Veterinary Parasitology 205 (2014) 62–69
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Pichia pastoris expressed EtMic2 protein as a potential vaccine against chicken coccidiosis Jie Zhang a,b,1 , Peipei Chen a,b,1 , Hui Sun a,b , Qing Liu a,b , Longjiang Wang a,b , Tiantian Wang a,b , Wenyan Shi a,b , Hongmei Li a,b , Yihong Xiao a,b,c , Pengfei Wang a,b , Fangkun Wang a,b,∗ , Xiaomin Zhao a,b,∗ a Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China b Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China c Department of Basic Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China
a r t i c l e
i n f o
Article history: Received 26 January 2014 Received in revised form 19 June 2014 Accepted 28 June 2014 Keywords: Eimeria tenella EtMic2 Pichia pastoris Vaccine
a b s t r a c t Chicken coccidiosis caused by Eimeria species leads to tremendous economic losses to the avian industry worldwide. Identification of parasite life cycle specific antigens is a critical step in recombinant protein vaccine development against Eimeria infections. In the present study, we amplified and cloned the microneme-2 (EtMIC2) gene from Eimeria tenella wild type strain SD-01, and expressed the EtMic2 protein using Pichia pastoris and Escherichia coli expression systems, respectively. The EtMic2 proteins expressed by P. pastoris and E. coli were used as vaccines to immunize chickens and their protective efficacies were compared and evaluated. The results indicated that both P. pastoris and E. coli expressed EtMic2 proteins exhibited good immunogenicity in stimulating host immune responses and the Pichia expressed EtMic2 provided better protection than the E. coli expressed EtMic2 did by significantly increasing growth rate, inducing high specific antibody response, reducing the oocyst output and cecal lesions. Particularly, the Pichia expressed EtMic2 protein exhibited much better ability in inducing cell mediated immune response than the E. coli expressed EtMic2. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Chicken coccidiosis is caused by several protozoan parasites of the genus Eimeria. Direct and indirect annual
∗ Corresponding authors at: Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61, Daizong Street, Taian City 271018, Shandong Province, China. Tel.: +86 0538 8249921; fax: +86 538 8249921. E-mail address: [email protected] (X. Zhao). 1 Authors contributed equally to this work. http://dx.doi.org/10.1016/j.vetpar.2014.06.029 0304-4017/© 2014 Elsevier B.V. All rights reserved.
economic losses caused by coccidiosis reach about 20 billion English pounds worldwide (Zhang et al., 2011). Etenella that completes its endogenous developmental stages in chicken cecal epithelial cells is one of the most pathogenic species of the seven chicken Eimeria species (Morris et al., 2007). The current strategies to control chicken coccidiosis are the use of anticoccidial drugs and live oocyst vaccine (Shirley et al., 2005). However, ubiquitous use of anticoccidial drugs has led to the emergence of drug resistant Eimeria strains (Li et al., 2011), and the use of live oocyst vaccine has some drawbacks including the pathogenicity, high production expenses and virulence reversibility of
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
coccidia (Vermeulen, 1998; Sharman et al., 2010). Efforts to develop new type vaccines have been relentless over the past several decades (Shirley et al., 2005; Sun et al., 2014). The most important task would be to screen and identify high immunogenicity antigens for developing efficient vaccines. The E. tenella microneme-2 (EtMic2) protein is secreted from the microneme and involved in coccidian invasion (Tomley and Soldati, 2001). Several studies suggested that the recombinant EtMic2 protein showed good immunogenicity and might be a good candidate for use in vaccine development (Ding and Jiang, 2002; Ding et al., 2005; Sathish et al., 2011). Although the recombinant EtMic2 protein was expressed in various host systems (Tomley et al., 1996; Jiang and Jiang, 1999; Liu et al., 2011; Sathish et al., 2011), it has never been expressed in Pichia pastoris expression system. Because both P. pastoris and E. tenella are single-celled eukaryotes, they may share similar protein synthesis mechanism. The coccidia proteins expressed by P. pastoris would be close to their native counterpart. In the present study, we amplified and cloned the EtMIC2 gene from E. tenella wild type strain SD-01, and expressed the EtMic2 protein using P. pastoris expression system. Chickens were immunized with the EtMic2 proteins expressed by P. pastoris and Escherichia coli, respectively, and their protective efficacies were compared and evaluated. The results showed both P. pastoris and E. coli expressed EtMic2 proteins exhibited good immunogenicity in stimulating host immune responses and P. pastoris expressed EtMic2 protein provided much better protection against homologous challenge. 2. Materials and methods 2.1. Ethics statement The study protocol and all animal studies were approved by the Shandong Agricultural University Animal Care and Use Committee (SACUC Permission number: AVM12030108). 2.2. Chickens and parasites One day-old, coccidia free, male Hy-Line Variety Brown layer chickens were purchased from Dongyue Hatcheries (Taian, China) and reared in isolated hoods. The birds were allowed to access to coccidiostat-free feed and water freely, and constant light was provided during the entire experimental period. E. tenella wild type strain SD-01 was isolated, identified and stored in our laboratory (Sun et al., 2014). E. tenella is maintained by passage through coccidia free two-week-old chickens at least every 6 months (Shirley, 1995). Propagation and purification of oocysts followed the method described by Fetterer and Barfield (2003).
