens are anaerobic bacteria occupying Wood-ljungdahl pathway for reduction of CO2 to synthesis acetyl-CoA, for energy conservation and for fixation of CO2 into cell carbon(Drake et al., 2008). Clostridium ljungdahlii, one of these strict anaerobes, is able to grow autotrophically by using H2 and/or CO as electron donor and CO2 as electron acceptor to produce bulk chemicals and biofuels such as acetate,ethanol and 2,3-butanediol (23BD), but not butyrate or butanol due to missing genes involved in butyrate or butanol synthesis such as crt (encoding crotonase) and bcd (encoding butyryl-CoA dehydrogenase)(Bengelsdorf et al., 2013; Kopke et al., 2011). In contrast, the heterotrophicClostridia such as C. acetobutylicum andC. beijerinckii,could produce acetone and butanol via the ABE (acetone-butanol-ethanol) fermentation. Using glucose or xylan as carbon source, these ABE-producers synthesizepredominantly acetate and butyrate duringacidogenesis (pH>5.2), until the pH decreases sharply to about 4.5 andthe fermentation switchesfromacidogenesis to solventogenesis. During the solventogenic phase, acetone
3
and butanol are mainly conversed from acetate and butyrate and the pH increases lightly(Durre, 2008; Jang et al., 2014; Millat et al., 2013). According to the genomic information from C. ljungdahliiDSM 13528, the metabolic pathways including the fixation of CO/CO2 and production of ethanol could be illustrated (Kopke et al., 2010). Transcriptomic analysis of C. ljungdahlii DSM 13528 grown on fructose versusautotrophically on H2/CO2 or CO/CO2 revealed that some hypothetical genes like cooS1 may play a critical role in the carbon fixation process(Nagarajan et al., 2013; Tan et al., 2013). Different gascompositions were investigated for theirinfluence on the yield of ethanol. During the fermentation under syngascontaining 44% (v/v) CO, 32% (v/v) N2, 22% (v/v) CO2, and 2% (v/v) H2, the major products were1.8 g/lacetate, 0.9 g/l ethanol as well as a trace amount of 23BD and lactate (Kopke et al., 2010; Kopke et al., 2011).Using 80% (v/v) H2 and 20% (v/v) CO2fermentation could increase the production of acetate to about 7 g/l, but the ethanol production has no significant alternation(Ueki et al., 2014).The slow gas–liquid masstransfer rate is one of these barriers that hinders the utilization of carbon fixation process. To overcome this problem, several approaches on improving bioreactors, increasing CO concentration in the liquid phase by raising the partial pressure of CO or using nanoparticles to enlarge surfaces between gas and liquid phasewere developed (Bredwell et al., 1999; Hurst & Lewis, 2010; Kim et al., 2014; Munasinghe & Khanal, 2010b; Ungerman & Heindel, 2007). Despite these efforts, the productivity of chemical bulks such as ethanol from C.
4
ljungdahliiis
still
very
low
in
comparison
with
ABE-producers.
Previous
researchesshowed that fermentation broth additivessuch as acetate and calcium carbonatehavesuccessfullyincreasedthe yield and productivity during ABE fermentation (Han et al., 2013).Nevertheless，little is known about influences of variant compounds like acids or metal irons on the ethanol production and gene-expression profiles of key enzymes during the fermentation process of C. ljungdahlii DSM 13528. In this study, C. ljungdahliiDSM 13528 was fermented by using a gas composition of CO/CO2 in a 5 lbioreactor, meanwhile the geneexpression profilesfor key metabolic enzymes involved in the carbon fixation, biosynthesis of acetic acid and ethanolwere analyzed at various time points.Combining with the effect of acids on the cell growth and ethanol productivity,it could beproposed that similar to the solventogenicClostridia, the switch fromacidogenic phase tosolventogenic phase in the C.ljungdahliiDSM13528 fermentation process did exist andcould be shifted by external acids. Moreover, CaCO3 played acrucial role in the cell density of C. ljungdahliiDSM 13528 and substrate utilization that led to increasing ethanol productivity.
2. Materials and methods 2.1 Bacteria strain and growth conditions C. ljungdahlii DSM 13528 was purchased from the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany) and conservedby freezing mid-exponential phase cultures at -80 °C with 20% glycerol for
5
long-term storage. C. ljungdahlii DSM 13528 was generally cultivated at 37 °C and 200 rpm in a modified DSMZ 879 medium, supplied with 0.5 g/l L-cysteine and 5g/l fructose (unless otherwise stated). The original recipe includes both cysteine and sodium sulfide as reductant, but no significant difference was found in growth without sodium sulfide. The basal DSMZ 879 medium with the following composition (per liter): 1.0 g NH4Cl, 0.1 g KCl, 0.2 g MgSO4 × 7 H2O, 0.8 g NaCl, 0.02 g CaCl2× 2 H2O, 0.1 g KH2PO4, 0.2 mg Na2WO4× 2 H2O, 1 g NaHCO3, 0.3 g cysteine-HCl× H2O, 1 g yeast extract, 0.5 mg resazurin, 10 ml trace element solution and 10 ml vitamin solution. Trace element solution contains 1.5 g nitrilotriacetic acid, 3 g MgSO4 × 7 H2O, 0.5 g MnSO4 × H2O, 1 g NaCl, 0.1 g FeSO4 × 7 H2O, 0.18g CoSO4 × 7 H2O, 0.18 g ZnSO4 × 7 H2O, 0.01g CuSO4 × 5 H2O, 0.02 g KAl(SO4 )2× 12 H2O, 0.1 g CaCl2× 2 H2O, 0.01 g H3BO3, 0.01 g Na2MoO4× 2 H2O, 0.03 g NiCl2× 6 H2O and 0.3 mg Na2SeO3× 5 H2O in 1l distilled water. Vitamin solution involves 2 mg biotin, 2 mg folic acid, 10 mg pyridoxine-HCl, 5 mg thiamine-HCl× 2 H2O, 5 mg riboflavin, 5 mg Nicotinic acid, 5 mg D-Ca-pantothenate, 0.1 mg vitamin B12, 5 mg p-Aminobenzoicacid and 5 mg lipoic acid in 1l distilled water.Cells from frozen stocks wererecovered in 50 ml modified DSMZ 879 mediumfor 72 h, and then re-transferred into a fresh medium until OD600nm of 0.4as pre-culture for the further work. 2.5 ml pre-culture was inoculated into 50 ml modified DSMZ 879 medium. As cells grew to an OD600nm of 0.4 to 0.5, a final concentration of 20mM acetic acid, 4mMHClor 20mM sodium acetate buffer (pH 5.4)wasapplied in culturesfor
6
monitoringgene-expressions of C. ljungdahlii under extra acids. Cell density and pH value were monitored after 30 min and 10ml of cells were harvested and stored at -80 °C for RNA preparation. To examine effects of CaCO3 on the growth of C. ljungdahlii, 5 ml pre-culture was inoculated into 100ml modified DSMZ 879 medium containing 0.01 or 0.02g/l CaCO3.As negative control, no supplement of CaCO3 was used. Cell density and pH value were measured immediately after sampling. For fructose, ethanol and acetic acid analysis, 2ml samples were centrifuged at 4 °C and 10,000 ×g for 5 min and supernatants were collected and stored at -80 °C.
2.2 Fed batch Fermentation with CO/CO2 The gas fermentation was carried out anaerobically in a FUS-XL bioreactor (5 l;GuoQiang, Shanghai,China) containing 3 l of modified DSM 879 base medium (without fructose and yeast extract). The continuously supplied gas was composed of 20% (v/v)CO2 and 80% (v/v)CO with a constant pressure of 0.16 MPa.The temperature and stirring rate were controlled at 37°C and 60 rpm.Before inoculating, 150 ml pre-culture ofC. ljungdahlii wascentrifuged at 5,000 × g and room temperature for 5 min, washed twice with DSMZ 879base medium to remove the yeast extract and fructose, and then resuspendedin the same medium to retain the original starting volume.Cell density and pH value were monitored every 12 h before entering late-log phase and then every 24 h till the end of the fermentation. 15ml samples were collected for products analysis and
7
RNA preparation.