63
post-infection and their cecal mucosae were scrapped. The total RNA was extracted from the cecal mucosa using Trizol kit (Kangwei, China) following the kit instruction, and was reverse transcribed into cDNA using random primers (Fermentas, Germany) (Hu et al., 2010). The fulllength of EtMIC2 gene coding region was PCR amplified from the cDNA using the EtMIC2 specific primers of EtMIC2F (5 -ATGGCTCGAGCGTTGTCGCTG-3 ) and EtMIC2R (5 -TCAGGATGACTGTTGAGTGTC-3 ) which were designed based on corresponding sequence deposited in GenBank (Z71755). The PrimeSTAR (Takara, Dalian, China), a pfu equivalent DNA Polymerase, was used for all of PCR reactions. PCR products were cloned into vector pJET1.2 (Fermentas, Germany) using standard molecular method and the cloned EtMIC2 gene of both strands was sequenced by Sangon Biotech Engineering Company (Shanghai). Sequence assembly and analysis were performed using lasergene analysis software (DNAstar Inc, Madison, WI). Sequences were manually trimmed and submitted to Genbank. 2.4. Expression of EtMic2 protein using Pichia expression system 2.4.1. Construction of expression vector The vector pPIC9 of Pichia expression system (Invitrogen, USA) was used to express the EtMic2 protein. The entire EtMIC2 coding region except the first 75 nucleotides (signal sequence) was PCR amplified from the EtMIC2 gene containing vector constructed in Section 2.3 using the primer pair of EtMIC2MatF (5 -CCCGAATTCGTCCC AGGCGAAGATAGC-3 ) and EtMIC2H6R (5 -CCCGCGGCC GCTCAGTGATGATGATGATGATGGGATGACTGTTGAGTGTC3 ). The restriction enzyme sites of EcoRI and NotI were built in the forward and reverse primers, respectively, for constructing the expression vector. The sequence encoding His6 polypeptides was also built in the reverse primer for protein purification. The PCR products were digested using restriction enzymes of EcoRI and NotI, and cloned into pPIC9 vector that was digested with same restriction enzymes. The correction of the cloning was confirmed by restriction enzyme digestions and sequencing of the inserts in both strands. The resultant plasmid was named pPIC9-EtMIC2.
2.3. Amplification and cloning of EtMIC2 gene
2.4.2. P. pastoris transformation and screening The plasmid pPIC9-EtMIC2 linearized by SacI digestion was transformed into P. pastoris strain GS115 using Lithium chloride transformation method (Daniel Gietz and Woods, 2002). The correct transformants were screened on RDB selective plates (1 M sorbitol, 2% dextrose, 1.34% yeast nitrogen base (YNB), 4 × 10−5 % biotin, 0.005% amino acids mixture, and 2% agar) and identified using PCR method. The P. pastoris transformed successfully with plasmid pPIC9EtMIC2 was named GS115-pPIC9-EtMIC2. The P. pastoris transformed with vector pPIC9 (GS115-pPIC9) was used as control.
The 11-day-old chickens were artificially infected with 5 × 104 E. tenella sporulated oocysts (SD-01) using oral gavage. Infected chickens were sacrificed at 112 h
2.4.3. Expression and analysis of EtMic2 protein The GS115-pPIC9-EtMIC2 was culture in Buffered Glycerol-complex Medium (BMGY) medium (1% yeast
64
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
extract, 2% peptone, 100 mM potassium phosphate buffer (PBS, pH 6.0), 1.34% YNB with amino acids, 4 × 10−5 % biotin, 1% glycerin) at 30 ◦ C for 20 h and then transferred to BMMY medium (1% yeast extract, 2% peptone, 100 mM PBS pH 6.0, 1.34% YNB with amino acids, 4 × 10−5 % biotin, 1% methanol) for 120 h continuous culturing at 30 ◦ C with vigorous shaking. Methanol was added to the culture to a final concentration of 1% every 24 h to induce EtMic2 expression. The strain GS115 of P. pastoris and GS115 transformed with pPIC9 cultured in the same conditions were used as controls. About 30 l supernatant from each culture was taken every 24 h for 5 days. All the samples were analyzed on 10% SDS-PAGE to detect the expressed protein. Once the expression conditions were optimized, the scaleup expression was carried out. The expressed protein was precipitated using ammonium sulfate method (Gao et al., 2006) and purified by Ni-NTA Purification system (Invitrogen, USA) following the manufacturer’s instruction. The purified proteins were dialyzed extensively against PBS to remove imidazole. The yield and concentration of the purified protein was determined using BCA protein assay kit (Beyotime, China) following the kit instruction. The purified EtMic2 protein was stored at –80 ◦ C for further use. The purified EtMic2 protein was identified using Western blot analysis. The recombinant EtMic2 protein was resolved on 10% SDS-PAGE under reducing conditions and the protein was transferred on to PVDF membrane (Millip, USA) using standard molecular method. The PVDF membrane was blocked overnight in 2.5% (w/v) skimmed milk powder dissolved in Phosphate Buffer SolutionTween (PBST) at 4 ◦ C. The recombinant EtMic2 protein was detected with 1:500 diluted anti-EtMic2 polyclonal antibody (prepared using E. coli expressed EtMic2 protein in our lab) and horseradish peroxidase-conjugated goat antimouse (1:2000, TransGen, China). 2.5. Immunization and parasite challenge infection The experimental design was summarized in Table 1. The experiment was repeated two times. One day old chickens were randomly divided into four groups of 20 each. Chickens were immunized by leg i.m. (100 g protein/chicken). The immunization schedule consisted of a primary dose emulsified with Freund’s complete adjuvant (Sigma, USA) on day 7 and two booster doses emulsified with Freund’s incomplete adjuvant (Sigma, USA) on day 14 and day 21, respectively. After 7 days post third immunization (day 28), all chickens of group II, group III and group IV were orally challenged with 6000 sporulated E. tenella oocysts as prepared Section 2.2. 2.6. Evaluation of protective efficacy Body weights of all chickens were measured on the 28th (the challenge day) and 35th (7 days after challenge) days. The body weight gains (BWG) were determined by the body weight of the birds on the 35th day subtracting the body weight on the 28th day of the experiment. The growth rate was calculated as BWG divided by the body weight on the 28th day (the challenge day). The relative growth
rate (RGR) was calculated as the growth rate of vaccinated group divided by the growth rate of group I. For the determination of fecal oocyst output, all chickens of every group were placed in oocyst collection cages separately and fecal samples (1 g) were collected on the 35th day (7 days after challenge). Oocysts per gram feces (OPG) were determined using a McMaster chamber (Xu et al., 2006) according to the following formula: total oocysts/bird = [oocyst count × dilution factor × (fecal sample volume/counting chamber volume)]/2. Oocyst decrease ratio (ODR) was calculated as follows: (the mean number of oocysts from the challenged control birds − the mean number of oocysts from vaccinated birds)/the mean number of oocysts from the challenged control birds × 100% (Rose and Mockett, 1983; Talebi and Mulcahy, 2005). At day 35, cecal lesion scores (LS, five birds per group) were determined using a numerical scale from 0 (normal) to 4 (severe) as described by Johnson and Reid (1970), and evaluated by three independent observers. Anti-coccidial index (ACI) was calculated as follows: (survival rate + relative growth rate) − (oocyst value + lesion value), among which the oocyst value was looked up in the “oocyst value table” according to OPG, and the lesion value was calculated by multiplying LS by 10 (Chapman and Shirly, 1989). 2.7. Measurement of serum antibody levels Blood samples were collected from the wing static vein of the birds (five per group) randomly chosen in each group at days 7, 14, 21, 28 and 35. Serum was prepared by low speed centrifugation for 5 min and stored at −20 ◦ C until further analysis. Specific antibody against EtMic2 was measured using an indirect ELISA (Li et al., 2012). The ELISA plates were coated with P. pastoris expressed EtMic2 protein (2 g/ml) to assess specific antibody titers of immunized chicken sera (1:10 dilution). Optical density values at 450 nm (OD450 ) were measured using an automated microplate reader (Bio-Rad, USA). All samples were analyzed in triplicates. 2.8. Cytokine measurement For the measurement of splenocyte cytokines, nine chickens of each group randomly taken were used for the splenocyte preparation. The chicken spleens were removed at day 35 as described by Sasai et al. (2000) and splenocytes were isolated using chicken lymphocytes separation kit (Solarbio, China) according to the manufacturer’s instruction. Single-cell clones from spleens were prepared following the method described by Sasai et al. (2000). The splenocytes were adjusted to desired density (details shown in Table 2) using RPMI containing 2% fetal bovine serum. The appropriate numbers of cells were seeded per well in a 24 well tissue culture plate, and Concanavalin A (ConA,Sigma, USA) with appropriate concentration (Table 2) was added to each well. The supernatants of cell cultures incubating at 37 ◦ C were collected at a specific time (Table 2). The levels of IFN-␥,
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
65
Table 1 Experimental groups of chickens in immunization and challenge experiment. Group
Treatment group
Number of chickens
Immunization dose (g)
Immunization time (day)
Challenge time (day)
I II III IV
Non-vaccinated, non-infected Non-vaccinated, infected E. Coli expressed EtMic2 protein Pichia expressed EtMic2 protein
20 20 20 20
– – 100 100
– – 7, 14, 21 7, 14, 21
– 28 28 28
IL-6, and IL-17 were measured by chicken IFN-␥, IL-6, or IL-17 ELISA Kit (Assay Biotech, USA) following the kit instruction.