2.3Monitoring culture pH, cell growth and metabolic products The pH was measured with a Sartorius PB-10standard pH meter (Sartorius, Göttingen,Germany). The cell density was measured by using a 2600 spectrophotometer (Unico instrument,Shanghai,China) at OD600nm.Ethanol, acetic acid and fructose were routinely detected by using an Agilent 1200 Infinity series HPLC system (Agilent Technologies, Santa Clara, USA) equipped with a refractive index detector (RID) (Agilent Technologies, Santa Clara, USA)operated at 35°C. All samples, prepared by centrifugation at 12,000 × g and 4 °C for 5 min and filtration with 0.22 µm filters, were separated by aHi-Plex H columnwith the dimension 300 × 7.7 mm and particle size 8 µm(Agilent Technologies, Santa Clara, USA). The column was kept at 60°C. Slightly acidified water (0.005 M H2SO4) was used as the mobile phase, with a flow rate of 0.6 ml/min.Fructose, ethanol and acetate peaks were identified by their standard products. Theconcentrations were calculated according to peak areas by using their standard curves.
2.4 Gene expression by quantitative real-time PCR The cell pellets were harvested by centrifugation at 6,000 ×g and 4°C for 5 min, snap-frozen in liquid nitrogen, and stored at -80 °C.Total RNA was extracted with the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's
8
instructions.
The
RNA
concentrationand
quality
weredetermined
with
a
BiophotometerPlus (Eppendorf, Hamburg, Germany) combined with gel electrophoresis analysis. 16SrDNAprimers(Table 1) were used to detect the contamination of DNA in the total RNA samples. 1 µg RNA was usedto generatecDNAswith the TransScript First-Strand cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China) using random primers at 42 °C for 30 min. 3µl cDNA and 0.3µlof 20µMgene-specific primers (Table 1) were mixed with the LightCycler® 480 SYBR green Imaster mix (Roche Diagnostics, Mannheim, Germany) with a final volume of 20 µl. The LightCycler480 real-time PCR system (Roche Diagnostics, Mannheim, Germany) was used to amplify and to quantify PCR products. Reaction mixtures were incubated for 5 min at 95 °C, followed by 40 amplification cycles of 10 s at 95 °C, 10 s at 59 °C and 15 s at 72 °C. All reactions were performed in 96-well reaction plates.Transcript abundance of these genes was normalized with the housekeeping gene fhs(formyl-tetrahydrofolatesynthetase) constitutively expressed under the tested conditions(Liu et al., 2013). Relative levels of transcript abundance of the studied genes were calculated with the 2-△△CT method(Livak & Schmittgen, 2001). The fold change over 2 or under 0.5 was considered as significant gene expression change.Quantitative real-time PCR was done in triplicate for each sample in every experiment.
3. Results and discussion 3.1 Cell growth and production of ethanol under CO and CO2 fermentation
9
The fermentation was performed twice for totally 312 h with 20% (v/v) CO2 and 80% (v/v) CO as the sole carbon sources.After an exponential growth for about 250 h, the cell density reached its maximum ofbetween 1.3-1.5 at OD600nm and the cell entered the stationary phase. The pH wassharply decreased in the early- and mid-log phase. After fermentationfor216 h, the pH value kept stable at about 3.7 (Figure 1a). Acetate was the dominant product, which dramatically increased through the exponential growth phaseand reacheda final concentration of over 5 g/l (Figure 1b). A trace amount of ethanol was detected during the early- and mid-log phase. Then, a significant increase of ethanol production was observed in the late exponential phase. Similar to the acetic acid production, the ethanol concentration became stable in the stationary phase and stayed at about 0.8 g/l untill the end of fermentation (Figure 1b). Atransition from producing acetic acid to ethanol under gas condition could be observedsimilar toa previous work with C. ljungdahlii DSM 13528 by using fructose as the sole carbon and energy source(Leang et al., 2013). The physiological behavior of C.ljungdahliiDSM13528is analog to the biphasic fermentation carried out bysolventogenicClostridia, namely the acidogenic phase and the solventogenic phase(Durre, 2005). In the acidogenic phase, cells are in the exponential
stage
and
produce
acids
like
acetate
and
butyrate
with
a
co-currentpH-decrease(Jang et al., 2014), which is similar to the stage for acetate productionin C.ljungdahlii. While pH is increased during the typical solventogenic phasefollowed by acids re-assimilatingandintensive solvents synthesis(Jang et al., 2014),
10
pH did not drop in the solventogenic phase of C.ljungdahlii, which was probably due to the weak production of ethanol.Furthermore, unlike thesesolventogenic Clostridia whose switch of these two phases occursaround the transient phase, solvent production by gas fixation bacterium C.ljungdahliistarted in the late exponential phase (Figure 1b).
3.2 Geneexpression profiles duringthe fermentation with CO and CO2 To enable direct comparison of gene expression and ethanol formation during the fermentation with CO and CO2, the samples afterfermentation of 48 h (early-log phase), 144 h (mid-log phase) and 216 h (late-log phase)were chosen, which presented three typicalstatusesfor the ethanol formation in the process of CO and CO2 fermentation by C.ljungdahliiDSM13528. According to the genome analysis(Kopke et al., 2010), genes involved in the ethanol production (adhE1, adhE2, aor1 and aor2), acetic acid production (ack and pta) and carbon fixation (metF,folD, fdhI, fdhII andfdhIII) were monitored by real-time PCR. The gene expression of folD and metFthat are involved in themethyl sub-unit synthesis from CO2had no alternationduring the fermentation of CO and CO2, which was consistent with the result fromC. autoethanogenum(Kopke et al., 2011). However, the three genes annotated as the subunit of formate dehydrogenase, namely fdhI, fdhII and fdhIII, were all up-regulated at mid- and late-log phase, especiallyfdhII (Figure 2). It indicated that the genes in the up-stream of Wood-ljungdal pathway likecodH and fdhwere more likely to be regulated towards environmental changes rather than the
11
downstream genes such as folD and metF.Moreover, thisphenomenoncould be found in previous transcriptomic analysis under autotrophic and heterotrophic conditions (Nagarajan et al., 2013; Tan et al., 2013). As major enzymes involved in the same gene cluster for the acetate synthesis pathway, ack and pta were only slightly up-regulated at the mid-log phase, but significantlyup-regulated at the late-log phase in comparison with the early-log phase for over 20 folds (Figure 2). This was consistent with the increasing acetate production before the stationary growth phase. Furthermore, acetate kinase reaction plays a critical role in energy conservation in this strain for providing one molecular ATP when growing autotrophically(Kopke et al., 2010). The difficulty to obtain the necessary ATP energy in the late-log phase might be one of the reasons for the strong up-regulation of these two genes. The ethanol production related gene aor1was significantly up-regulated in the mid-logphase and slightly up-regulated in the late-logphase, while aor2 only slightly up-regulated in the mid-logphase. More surprisingly, the gene expression of adhE1andadhE2had no significant change during the ethanol production (Figure 2), though adhE1 is supposed to be critical for the ethanol biosynthesis(Leang et al., 2013).The stable expression of adhE1 and up-regulation of both aorgenes gave new insights about theunique feature of the ethanol biosynthesis pathway in C. ljungdahlii DSM 13528. Up-regulating aorgenes indicated that a possible alternative pathway through re-assimilation of acetate to ethanol exists, which is agreed to the genomic
12
analysis in the previous study(Kopke et al., 2010).Thus, the increasing abundance of aor transcripts, especially aor1, is the reason for the increasing ethanol production during the late exponential growth phase.
3.3 Gene expression profiles of C. ljungdahliiDSM 13528 treated by acids To check the influences of different acids on the C. ljungdahlii DSM 13528, acetic acid with a final concentration at 20 mM, HClat 4 mM or 20 mMsodium acetate buffer with pH 5.4 was added into culturesin the exponential phasewith OD600nm at 0.45.20 mMacetic acid or 4mMHClled to pH decreasing of cultures from 5.4 to about 4.5, while 20 mMsodium acetate buffer with pH 5.4 supplied only extra CH3COO-without pH decrease. Samples were gathered after 30 min treatment for gene expression analysis. aor1, adhE1, ack and pta were up-regulated under treatment with acetic acid, among which aor1 expression increased by 7 fold (Figure 3). After treatment with4 mMHCl, a slightly up-regulation of aor1, pta and ackwasobserved(Figure 3). However, aor2, adhE1 and adhE2 were significantly down-regulated to 0.19, 0.05 and 0.09 fold respectively (Figure 3). Moreover, sodium acetate did not make any significant expression changes, which indicated that expression of these genes could be induced by H+, but not CH3COO-after a short treatment (Figure 3). Changes of the external pH level could induce the transition from acidogenic state to solventogenicstateand have been already well studied in heterotrophic Clostridia, like C. acetobutylicum(Fischer et al., 2006; Millat et al., 2013). The results showed that decreasing culture pH couldstimulate the expression of ethanol pathway genes and acetate synthesis genes in an autotrophic Clostridium. This is the first experimental evidence that the switch fromacidogenesis to solventogenesisis not limited in the 13
heterotrophicacetone-butanol-ethanol fermentationClostridia, which might exist more widely in this genus than it was thought before.The genesinvolved in the switch process arepotential targets forfurther bio-engineering approaches to increase ethanol production during its fermentation.