2.9. Splenocytes analysis The density of the spleenocytes prepared above was adjusted to 5 × 105 /ml using RPMI containing 2% FBS. One hundred microliter splenocyte suspension were added to each well of a 96-well plate and 100 l RPMI 1640 medium were used as control. To each well (except the controls), 10 l 0.5 mg/ml ConA were added and the plates were incubated at 37 ◦ C for 66 h in a 5% CO2 atmosphere. 70 l supernatant from each well was discarded and 10 l 0.5% MTT (Sigma, USA) were added. After 4 h incubation, 100 l N,N-dimethylformamide (DMF) were added to each well. Plates were incubated for 2 h with shaking and the OD value was read at 490 nm with a microplate reader. The cells without ConA stimulation were used as controls. The experiment was repeated three times. For analysis of the subsets of CD4+ and CD8+ splenocytes, the splenocytes prepared in Section 2.8 were incubated with R-PE-conjugated mouse anti-chicken CD8 ␣ antibody (0.1 mg/ml) (Abcam, UK) and FITC-conjugated mouse anti-chicken CD4 antibody (0.5 mg/ml) (Abcam, UK) for 20 min at 4 ◦ C in dark, and then detected by flow cytometry (Guava, USA) for evaluation of the percentages of CD4+ and CD8+ cells.
2.10. Statistical analysis All data were expressed as the mean ± SD of 3–10 birds per group with three replicates per sample. Comparisons of the mean values were performed by one-way analysis of variance followed by the Duncan’s multiple range test using SPSS software (SPSS 17.0 for Windows; SPSS). Differences between groups were considered statistically significant at P < 0.05.
Table 2 Cytokines detection conditions of spleenocytes stimulated by Concanavalin A. Cytokines
IFN-␥ IL-6 IL17
Cell concentration (cells/ml) 3 × 106 5 × 106 1 × 107
ConA final concentration (g/ml) 30 3 2.5
Supernatant collection time (h) 60 28 52
3. Results 3.1. Cloning and sequence analysis of EtMIC2 gene The full length of EtMIC2 gene of the E. tenella wild type strain SD-01 was amplified, cloned, and sequenced. Its protein sequence was predicted using online software ExPASy-Translate tool. The results of sequence analysis indicated that the EtMIC2 coding region is 1026 nucleotides in length that encodes 342 amino acids. The sequence comparisons with available EtMIC2 sequences deposited in GenBank showed that there are two nucleotide differences between SD-01 and Houghton strain (Z71755) at nucleotide positions 28 (C → T) and 164 (A → T). The change of 164th nucleotide A to T caused the change of 54th amino acid (D → V), while another change is silent. When compared the Beijing strain (AF111839), one nucleotide difference at 203 (C → T) that caused the 69th amino acid change (P → L) was found. Two nucleotide differences were noticed between SD-01 and India strain (FJ807654). One of the two changes is same with the Beijing strain, while another change occurred at nucleotide 733 (G → A), which caused the 245th amino acid change (G → S). The DNA sequence of the EtMIC2 gene from strain SD-01 has been submitted to GenBank and assigned access number as KC333870.
3.2. EtMic2 protein expression and identification The strain GS115-pPIC9-EtMIC2 was cultured in BMMY medium with 1% methanol to induce the EtMic2 protein expression. SDS-PAGE detection of the cultured supernatants collected at different time points showed that the recombinant EtMic2 protein became detectable from 72 h induction, and the quantity increased with the extension of the induction time and stabilized at 96 h (Fig. 1A). The scaleup expression under optimized expression conditions was performed and the expressed EtMic2 protein was purified using Ni-NTA Purification system. The purified EtMic2 protein expressed by Pichia system was analyzed together with the E. coli expressed EtMic2 protein (prepared in our lab). The result showed that Pichia expressed EtMic2 protein is about 48 kDa in size, about 14 kDa bigger than the theoretical value (34 kDa), and about 7 kDa smaller than the E. coli expressed EtMic2 protein (Fig. 1B) that is about 15 kDa bigger than its theoretical value (39.8 kDa). The Western blot analysis (Fig. 1C) using specific anti-EtMic2 protein (E. coli expressed) polyclonal antibody indicated that the expressed EtMic2 protein was pure and recognized by its specific antibody, which suggested that both Pichia and E. coli expressed EtMic2 proteins were pure, good in quality.
66
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
Fig. 1. Pichia pastoris expressed EtMic2 protein analyzed by SDS-PAGE and Western blot. (A) SDS-PAGE analyzed the P. pastoris expressed EtMic2 protein at different time points. (M) Marker; (1) GS115 induced for 120 h; (2) GS115-pPIC9 induced for 120 h; (3–7) GS115-pPIC9-EtMIC2 induced for 24 h, 48 h, 72 h, 96 h, 120 h, respectively; BMGY was used as culture medium for all strains and 30 l supernant of cultures were loaded. (B) SDS-PAGE analyzed the purified recombinant EtMic2 proteins. (M) Marker; (1) EtMic2 protein expressed by E. coli (5 g); (2) EtMic2 protein expressed by P. Pastoris (5 g). (C) Western-blot analysis of the recombinant EtMIC2 proteins. (M) Marker; (1) EtMic2 protein expressed by E. coli (2 g); (2) EtMic2 protein expressed by P. Pastoris (2 g).
3.3. Protective efficacy of EtMic2 proteins The protective efficacy of vaccines against challenge was evaluated based on survival rate (SR), BWG, RGR, OPG, ODR, LS, and ACI. No chicken died from E. tenella challenge in any group. The BWG of chickens in non-immunized and challenged group (group II) were significantly decreased compared to the non-immunized, non-challenged control (group I). The RGR in group II was only 66.39%, which indicates that E. tenella infection greatly reduce the growth rate of chicken. Chickens of the two immunized groups exhibited significantly improved BWG compared to group II, while chickens of group IV (immunized with Pichia expressed EtMic2 protein) showed significantly better BWG than that of group III (immunized with E. coli expressed EtMic2 protein). The RGR in group III was 88.92% while that in group IV reached 93.66% (Table 3). The OPG of chickens in the two immunized groups was greatly reduced compared to the challenged control group. The ODR of group IV was 85.01%, which is much better than group III (74.66%, Table 3). The LS of group IV was significantly decreased than that of group III, while LSs of both groups III and IV were significantly reduced compared to the challenged control group (II) (Table 3). The ACI of all groups was calculated and summarized in Table 3. 3.4. Serum specific antibody response The results showed that no obvious difference in mean EtMic2 antibody titers was detected at days 7 and 14 in
Fig. 2. The antibody level of chickens in four experiment groups measured in different days. The asterisks represented significant increase of serum antibody when compared with the non-vaccinated, infected, group (P < 0.05). Bars not sharing the same letters were significantly different according to the Duncan’s multiple range (P < 0.05).
chickens of all the groups. The specific EtMic2 antibody levels of the immunized chickens (group III and IV) were significantly higher than controls on the day 21 (7 days after 2nd immunization), and continued to increase significantly on the days 28 (7 days after 3rd immunization) and 35 (7 days after challenge). The Pichia expressed EtMic2 protein induced higher specific EtMic2 antibody levels than the E. coli expressed EtMic2 protein did in the immunized chickens on days 28 and 35 (Fig. 2). 3.5. Evaluation of cell mediated immune response The results showed that the splenocyte proliferation values without ConA stimulation from all challenged groups showed no significant difference and were significantly higher than that in group I (P < 0.05). After stimulation with ConA, the splenocytes showed increased proliferation ability in all groups; no significant difference
Table 3 Protective efficacy of vaccination against Eimeria tenella challenge. Group I II III IV
SR (%) 100 100 100 100
BWG (g) 84.25 56.40 68.75 79.47
± ± ± ±
d
1.85 2.58a 3.05b 2.70c
RGR (%)
OPG (×106 )
ODR (%)
LS
100.00 66.39 88.92 93.66
0.00 3.67 0.93 0.55
± ± ± ±
100.00 0.00 74.66 85.01
0.00 3.40 1.76 1.22
00a 0.04d 0.01c 0.00b
ACI ± ± ± ±
0a 0.17d 0.06c 0.08b
200.00 122.39 170.32 180.46
SR: survival rate, BWG: body weight gain, RGR: relative growth rate, OPG: oocysts per gram of content, ODR: oocyst decrease ratio, LS: cecal lesion score, ACI: Anti-coccidial index. Values with different letters in the same column are significantly different (P < 0.05).