3.4 Effects of CaCO3 to the fermentation of C.ljungdahliiDSM 13528 Recent research showed a positive effect of CaCO3on the substrate utilization inC.beijerinckii(Han et
al.,
2013),
soits
influences
wereexaminedduring the
fermentation of C. ljungdahliiDSM 13528on the cell growth,substrate utilization and metabolites production. Asmonitoring the amount of fructose is more convenient under the laboratory conditions in comparison to CO or CO2, 5 g/l fructosewas used as carbon sourcein this study to checkthe substrate consumption rate. Adding 0.01 g/l CaCO3 in the medium increased the cell density to1.57 at OD600nm after 72 h fermentation, while the double amount of CaCO3 (0.02 g/l)reduced the growth of the bacterium (the cell density was only 0.78 at OD600nm). Interestingly, thisinfluence of CaCO3did not happen in the beginning of the growth, butoccuredat OD600nmof about 0.7 (Figure 4a). Simultaneously, the fructose amountin the cultureswas measured.84% of fructose was consumed in the culture containing 0.01 g/lCaCO3, whereas only 24% or 52% of fructose was used up in the culture with 0.02 g/lCaCO3 or without CaCO3 (Figure 4b). The cell density was correlated with the fructose consumption. The finalpH of the cultureswas4.12 for treatment with 0.01 g/l CaCO3,4.57 for 14
treatment with 0.02 g/l and 4.34 without CaCO3, respectively(Figure 4a).This was correlated with the acetate production (Figure 4c).While3.8 g/l acetate and 0.7 g/l ethanol was obtained in the fermentationwithout CaCO3, 5 g/l acetate (about 30% increment) and 1 g/l ethanol (about 40% increment) were obtained from the culture with 0.01 g/l CaCO3
(Figure 4d).Similar to the previous report in the bacterium
C.beijerinckii(Han et al., 2013),this investigation showed that an enhanced production of ethanol and acetate were resulted the increased cell density and substrate utilization triggered by CaCO3 during the fermentation of C. ljungdahlii. However,CaCO3 could enhance the growth and productivity of C.beijerinckii at a broad range of CaCO3 concentrations (about 2-10 g/l) (Han et al., 2013), while only a very low concentration of CaCO3 (about 0.01 g/l) had the effectduring the fermentation with C. ljungdahlii DSM 13528. A similar correlation betweenincreasing cell density as well as fructose utilization and the production of ethanol and acetate was observed under supplementing extra CaCl2 with a final concentration of 0.01 g/l instead of CaCO3 in this study (S 3).The stronger effect from CaCO3 in comparison to CaCl2was probablycaused by slowly releasing of a trace amount of free Ca2+ into the culture medium due to the very low water solubility of CaCO3. But it could be an effect from the buffering capacity of carbonate. To investigate the role of carbonate during C. ljungdahlii DSM 13528fermentation, extra 0.05 g/l NaHCO3 or 0.05 g/l Na2CO3 was supplied in the culture medium. Butno expectedeffect could be observed during the fermentation of C.
15
ljungdahlii DSM 13528 (data not shown), while variouscarbonate-containing compounds showedgenerallypositive effect on the growth of C.beijerinckiithrough buffering effect (Han et al., 2013). It indicated that Ca2+probably served as a signaling factor in the case ofC. ljungdahlii DSM 13528 rather than a buffering effect from carbonate.
4. Conclusion This work revealed the existence of the transition from acidogenesis to solventogenesisin C. ljungdahliifermentation. The significant up-regulation of aor1 and acid accumulation induced aor1 transcription gave the first experimentalevidenceofthe criticalrole ofaor1in triggering ethanol productionthrough a unique alternative acetate re-assimilation pathway.Precisely controlling the transcription of aor1 and fine-tuning pH during fermentation canimprove the ethanol production remarkably. Low concentrations of CaCO3couldincrease the production of acetate and ethanol through enhancing the cell growth and substrate utilization. However, its mechanism needs to be furtherinvestigated.
Acknowledgements This study was supported by grants from the Chinese Academy of Sciences (KSZD-EW-Z-017-1) and the Natural Science Foundation of China (11311140293).
16
Reference 1.
Bengelsdorf, F.R., Straub, M., Dürre, P. 2013. Bacterial synthesis gas (syngas) fermentation. Environmental Technology, 34(13-14), 1639-1651.
2.
Bredwell, M.D., Srivastava, P., Worden, R.M. 1999. Reactor Design Issues for Synthesis-Gas Fermentations. Biotechnol Prog, 15(5), 834-844.
3.
Drake, H.L., Gossner, A.S., Daniel, S.L. 2008. Old acetogens, new light. Ann N Y Acad Sci, 1125, 100-28.
4.
Durre, P. 2008. Fermentative butanol production: bulk chemical and biofuel. Ann N Y Acad Sci, 1125, 353-62.
5. 6.
Durre, P. 2005. Formation of solvents in Clostridia. Handbook on clostridia, 671-693. Fischer, R.J., Oehmcke, S., Meyer, U., Mix, M., Schwarz, K., Fiedler, T., Bahl, H. 2006. Transcription of the pst operon of Clostridium acetobutylicum is dependent on phosphate concentration and pH. J Bacteriol, 188(15), 5469-78.
7.
Han, B., Ujor, V., Lai, L.B., Gopalan, V., Ezeji, T.C. 2013. Use of Proteomic Analysis To Elucidate the Role of Calcium in Acetone-Butanol-Ethanol Fermentation by Clostridium beijerinckii NCIMB 8052. Applied and Environmental Microbiology, 79(1), 282-293.
8.
Hurst, K.M., Lewis, R.S. 2010. Carbon monoxide partial pressure effects on the metabolic process of syngas fermentation. Biochemical Engineering Journal 48(2), 159-165.
9.
Jang, Y.S., Han, M.J., Lee, J., Im, J.A., Lee, Y.H., Papoutsakis, E.T., Bennett, G., Lee, S.Y. 2014. Proteomic analyses of the phase transition from acidogenesis to solventogenesis using solventogenic and non-solventogenic Clostridium acetobutylicum strains. Applied Microbiology and Biotechnology, 98(11), 5105-5115.
10. Kim, Y.K., Park, S.E., Lee, H., Yun, J.Y. 2014. Enhancement of bioethanol production in syngas fermentation with Clostridium ljungdahlii using nanoparticles. Bioresour Technol, 159, 446-50. 11. Kopke, M., Held, C., Hujer, S., Liesegang, H., Wiezer, A., Wollherr, A., Ehrenreich, A., Liebl, W., Gottschalk, G., Durre, P. 2010. Clostridium ljungdahlii represents a microbial production platform based on syngas. Proceedings of the National Academy of Sciences of the United States of America, 107(29), 13087-13092. 12. Kopke, M., Mihalcea, C., Liew, F.M., Tizard, J.H., Ali, M.S., Conolly, J.J., Al-Sinawi, B., Simpson, S.D. 2011. 2,3-Butanediol Production by Acetogenic Bacteria, an Alternative Route to Chemical Synthesis, Using Industrial Waste Gas. Applied and Environmental Microbiology, 77(15), 5467-5475. 13. Leang, C., Ueki, T., Nevin, K.P., Lovley, D.R. 2013. A Genetic System for Clostridium ljungdahlii: a Chassis for Autotrophic Production of Biocommodities and a Model Homoacetogen. Applied and Environmental Microbiology, 79(4), 1102-1109. 14. Liu, J., Tan, Y., Yang, X., Chen, X., Li, F. 2013. Evaluation of Clostridium ljungdahlii DSM 13528 reference genes in gene expression studies by qRT-PCR. J Biosci Bioeng, 116(4), 460-4. 15. Livak, K.J., Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods, 25(4), 402-408. 16. Millat, T., Janssen, H., Thorn, G.J., King, J.R., Bahl, H., Fischer, R.J., Wolkenhauer, O. 2013. A shift in the dominant phenotype governs the pH-induced metabolic switch of Clostridium acetobutylicumin phosphate-limited continuous cultures. Appl Microbiol Biotechnol, 97(14), 6451-66.