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
67
Table 4 The percentages of CD4+, CD8+ splenocytes and splenocytes proliferation. Group
Percentages of CD4+/CD8+ splenocytes CD4 (%)
I II III IV
13.85 17.11 18.30 21.65
± ± ± ±
Splenocytes proliferation
CD8 (%) 1.05a 0.56b 0.31b 0.58c
19.88 23.37 25.07 29.79
± ± ± ±
No ConA Stimulated 0.78a 2.23b 1.69b 0.27c
0.185 0.262 0.257 0.269
± ± ± ±
0.0128a 0.0184b 0.0079b 0.028b
ConA Stimulated 0.215 0.327 0.342 0.383
± ± ± ±
0.0167a 0.0279b 0.1058b 0.0954c
Values with different letters in the same column are significantly different (P < 0.05).
Fig. 3. The average expression level of IFN-␥, IL-6, IL-17. Bars not sharing the same letters were significantly different according to the Duncan’s multiple range (P < 0.05).
of the splenocyte proliferation values with ConA stimulation was found in chickens between group II and group III; the splenocyte proliferation values with ConA stimulation in chickens immunized with Pichia expressed EtMic2 protein was significant higher than that of all other groups (Table 4). The results of the splenocyte subset analysis showed that both the CD4+ and CD8+ splenocytes of all the challenged groups were significantly increased compared to that of group I (P < 0.01) and that of group IV was significant higher than that of all other groups. No significant difference of CD4+ and CD8+ splenocytes was found in chickens between group II and group III (Table 4). The average expression levels of IFN-␥ in all the challenged groups (II–IV) were significantly decreased compared to the unchallenged control (group I). Significant differences of the average IL-6 expression levels were observed among all the groups, the highest to the lowest expression level of IL-6 was found in group IV, then group III, group II, and group I in order. The average expression level of IL-17 in the challenged groups (II–IV) was increased compared to the group I, and the highest expression level was found in group II and group IV (Fig. 3). 4. Discussion E. tenella is considered to be the most important poultry infection worldwide (Zhang et al., 2011). Identification of life cycle stage specific antigens inducing protective immunity is a critical step in recombinant protein vaccine development against Eimeria infections. Tomley et al. (1996) first cloned and identified the full length EtMIC2 gene from sporozoites of E. tenella, and verified that EtMic2
protein could also be expressed in the second-generation merozoites using Western- and Southern-blot hybridization. Jiang and Jiang (2002) cloned the coding sequence of the EtMIC2 gene from the second-generation merozoites of E. tenella Beijing strain, and detected EtMic2 protein expression throughout the asexual process from sporozoites to the second generation merozoites. Very recently, Liu et al. in our laboratory first detected the EtMic2 protein expressed in the sexual developmental stages of gematocytes and zygotes in chickens artificially infected with E. tenella using immunostaining and Western blot analysis with a monoclonal anti-EtMic2 antibody. Those data indicate that EtMic2 protein is actually expressed abundantly in all the endogenous developmental stages of E. tenella, which suggests that the EtMic2 protein would be a good candidate for vaccine development. In the present study, we cloned and sequenced the EtMIC2 gene from the second-generation merozoite RNA and expressed the EtMic2 protein using Pichia expression system. The result of sequence analysis revealed that the EtMIC2 gene of strain SD-01 is 99.9%, 99.8%, 99.8% homologous to that of Beijing strain, Houghton strain, and Indian strain of E. tenella, respectively, which indicates that the EtMIC2 gene is highly conserved among different strains. The EtMIC2 gene or recombinant EtMic2 proteins expressed using prokaryotic or plant expression systems have been used as DNA vaccine or sub-unite vaccine to immunize chickens to against homologous challenge in several early studies (Ding et al., 2005; Sathish et al., 2011). All the reports suggested that EtMic2 protein could provide partial protection against challenge, although the protective levels were different among the studies. In the present study, the EtMic2 proteins expressed by P. pastoris and E. coli were used to immunize chickens and their protective efficacies were compared and evaluated. The results showed that both EtMic2 proteins expressed by Pichia and E. coli systems provided protection against challenge by significantly improving the body weight gains, reducing oocyst shedding and alleviating cecal lesions compared to controls. The ACI of chickens immunized with Pichia and E. coli systems reached 180.46 and 170.32, respectively, which suggest a good protection against challenge. The significant increase of the specific antibody levels in all immunized chicken groups, particularly in group IV, from 7 days after 2nd immunization is consistent with the data of body weight gain, cecal lesion score, oocyst decrease rate, and ACI, which suggests that the recombinant EtMic2 protein can induce humoral immune response and the specific EtMic2 antibody may play roles in protection against challenge.