17
17. Munasinghe, P.C., Khanal, S.K. 2010a. Biomass-derived syngas fermentation into biofuels: Opportunities and challenges. Bioresour Technol, 101(13), 5013-22. 18. Munasinghe, P.C., Khanal, S.K. 2010b. Syngas fermentation to biofuel: evaluation of carbon monoxide mass transfer coefficient (kLa) in different reactor configurations. Biotechnol Prog, 26(6), 1616-21. 19. Nagarajan, H., Sahin, M., Nogales, J., Latif, H., Lovley, D.R., Ebrahim, A., Zengler, K. 2013. Characterizing acetogenic metabolism using a genome-scale metabolic reconstruction of Clostridium ljungdahlii. Microbial Cell Factories, 12. 20. Sanchez, O.J., Cardona, C.A. 2008. Trends in biotechnological production of fuel ethanol from different feedstocks. Bioresour Technol, 99(13), 5270-95. 21. Sun, Y., Cheng, J. 2002. Hydrolysis of lignocellulosic materials for ethanol production: a review. Bioresour Technol, 83(1), 1-11. 22. Tan, Y., Liu, J.J., Chen, X.H., Zheng, H.J., Li, F.L. 2013. RNA-seq-based comparative transcriptome analysis of the syngas-utilizing bacterium Clostridium ljungdahlii DSM 13528 grown autotrophically and heterotrophically. Molecular Biosystems, 9(11), 2775-2784. 23. Ueki, T., Nevin, K.P., Woodard, T.L., Lovley, D.R. 2014. Converting Carbon Dioxide to Butyrate with an Engineered Strain of Clostridium ljungdahlii. MBio, 5(5). 24. Ungerman, A.J., Heindel, T.J. 2007. Carbon monoxide mass transfer for syngas fermentation in a stirred tank reactor with dual impeller configurations. Biotechnol Prog, 23(3), 613-20. 25. Ying, Y., Meng, D., Chen, X., Li, F. 2013. An extremely thermophilic anaerobic bacterium Caldicellulosiruptor sp. F32 exhibits distinctive properties in growth and xylanases during xylan hydrolysis. Enzyme Microb Technol, 53(3), 194-9. 26. Yuan, B., Wang, S.A., Li, F.L. 2013. Improved ethanol fermentation by heterologous endoinulinase and inherent invertase from inulin by Saccharomyces cerevisiae. Bioresour Technol, 139, 402-5. 27. Zhang, K., Chen, X., Schwarz, W.H., Li, F. 2014. Synergism of glycoside hydrolase secretomes from two thermophilic bacteria cocultivated on lignocellulose. Appl Environ Microbiol, 80(8), 2592-601.
18
FIGURE LEGENDS: Figure 1Cell growth and metabolites analysis of C. ljungdahlii DSM 13528 underthe CO/CO2 fermentation with duplication (circle and triangle):(a)cell density (unfilled) and pH value (filled); (b) the concentration of acetate (unfilled) and ethanol (filled). Figure 2Gene expression profiles of C. ljungdahlii DSM 13528 under the CO/CO2fermentation:ack, acetate kinase; adhE1 and adhE2, aldehyde/alcohol dehydrogenase; aor1 and aor2, putative aldehyde oxidoreductase; fdh, formate dehydrogenase; folD, methylene-tetrahydrofolate dehydrogenase; metF, methylene-tetrahydrofolate reductase; pta, phosphotransacetylase. Figure 3Gene expression profiles of C. ljungdahlii DSM 13528under treatment with externalacids: ack, acetate kinase; adhE1 and adhE2, aldehyde/alcohol dehydrogenase; aor1 and aor2, putative aldehyde oxidoreductase; pta, phosphotransacetylase. Figure 4Cell growth and metabolites analysis of C. ljungdahlii DSM 13528 underthe fructose fermentation supplied with different concentration of CaCO3:(a) cell density (filled) and pH value (empty); (b) fructose concentration; (c) acetate concentration and (d) ethanol concentration.Supplements with 0.01 g/l CaCO3 (triangle), 0.02 g/l CaCO3(circle)or without CaCO3 (square) were checked.
19
TABLE: Table 1Primers used in this study. Gene locus
primer
Sequence (5’ to 3’)
CLJU_c20110
aor1-RT-1
GCACCGCTTACAGGAACTATA
aor1-RT-2
ACTGGTGAATCAGCCTTATCC
aor2-RT-1
TAGCAGCAGATGGATTGTCAC
aor2-RT-2
CAGGTACACCGTATGAGTCACA
adhE1-RT-1
ATCAGTTGGTGGTGGCTCAG
adhE1-RT-2
TTCCTGCGGATGTTGCTACT
adhE2-RT-1
GATCCAACCCTTGCTACA
adhE2-RT-2
GATGCTCATACATTACCCAC
ackA-RT-1
ATTTACAGCAGGACTTGGAG
ackA-RT-2
GTGCTTATTTCTAGTGCCTC
pta-RT-1
AGAAGGGAATAACGCCAGAA
pta-RT-2
TATGAACCGCACCTGAAACC
folD-RT-1
AACCAGTGGCAGATGCTATA
folD-RT-2
CGTTTGCTCCAACTCTTACT
metF-RT-1
AAAGATGCAGGATTAGAACC
metF-RT-2
GCCACCTGTAATATCCCAAC
fhs-RT-1
AGCAAAGACCCAATACTCCT
fhs-RT-2
TTTCCAAGACCTGGCATC
fdhI-RT-1
AGCAGTTAGCCGATGAACCA
fdhI-RT-2
GGCAACCACAGAACCTCTTC
fdhII-RT-1
TGCTTCTGAATGGAGACCTACA
fdhII-RT-2
TTCCAAGTTCTTCCGCATCTTC
fdhIII-RT-1
CCAGGTACAGATGTAGCACTTC
fdhIII-RT-2
TCTTGTCTGCTGGAACCTTAGT
16S-27F
AGAGTTTGATCCTGGCTCAG
16S-1492R
TACGGCTACCTTGTTACGACT
Product length (bp) 113
CLJU_c20210
141
CLJU_c16510
179
CLJU_c16520
130
CLJU_c12780
129
CLJU_c12770
114
CLJU_c37630
105
CLJU_c37610
200
CLJU_c37650
153
CLJU_c06990
116
CLJU_c08930
185
CLJU_c20040
175
CLJU_c00080
1461
20
FIGURES Fig. 1
21
Fig. 2
22
Fig. 3
23
Fig. 4
24
Highlights
A unique alternative acetate re-assimilation pathwaytriggeredethanol production. Putative aldehyde oxidoreductaseaor1 involved in this alternativepathway. Accumulation of external acids induced the shift to solventogenesis. A trace amount ofCaCO3 increased ethanoland acetate production.
25
S0960-8524(14)01715-5 http://dx.doi.org/10.1016/j.biortech.2014.11.101 BITE 14307
To appear in:
Bioresource Technology
Received Date: Revised Date: Accepted Date:
10 October 2014 24 November 2014 25 November 2014
Please cite this article as: Xie, B-T., Liu, Z-Y., Tian, L., Li, F-L., Chen, X-H., Physiological response of Clostridium ljungdahlii DSM 13528 of ethanol production under different fermentation conditions, Bioresource Technology (2014), doi: http://dx.doi.org/10.1016/j.biortech.2014.11.101
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Physiological responseof Clostridium ljungdahliiDSM 13528 of ethanol production underdifferent fermentation conditions Bin-Tao Xiea,b, Zi-Yong Liu a, Lei Tiana, Fu-Li Lia,Xiao-Hua Chena*
a
Key laboratory of Biofuels, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Songling Road 189, Qingdao 266101, China b University of Chinese Academy of Sciences, Yuquan Road 19A, Beijing 100049, China
Author for correspondence: Xiao-Hua Chen, Key laboratory of Biofuels, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Songling Road 189, Qingdao 266101, China, Tel: +86-532-80662655, Fax: +86-532-80662778, E-mail: [email protected]
1
Abstract In this study, cell growth, gene expressionand ethanol productionwere monitored under different fermentationconditions. Like its heterotrophicalABE-producingrelatives, a switch
fromacidogenesis
tosolventogenesisofC.ljungdahliiduring
the
autotrophic
fermentationwith CO/CO2 could be observed, which occurred surprisingly in the late-log phase rather than in the transition phase. The gene expression profiles indicated thataor1,one of the putative aldehyde oxidoreductasesin its genome played a critical role in the formation of ethanol, and its transcription could be induced by external acids. Moreover, a low amount of CaCO3 was proved to have positive influences on the cell density and substrate utilization, followed by an increase of over 40% ethanol and 30% acetate formation.
Keywords: Clostridium ljungdahlii;CO/CO2 fermentation;Ethanol synthesis;Acid induction;CaCO3 effect.
2
1. Introduction As an important renewable energy, ethanol production has been broadly studied in different organisms, such as yeast, Clostridia, Caldicellulosiruptoretc.by using variant carbohydrates as carbon sources(Sanchez & Cardona, 2008; Sun & Cheng, 2002; Ying et al., 2013; Yuan et al., 2013; Zhang et al., 2014).Recently, fermentations with CO2 containing gases are in the focus, which are important components in waste gases from steel mills, power plants, and refineries as well as syngas produced by gasification of biomass (Munasinghe & Khanal, 2010a). Acetogens are anaerobic bacteria occupying Wood-ljungdahl pathway for reduction of CO2 to synthesis acetyl-CoA, for energy conservation and for fixation of CO2 into cell carbon(Drake et al., 2008). Clostridium ljungdahlii, one of these strict anaerobes, is able to grow autotrophically by using H2 and/or CO as electron donor and CO2 as electron acceptor to produce bulk chemicals and biofuels such as acetate,ethanol and 2,3-butanediol (23BD), but not butyrate or butanol due to missing genes involved in butyrate or butanol synthesis such as crt (encoding crotonase) and bcd (encoding butyryl-CoA dehydrogenase)(Bengelsdorf et al., 2013; Kopke et al., 2011). In contrast, the heterotrophicClostridia such as C. acetobutylicum andC. beijerinckii,could produce acetone and butanol via the ABE (acetone-butanol-ethanol) fermentation. Using glucose or xylan as carbon source, these ABE-producers synthesizepredominantly acetate and butyrate duringacidogenesis (pH>5.2), until the pH decreases sharply to about 4.5 andthe fermentation switchesfromacidogenesis to solventogenesis. During the solventogenic phase, acetone
3
and butanol are mainly conversed from acetate and butyrate and the pH increases lightly(Durre, 2008; Jang et al., 2014; Millat et al., 2013). According to the genomic information from C. ljungdahliiDSM 13528, the metabolic pathways including the fixation of CO/CO2 and production of ethanol could be illustrated (Kopke et al., 2010). Transcriptomic analysis of C. ljungdahlii DSM 13528 grown on fructose versusautotrophically on H2/CO2 or CO/CO2 revealed that some hypothetical genes like cooS1 may play a critical role in the carbon fixation process(Nagarajan et al., 2013; Tan et al., 2013). Different gascompositions were investigated for theirinfluence on the yield of ethanol. During the fermentation under syngascontaining 44% (v/v) CO, 32% (v/v) N2, 22% (v/v) CO2, and 2% (v/v) H2, the major products were1.8 g/lacetate, 0.9 g/l ethanol as well as a trace amount of 23BD and lactate (Kopke et al., 2010; Kopke et al., 2011).Using 80% (v/v) H2 and 20% (v/v) CO2fermentation could increase the production of acetate to about 7 g/l, but the ethanol production has no significant alternation(Ueki et al., 2014).The slow gas–liquid masstransfer rate is one of these barriers that hinders the utilization of carbon fixation process. To overcome this problem, several approaches on improving bioreactors, increasing CO concentration in the liquid phase by raising the partial pressure of CO or using nanoparticles to enlarge surfaces between gas and liquid phasewere developed (Bredwell et al., 1999; Hurst & Lewis, 2010; Kim et al., 2014; Munasinghe & Khanal, 2010b; Ungerman & Heindel, 2007). Despite these efforts, the productivity of chemical bulks such as ethanol from C.
4
ljungdahliiis
still
very
low
in
comparison
with
ABE-producers.
Previous
researchesshowed that fermentation broth additivessuch as acetate and calcium carbonatehavesuccessfullyincreasedthe yield and productivity during ABE fermentation (Han et al., 2013).Nevertheless，little is known about influences of variant compounds like acids or metal irons on the ethanol production and gene-expression profiles of key enzymes during the fermentation process of C. ljungdahlii DSM 13528. In this study, C. ljungdahliiDSM 13528 was fermented by using a gas composition of CO/CO2 in a 5 lbioreactor, meanwhile the geneexpression profilesfor key metabolic enzymes involved in the carbon fixation, biosynthesis of acetic acid and ethanolwere analyzed at various time points.Combining with the effect of acids on the cell growth and ethanol productivity,it could beproposed that similar to the solventogenicClostridia, the switch fromacidogenic phase tosolventogenic phase in the C.ljungdahliiDSM13528 fermentation process did exist andcould be shifted by external acids. Moreover, CaCO3 played acrucial role in the cell density of C. ljungdahliiDSM 13528 and substrate utilization that led to increasing ethanol productivity.
2. Materials and methods 2.1 Bacteria strain and growth conditions C. ljungdahlii DSM 13528 was purchased from the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany) and conservedby freezing mid-exponential phase cultures at -80 °C with 20% glycerol for
5
long-term storage. C. ljungdahlii DSM 13528 was generally cultivated at 37 °C and 200 rpm in a modified DSMZ 879 medium, supplied with 0.5 g/l L-cysteine and 5g/l fructose (unless otherwise stated). The original recipe includes both cysteine and sodium sulfide as reductant, but no significant difference was found in growth without sodium sulfide. The basal DSMZ 879 medium with the following composition (per liter): 1.0 g NH4Cl, 0.1 g KCl, 0.2 g MgSO4 × 7 H2O, 0.8 g NaCl, 0.02 g CaCl2× 2 H2O, 0.1 g KH2PO4, 0.2 mg Na2WO4× 2 H2O, 1 g NaHCO3, 0.3 g cysteine-HCl× H2O, 1 g yeast extract, 0.5 mg resazurin, 10 ml trace element solution and 10 ml vitamin solution. Trace element solution contains 1.5 g nitrilotriacetic acid, 3 g MgSO4 × 7 H2O, 0.5 g MnSO4 × H2O, 1 g NaCl, 0.1 g FeSO4 × 7 H2O, 0.18g CoSO4 × 7 H2O, 0.18 g ZnSO4 × 7 H2O, 0.01g CuSO4 × 5 H2O, 0.02 g KAl(SO4 )2× 12 H2O, 0.1 g CaCl2× 2 H2O, 0.01 g H3BO3, 0.01 g Na2MoO4× 2 H2O, 0.03 g NiCl2× 6 H2O and 0.3 mg Na2SeO3× 5 H2O in 1l distilled water. Vitamin solution involves 2 mg biotin, 2 mg folic acid, 10 mg pyridoxine-HCl, 5 mg thiamine-HCl× 2 H2O, 5 mg riboflavin, 5 mg Nicotinic acid, 5 mg D-Ca-pantothenate, 0.1 mg vitamin B12, 5 mg p-Aminobenzoicacid and 5 mg lipoic acid in 1l distilled water.Cells from frozen stocks wererecovered in 50 ml modified DSMZ 879 mediumfor 72 h, and then re-transferred into a fresh medium until OD600nm of 0.4as pre-culture for the further work. 2.5 ml pre-culture was inoculated into 50 ml modified DSMZ 879 medium. As cells grew to an OD600nm of 0.4 to 0.5, a final concentration of 20mM acetic acid, 4mMHClor 20mM sodium acetate buffer (pH 5.4)wasapplied in culturesfor
6
monitoringgene-expressions of C. ljungdahlii under extra acids. Cell density and pH value were monitored after 30 min and 10ml of cells were harvested and stored at -80 °C for RNA preparation. To examine effects of CaCO3 on the growth of C. ljungdahlii, 5 ml pre-culture was inoculated into 100ml modified DSMZ 879 medium containing 0.01 or 0.02g/l CaCO3.As negative control, no supplement of CaCO3 was used. Cell density and pH value were measured immediately after sampling. For fructose, ethanol and acetic acid analysis, 2ml samples were centrifuged at 4 °C and 10,000 ×g for 5 min and supernatants were collected and stored at -80 °C.