68
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
Although EtMic2 has been expressed by several investigators using E. coli, Hela cell, and plant cell expression systems previously (Tomley et al., 1996; Jiang and Jiang, 1999; Liu et al., 2011; Sathish et al., 2011), P. pastoris, a one-cell eukaryote, has never been used to express the EtMic2 protein. The antigenic property of proteins is determined not only by their primary sequence, but also by their structural folding features which are greatly affected during their translation and post-translation modifications (Nagy et al., 2009; Zhang et al., 2009). The selection of an expression system to express a heterologous protein would be important. The closer of the protein expressed by a heterologous host to its native structure, the more functional the heterologous expressed protein would be. In the case of Eimeria species, although they are far related to P. pastoris in classification (protozoa vs. fungus), they are all eukaryotic and one cell organisms. Therefore, the EtMic2 expressed by P. pastoris would be maximally close to its native structure and biological activity. In addition, the Pichia system has advantages of high level of expression, stability of the exogenous gene, and easily to purify the product over the bacteria and plant systems (Ou Yang et al., 2000). Our results in the present study showed that the Pichia expressed EtMic2 provided significant higher protection than the E. coli expressed EtMic2. It is interesting to note that no significant difference of the percentages of CD4+ and CD8+ splenocytes and the splenocyte proliferation ability with ConA stimulation was found between the group II (unimmunized challenged control) and group III (immunized with E. coli expressed EtMic2), while the chickens immunized with the Pichia expressed EtMic2 (group IV) showed significant increases (P < 0.05) of the percentages of CD4+ and CD8+ splenocytes and the splenocyte proliferation ability with ConA stimulation compared to group II and group III (Table 4). These data may give a clue that the Pichia expressed EtMic2 is better in inducing cell mediated immune response than the E. coli expressed EtMic2. While the cell mediated immune response may play more important roles in resisting Eimeria species infections (Rose and Long, 1971). IFN-␥ was reported to be associated with protective immune responses to avian coccidiosis (Min et al., 2003; Lillehoj et al., 2004). IL-6, a cytokine produced by T cells and macrophages, acts as both a pro-inflammatory and an anti-inflammatory cytokine. IL-17 may induce fibroblasts to secrete other cytokines involved in proinflammatory or hematopoietic processes (Yao et al., 1995). Our current results demonstrated that the expression levels of IL-6 in group III and group IV were significantly higher than control groups. However, the average expression levels of IFN-␥ in vaccinated groups were significantly decreased compared to control groups. The expression level of IL-17 in group II and group IV were significantly higher than that of other groups. The reasons for these were unknown. 5. Conclusion In conclusion, the results showed both P. pastoris and E. coli expressed EtMic2 proteins showed good immunogenicity in stimulating host immune responses and the Pichia expressed EtMic2 provided better protection than
the E. coli expressed EtMic2 did by significantly increasing growth rate, inducing high specific antibody response, reducing the oocysts output and cecal lesions. Particularly, the Pichia expressed EtMic2 protein exhibited much better ability in inducing cell mediated immune response than the E. coli expressed EtMic2 did. Conflict of interest statement None of the authors has any financial or personal relationships that could inappropriately influence or bias the content of the paper. Acknowledgements This work was supported by the grant from the National Natural Science Foundation of China to XZ (No. 31172314) and the grant from Shandong Province Science and Technology Development Program to XZ (No. 2013GNC11017). References Chapman, H.D., Shirly, M.W., 1989. Sensitivity of field isolates of Eimeria species to monensin and lasalocid in the chicken. Res. Vet. Sci. 46 (1), 114–117. Daniel Gietz, R., Woods, R.A., 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Method. Enzymol. 