2.2 Fed batch Fermentation with CO/CO2 The gas fermentation was carried out anaerobically in a FUS-XL bioreactor (5 l;GuoQiang, Shanghai,China) containing 3 l of modified DSM 879 base medium (without fructose and yeast extract). The continuously supplied gas was composed of 20% (v/v)CO2 and 80% (v/v)CO with a constant pressure of 0.16 MPa.The temperature and stirring rate were controlled at 37°C and 60 rpm.Before inoculating, 150 ml pre-culture ofC. ljungdahlii wascentrifuged at 5,000 × g and room temperature for 5 min, washed twice with DSMZ 879base medium to remove the yeast extract and fructose, and then resuspendedin the same medium to retain the original starting volume.Cell density and pH value were monitored every 12 h before entering late-log phase and then every 24 h till the end of the fermentation. 15ml samples were collected for products analysis and
7
RNA preparation.
2.3Monitoring culture pH, cell growth and metabolic products The pH was measured with a Sartorius PB-10standard pH meter (Sartorius, Göttingen,Germany). The cell density was measured by using a 2600 spectrophotometer (Unico instrument,Shanghai,China) at OD600nm.Ethanol, acetic acid and fructose were routinely detected by using an Agilent 1200 Infinity series HPLC system (Agilent Technologies, Santa Clara, USA) equipped with a refractive index detector (RID) (Agilent Technologies, Santa Clara, USA)operated at 35°C. All samples, prepared by centrifugation at 12,000 × g and 4 °C for 5 min and filtration with 0.22 µm filters, were separated by aHi-Plex H columnwith the dimension 300 × 7.7 mm and particle size 8 µm(Agilent Technologies, Santa Clara, USA). The column was kept at 60°C. Slightly acidified water (0.005 M H2SO4) was used as the mobile phase, with a flow rate of 0.6 ml/min.Fructose, ethanol and acetate peaks were identified by their standard products. Theconcentrations were calculated according to peak areas by using their standard curves.
2.4 Gene expression by quantitative real-time PCR The cell pellets were harvested by centrifugation at 6,000 ×g and 4°C for 5 min, snap-frozen in liquid nitrogen, and stored at -80 °C.Total RNA was extracted with the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's
8
instructions.
The
RNA
concentrationand
quality
weredetermined
with
a
BiophotometerPlus (Eppendorf, Hamburg, Germany) combined with gel electrophoresis analysis. 16SrDNAprimers(Table 1) were used to detect the contamination of DNA in the total RNA samples. 1 µg RNA was usedto generatecDNAswith the TransScript First-Strand cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China) using random primers at 42 °C for 30 min. 3µl cDNA and 0.3µlof 20µMgene-specific primers (Table 1) were mixed with the LightCycler® 480 SYBR green Imaster mix (Roche Diagnostics, Mannheim, Germany) with a final volume of 20 µl. The LightCycler480 real-time PCR system (Roche Diagnostics, Mannheim, Germany) was used to amplify and to quantify PCR products. Reaction mixtures were incubated for 5 min at 95 °C, followed by 40 amplification cycles of 10 s at 95 °C, 10 s at 59 °C and 15 s at 72 °C. All reactions were performed in 96-well reaction plates.Transcript abundance of these genes was normalized with the housekeeping gene fhs(formyl-tetrahydrofolatesynthetase) constitutively expressed under the tested conditions(Liu et al., 2013). Relative levels of transcript abundance of the studied genes were calculated with the 2-△△CT method(Livak & Schmittgen, 2001). The fold change over 2 or under 0.5 was considered as significant gene expression change.Quantitative real-time PCR was done in triplicate for each sample in every experiment.
3. Results and discussion 3.1 Cell growth and production of ethanol under CO and CO2 fermentation
9
The fermentation was performed twice for totally 312 h with 20% (v/v) CO2 and 80% (v/v) CO as the sole carbon sources.After an exponential growth for about 250 h, the cell density reached its maximum ofbetween 1.3-1.5 at OD600nm and the cell entered the stationary phase. The pH wassharply decreased in the early- and mid-log phase. After fermentationfor216 h, the pH value kept stable at about 3.7 (Figure 1a). Acetate was the dominant product, which dramatically increased through the exponential growth phaseand reacheda final concentration of over 5 g/l (Figure 1b). A trace amount of ethanol was detected during the early- and mid-log phase. Then, a significant increase of ethanol production was observed in the late exponential phase. Similar to the acetic acid production, the ethanol concentration became stable in the stationary phase and stayed at about 0.8 g/l untill the end of fermentation (Figure 1b). Atransition from producing acetic acid to ethanol under gas condition could be observedsimilar toa previous work with C. ljungdahlii DSM 13528 by using fructose as the sole carbon and energy source(Leang et al., 2013). The physiological behavior of C.ljungdahliiDSM13528is analog to the biphasic fermentation carried out bysolventogenicClostridia, namely the acidogenic phase and the solventogenic phase(Durre, 2005). In the acidogenic phase, cells are in the exponential
stage
and
produce
acids
like
acetate
and
butyrate
with
a
co-currentpH-decrease(Jang et al., 2014), which is similar to the stage for acetate productionin C.ljungdahlii. While pH is increased during the typical solventogenic phasefollowed by acids re-assimilatingandintensive solvents synthesis(Jang et al., 2014),
10
pH did not drop in the solventogenic phase of C.ljungdahlii, which was probably due to the weak production of ethanol.Furthermore, unlike thesesolventogenic Clostridia whose switch of these two phases occursaround the transient phase, solvent production by gas fixation bacterium C.ljungdahliistarted in the late exponential phase (Figure 1b).
3.2 Geneexpression profiles duringthe fermentation with CO and CO2 To enable direct comparison of gene expression and ethanol formation during the fermentation with CO and CO2, the samples afterfermentation of 48 h (early-log phase), 144 h (mid-log phase) and 216 h (late-log phase)were chosen, which presented three typicalstatusesfor the ethanol formation in the process of CO and CO2 fermentation by C.ljungdahliiDSM13528. According to the genome analysis(Kopke et al., 2010), genes involved in the ethanol production (adhE1, adhE2, aor1 and aor2), acetic acid production (ack and pta) and carbon fixation (metF,folD, fdhI, fdhII andfdhIII) were monitored by real-time PCR. The gene expression of folD and metFthat are involved in themethyl sub-unit synthesis from CO2had no alternationduring the fermentation of CO and CO2, which was consistent with the result fromC. autoethanogenum(Kopke et al., 2011). However, the three genes annotated as the subunit of formate dehydrogenase, namely fdhI, fdhII and fdhIII, were all up-regulated at mid- and late-log phase, especiallyfdhII (Figure 2). It indicated that the genes in the up-stream of Wood-ljungdal pathway likecodH and fdhwere more likely to be regulated towards environmental changes rather than the
11
downstream genes such as folD and metF.Moreover, thisphenomenoncould be found in previous transcriptomic analysis under autotrophic and heterotrophic conditions (Nagarajan et al., 2013; Tan et al., 2013). As major enzymes involved in the same gene cluster for the acetate synthesis pathway, ack and pta were only slightly up-regulated at the mid-log phase, but significantlyup-regulated at the late-log phase in comparison with the early-log phase for over 20 folds (Figure 2). This was consistent with the increasing acetate production before the stationary growth phase. Furthermore, acetate kinase reaction plays a critical role in energy conservation in this strain for providing one molecular ATP when growing autotrophically(Kopke et al., 2010). The difficulty to obtain the necessary ATP energy in the late-log phase might be one of the reasons for the strong up-regulation of these two genes. The ethanol production related gene aor1was significantly up-regulated in the mid-logphase and slightly up-regulated in the late-logphase, while aor2 only slightly up-regulated in the mid-logphase. More surprisingly, the gene expression of adhE1andadhE2had no significant change during the ethanol production (Figure 2), though adhE1 is supposed to be critical for the ethanol biosynthesis(Leang et al., 2013).The stable expression of adhE1 and up-regulation of both aorgenes gave new insights about theunique feature of the ethanol biosynthesis pathway in C. ljungdahlii DSM 13528. Up-regulating aorgenes indicated that a possible alternative pathway through re-assimilation of acetate to ethanol exists, which is agreed to the genomic
12
analysis in the previous study(Kopke et al., 2010).Thus, the increasing abundance of aor transcripts, especially aor1, is the reason for the increasing ethanol production during the late exponential growth phase.
3.3 Gene expression profiles of C. ljungdahliiDSM 13528 treated by acids To check the influences of different acids on the C. ljungdahlii DSM 13528, acetic acid with a final concentration at 20 mM, HClat 4 mM or 20 mMsodium acetate buffer with pH 5.4 was added into culturesin the exponential phasewith OD600nm at 0.45.20 mMacetic acid or 4mMHClled to pH decreasing of cultures from 5.4 to about 4.5, while 20 mMsodium acetate buffer with pH 5.4 supplied only extra CH3COO-without pH decrease. Samples were gathered after 30 min treatment for gene expression analysis. aor1, adhE1, ack and pta were up-regulated under treatment with acetic acid, among which aor1 expression increased by 7 fold (Figure 3). After treatment with4 mMHCl, a slightly up-regulation of aor1, pta and ackwasobserved(Figure 3). However, aor2, adhE1 and adhE2 were significantly down-regulated to 0.19, 0.05 and 0.09 fold respectively (Figure 3). Moreover, sodium acetate did not make any significant expression changes, which indicated that expression of these genes could be induced by H+, but not CH3COO-after a short treatment (Figure 3). Changes of the external pH level could induce the transition from acidogenic state to solventogenicstateand have been already well studied in heterotrophic Clostridia, like C. acetobutylicum(Fischer et al., 2006; Millat et al., 2013). The results showed that decreasing culture pH couldstimulate the expression of ethanol pathway genes and acetate synthesis genes in an autotrophic Clostridium. This is the first experimental evidence that the switch fromacidogenesis to solventogenesisis not limited in the 13
heterotrophicacetone-butanol-ethanol fermentationClostridia, which might exist more widely in this genus than it was thought before.The genesinvolved in the switch process arepotential targets forfurther bio-engineering approaches to increase ethanol production during its fermentation.
3.4 Effects of CaCO3 to the fermentation of C.ljungdahliiDSM 13528 Recent research showed a positive effect of CaCO3on the substrate utilization inC.beijerinckii(Han et
al.,
2013),
soits
influences
wereexaminedduring the
fermentation of C. ljungdahliiDSM 13528on the cell growth,substrate utilization and metabolites production. Asmonitoring the amount of fructose is more convenient under the laboratory conditions in comparison to CO or CO2, 5 g/l fructosewas used as carbon sourcein this study to checkthe substrate consumption rate. Adding 0.01 g/l CaCO3 in the medium increased the cell density to1.57 at OD600nm after 72 h fermentation, while the double amount of CaCO3 (0.02 g/l)reduced the growth of the bacterium (the cell density was only 0.78 at OD600nm). Interestingly, thisinfluence of CaCO3did not happen in the beginning of the growth, butoccuredat OD600nmof about 0.7 (Figure 4a). Simultaneously, the fructose amountin the cultureswas measured.84% of fructose was consumed in the culture containing 0.01 g/lCaCO3, whereas only 24% or 52% of fructose was used up in the culture with 0.02 g/lCaCO3 or without CaCO3 (Figure 4b). The cell density was correlated with the fructose consumption. The finalpH of the cultureswas4.12 for treatment with 0.01 g/l CaCO3,4.57 for 14
treatment with 0.02 g/l and 4.34 without CaCO3, respectively(Figure 4a).This was correlated with the acetate production (Figure 4c).While3.8 g/l acetate and 0.7 g/l ethanol was obtained in the fermentationwithout CaCO3, 5 g/l acetate (about 30% increment) and 1 g/l ethanol (about 40% increment) were obtained from the culture with 0.01 g/l CaCO3
(Figure 4d).Similar to the previous report in the bacterium
C.beijerinckii(Han et al., 2013),this investigation showed that an enhanced production of ethanol and acetate were resulted the increased cell density and substrate utilization triggered by CaCO3 during the fermentation of C. ljungdahlii. However,CaCO3 could enhance the growth and productivity of C.beijerinckii at a broad range of CaCO3 concentrations (about 2-10 g/l) (Han et al., 2013), while only a very low concentration of CaCO3 (about 0.01 g/l) had the effectduring the fermentation with C. ljungdahlii DSM 13528. A similar correlation betweenincreasing cell density as well as fructose utilization and the production of ethanol and acetate was observed under supplementing extra CaCl2 with a final concentration of 0.01 g/l instead of CaCO3 in this study (S 3).The stronger effect from CaCO3 in comparison to CaCl2was probablycaused by slowly releasing of a trace amount of free Ca2+ into the culture medium due to the very low water solubility of CaCO3. But it could be an effect from the buffering capacity of carbonate. To investigate the role of carbonate during C. ljungdahlii DSM 13528fermentation, extra 0.05 g/l NaHCO3 or 0.05 g/l Na2CO3 was supplied in the culture medium. Butno expectedeffect could be observed during the fermentation of C.
15
ljungdahlii DSM 13528 (data not shown), while variouscarbonate-containing compounds showedgenerallypositive effect on the growth of C.beijerinckiithrough buffering effect (Han et al., 2013). It indicated that Ca2+probably served as a signaling factor in the case ofC. ljungdahlii DSM 13528 rather than a buffering effect from carbonate.
4. Conclusion This work revealed the existence of the transition from acidogenesis to solventogenesisin C. ljungdahliifermentation. The significant up-regulation of aor1 and acid accumulation induced aor1 transcription gave the first experimentalevidenceofthe criticalrole ofaor1in triggering ethanol productionthrough a unique alternative acetate re-assimilation pathway.Precisely controlling the transcription of aor1 and fine-tuning pH during fermentation canimprove the ethanol production remarkably. Low concentrations of CaCO3couldincrease the production of acetate and ethanol through enhancing the cell growth and substrate utilization. However, its mechanism needs to be furtherinvestigated.
Acknowledgements This study was supported by grants from the Chinese Academy of Sciences (KSZD-EW-Z-017-1) and the Natural Science Foundation of China (11311140293).
16
Reference 1.
Bengelsdorf, F.R., Straub, M., Dürre, P. 2013. Bacterial synthesis gas (syngas) fermentation. Environmental Technology, 34(13-14), 1639-1651.
2.
Bredwell, M.D., Srivastava, P., Worden, R.M. 1999. Reactor Design Issues for Synthesis-Gas Fermentations. Biotechnol Prog, 15(5), 834-844.
3.
Drake, H.L., Gossner, A.S., Daniel, S.L. 2008. Old acetogens, new light. Ann N Y Acad Sci, 1125, 100-28.
4.
Durre, P. 2008. Fermentative butanol production: bulk chemical and biofuel. Ann N Y Acad Sci, 1125, 353-62.
5. 6.
Durre, P. 2005. Formation of solvents in Clostridia. Handbook on clostridia, 671-693. Fischer, R.J., Oehmcke, S., Meyer, U., Mix, M., Schwarz, K., Fiedler, T., Bahl, H. 2006. Transcription of the pst operon of Clostridium acetobutylicum is dependent on phosphate concentration and pH. J Bacteriol, 188(15), 5469-78.
7.
Han, B., Ujor, V., Lai, L.B., Gopalan, V., Ezeji, T.C. 2013. Use of Proteomic Analysis To Elucidate the Role of Calcium in Acetone-Butanol-Ethanol Fermentation by Clostridium beijerinckii NCIMB 8052. Applied and Environmental Microbiology, 79(1), 282-293.
8.
Hurst, K.M., Lewis, R.S. 2010. Carbon monoxide partial pressure effects on the metabolic process of syngas fermentation. Biochemical Engineering Journal 48(2), 159-165.
9.
Jang, Y.S., Han, M.J., Lee, J., Im, J.A., Lee, Y.H., Papoutsakis, E.T., Bennett, G., Lee, S.Y. 2014. Proteomic analyses of the phase transition from acidogenesis to solventogenesis using solventogenic and non-solventogenic Clostridium acetobutylicum strains. Applied Microbiology and Biotechnology, 98(11), 5105-5115.
10. Kim, Y.K., Park, S.E., Lee, H., Yun, J.Y. 2014. Enhancement of bioethanol production in syngas fermentation with Clostridium ljungdahlii using nanoparticles. Bioresour Technol, 159, 446-50. 11. Kopke, M., Held, C., Hujer, S., Liesegang, H., Wiezer, A., Wollherr, A., Ehrenreich, A., Liebl, W., Gottschalk, G., Durre, P. 2010. Clostridium ljungdahlii represents a microbial production platform based on syngas. Proceedings of the National Academy of Sciences of the United States of America, 107(29), 13087-13092. 12. Kopke, M., Mihalcea, C., Liew, F.M., Tizard, J.H., Ali, M.S., Conolly, J.J., Al-Sinawi, B., Simpson, S.D. 2011. 2,3-Butanediol Production by Acetogenic Bacteria, an Alternative Route to Chemical Synthesis, Using Industrial Waste Gas. Applied and Environmental Microbiology, 77(15), 5467-5475. 13. Leang, C., Ueki, T., Nevin, K.P., Lovley, D.R. 2013. A Genetic System for Clostridium ljungdahlii: a Chassis for Autotrophic Production of Biocommodities and a Model Homoacetogen. Applied and Environmental Microbiology, 79(4), 1102-1109. 14. Liu, J., Tan, Y., Yang, X., Chen, X., Li, F. 2013. Evaluation of Clostridium ljungdahlii DSM 13528 reference genes in gene expression studies by qRT-PCR. J Biosci Bioeng, 116(4), 460-4. 15. Livak, K.J., Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods, 25(4), 402-408. 16. Millat, T., Janssen, H., Thorn, G.J., King, J.R., Bahl, H., Fischer, R.J., Wolkenhauer, O. 2013. A shift in the dominant phenotype governs the pH-induced metabolic switch of Clostridium acetobutylicumin phosphate-limited continuous cultures. Appl Microbiol Biotechnol, 97(14), 6451-66.
17
17. Munasinghe, P.C., Khanal, S.K. 2010a. Biomass-derived syngas fermentation into biofuels: Opportunities and challenges. Bioresour Technol, 101(13), 5013-22. 18. Munasinghe, P.C., Khanal, S.K. 2010b. Syngas fermentation to biofuel: evaluation of carbon monoxide mass transfer coefficient (kLa) in different reactor configurations. Biotechnol Prog, 26(6), 1616-21. 19. Nagarajan, H., Sahin, M., Nogales, J., Latif, H., Lovley, D.R., Ebrahim, A., Zengler, K. 2013. Characterizing acetogenic metabolism using a genome-scale metabolic reconstruction of Clostridium ljungdahlii. Microbial Cell Factories, 12. 20. Sanchez, O.J., Cardona, C.A. 2008. Trends in biotechnological production of fuel ethanol from different feedstocks. Bioresour Technol, 99(13), 5270-95. 21. Sun, Y., Cheng, J. 2002. Hydrolysis of lignocellulosic materials for ethanol production: a review. Bioresour Technol, 83(1), 1-11. 22. Tan, Y., Liu, J.J., Chen, X.H., Zheng, H.J., Li, F.L. 2013. RNA-seq-based comparative transcriptome analysis of the syngas-utilizing bacterium Clostridium ljungdahlii DSM 13528 grown autotrophically and heterotrophically. Molecular Biosystems, 9(11), 2775-2784. 23. Ueki, T., Nevin, K.P., Woodard, T.L., Lovley, D.R. 2014. Converting Carbon Dioxide to Butyrate with an Engineered Strain of Clostridium ljungdahlii. MBio, 5(5). 24. Ungerman, A.J., Heindel, T.J. 2007. Carbon monoxide mass transfer for syngas fermentation in a stirred tank reactor with dual impeller configurations. Biotechnol Prog, 23(3), 613-20. 25. Ying, Y., Meng, D., Chen, X., Li, F. 2013. An extremely thermophilic anaerobic bacterium Caldicellulosiruptor sp. F32 exhibits distinctive properties in growth and xylanases during xylan hydrolysis. Enzyme Microb Technol, 53(3), 194-9. 26. Yuan, B., Wang, S.A., Li, F.L. 2013. Improved ethanol fermentation by heterologous endoinulinase and inherent invertase from inulin by Saccharomyces cerevisiae. Bioresour Technol, 139, 402-5. 27. Zhang, K., Chen, X., Schwarz, W.H., Li, F. 2014. Synergism of glycoside hydrolase secretomes from two thermophilic bacteria cocultivated on lignocellulose. Appl Environ Microbiol, 80(8), 2592-601.
18
FIGURE LEGENDS: Figure 1Cell growth and metabolites analysis of C. ljungdahlii DSM 13528 underthe CO/CO2 fermentation with duplication (circle and triangle):(a)cell density (unfilled) and pH value (filled); (b) the concentration of acetate (unfilled) and ethanol (filled). Figure 2Gene expression profiles of C. ljungdahlii DSM 13528 under the CO/CO2fermentation:ack, acetate kinase; adhE1 and adhE2, aldehyde/alcohol dehydrogenase; aor1 and aor2, putative aldehyde oxidoreductase; fdh, formate dehydrogenase; folD, methylene-tetrahydrofolate dehydrogenase; metF, methylene-tetrahydrofolate reductase; pta, phosphotransacetylase. Figure 3Gene expression profiles of C. ljungdahlii DSM 13528under treatment with externalacids: ack, acetate kinase; adhE1 and adhE2, aldehyde/alcohol dehydrogenase; aor1 and aor2, putative aldehyde oxidoreductase; pta, phosphotransacetylase. Figure 4Cell growth and metabolites analysis of C. ljungdahlii DSM 13528 underthe fructose fermentation supplied with different concentration of CaCO3:(a) cell density (filled) and pH value (empty); (b) fructose concentration; (c) acetate concentration and (d) ethanol concentration.Supplements with 0.01 g/l CaCO3 (triangle), 0.02 g/l CaCO3(circle)or without CaCO3 (square) were checked.
19
TABLE: Table 1Primers used in this study. Gene locus
primer
Sequence (5’ to 3’)
CLJU_c20110
aor1-RT-1
GCACCGCTTACAGGAACTATA
aor1-RT-2
ACTGGTGAATCAGCCTTATCC
aor2-RT-1
TAGCAGCAGATGGATTGTCAC
aor2-RT-2
CAGGTACACCGTATGAGTCACA
adhE1-RT-1
ATCAGTTGGTGGTGGCTCAG
adhE1-RT-2
TTCCTGCGGATGTTGCTACT
adhE2-RT-1
GATCCAACCCTTGCTACA
adhE2-RT-2
GATGCTCATACATTACCCAC
ackA-RT-1
ATTTACAGCAGGACTTGGAG
ackA-RT-2
GTGCTTATTTCTAGTGCCTC
pta-RT-1
AGAAGGGAATAACGCCAGAA
pta-RT-2
TATGAACCGCACCTGAAACC
folD-RT-1
AACCAGTGGCAGATGCTATA
folD-RT-2
CGTTTGCTCCAACTCTTACT
metF-RT-1
AAAGATGCAGGATTAGAACC
metF-RT-2
GCCACCTGTAATATCCCAAC
fhs-RT-1
AGCAAAGACCCAATACTCCT
fhs-RT-2
TTTCCAAGACCTGGCATC
fdhI-RT-1
AGCAGTTAGCCGATGAACCA
fdhI-RT-2
GGCAACCACAGAACCTCTTC
fdhII-RT-1
TGCTTCTGAATGGAGACCTACA
fdhII-RT-2
TTCCAAGTTCTTCCGCATCTTC
fdhIII-RT-1
CCAGGTACAGATGTAGCACTTC
fdhIII-RT-2
TCTTGTCTGCTGGAACCTTAGT
16S-27F
AGAGTTTGATCCTGGCTCAG
16S-1492R
TACGGCTACCTTGTTACGACT
Product length (bp) 113
CLJU_c20210
141
CLJU_c16510
179
CLJU_c16520
130
CLJU_c12780
129
CLJU_c12770
114
CLJU_c37630
105
CLJU_c37610
200
CLJU_c37650
153
CLJU_c06990
116
CLJU_c08930
185
CLJU_c20040
175
CLJU_c00080
1461
20
FIGURES Fig. 1
21
Fig. 2
22
Fig. 3
23
Fig. 4
24
Highlights
A unique alternative acetate re-assimilation pathwaytriggeredethanol production. Putative aldehyde oxidoreductaseaor1 involved in this alternativepathway. Accumulation of external acids induced the shift to solventogenesis. A trace amount ofCaCO3 increased ethanoland acetate production.
25