350, 87–96. Ding, X.C., Jiang, J.S., 2002. Protection of chickens against three species of Eimeria by EtMIC-2 expressed protein. Chin. J. Anim. Vet. Sci. 2, 029. Ding, X., Lillehoj, H.S., Dalloul, R.A., Min, W., Sato, T., Yasuda, A., Lillehoj, E.P., 2005. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 23 (28), 3733–3740. Fetterer, R.H., Barfield, R.C., 2003. Characterization of a developmentally regulated oocyst protein from Eimeria tenella. J. Parasitol. 89 (3), 553–564. Gao, D.H., Mei, L.H., Sheng, Q., Xu, J., Lin, D.Q., Yao, S.J., 2006. Separation and purification of nattokinase produced by Bacillus subtilis with ammonium sulfate precipitation and chromatography. J. Chem. Eng. Chin. Univ. 20 (1), 63–67. Hu, B.X., Li, W., Han, C.X., 2010. Recombinant expression of 3-1E gene from Eimeria tenella Harbin strain and immunoprotection induced by the expressed recombinant protein. Chin. Vet. Sci. 4, 013. Jiang, J.L., Jiang, J.S., 1999. Expression of microneme gene mic2-7 h in E. coli. Rev. Chin. Agric. Sci. Technol. 1, 022. Jiang, J.L., Jiang, J.S., 2002. Cloning and sequence of EtMIC-2 gene from second generation of merizoites of Eimeria tenella. Chin. J. Vet. Med. 38 (3), 7–10. Johnson, J., Reid, W.M., 1970. Anticoccidial drug: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28 (1), 30–36. Li, J.H., Zheng, J., Gong, P., Zhang, X., 2012. Efficacy of Eimeria tenella rhomboid-like protein as a subunit vaccine in protective immunity against homologous challenge. Parasitol. Res. 110 (3), 1139–1145. Li, Y.Y., Li, P.G., Zhang, Y.Y., Zhang, X.Z., Zhang, W.X., Jia, Q.H., 2011. Research approach in drug-resistant detection of Eimeria tenella. Chin. J. Vet. Sci. 31 (3), 449–455. Lillehoj, H.S., Min, W., Dalloul, R.A., 2004. Recent progress on the cytokine regulation of intestinal immune responses to Eimeria. Poult. Sci. 83 (4), 611–623. Liu, Y.L., Li, J.H., Zhang, J., Zhang, X.C., 2011. Construction of an eukaryotic expression vector containing EtMIC-2 gene of Eimeria tenella and its expression in Hela cells. Chin. J. Vet. Sci. 8, 014. Min, W., Lillehoj, H.S., Kim, S., Zhu, J.J., Beard, H., Alkharouf, N., Matthews, B.F., 2003. Profiling local gene expression changes associated with Eimeria maxima and Eimeria acervulina using cDNA microarray. Appl. Microbiol. Biotechnol. 62, 392–399. Morris, G.M., Woods, W.G., Grant Richards, D., Gasser, R.B., 2007. The application of a polymerase chain reaction (PCR)-based capillary electrophoretic technique provides detailed insights into Eimeria populations in intensive poultry establishments. Mol. Cell. Probes 21 (4), 288–294.
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69 Nagy, A., Marciniak-Darmochwal, K., Krawczuk, S., Mierzejewska, D., Kostyra, H., Gelencser, E., 2009. Influence of glycation and pepsin hydrolysis on immunoreactivity of albumin/globulin fraction of herbicide resistant wheat line. Czech J. Food Sci. 27 (5), 320–329. Ou Yang, L.M., Zhang, H.Z., Zhang, S.L., Liu, Z.M., 2000. Advances in the studies of Pichia pastoris as a heterologous gene expression system. Prog. Biochim. Biophys. 27 (2), 151–154. Rose, M.E., Long, P.L., 1971. Immunity to coccidiosis: protective effects of transferred serum and cells investigated in chick embryos infected with Eimeria tenella. Parasitology 63 (2), 299–313. Rose, M.E., Mockett, A.P., 1983. Antibodies to coccidia: detection by the enzyme-linked immunosorbent assay (ELISA). Parasite Immunol. 5 (5), 479–489. Sasai, K., Aita, M., Lillehoj, H.S., Miyamoto, T., Fukata, T., Baba, E., 2000. Dynamics of lymphocyte subpopulation changes in the cecal tonsils of chickens infected with Salmonella enteritidis. Vet. Microbiol. 74 (4), 345–351. Sathish, K., Sriraman, R., Subramanian, B.M., Rao, N.H., Balaji, K., Narasu, M.L., Srinivasan, V.A., 2011. Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken coccidiosis. Vaccine 29 (49), 9201–9208. Sharman, P.A., Smith, N.C., Wallach, M.G., Katrib, M., 2010. Chasing the golden egg: vaccination against poultry coccidiosis. Parasite Immunol. 32 (8), 590–598. Shirley, M.W., 1995. Eimeria species and strains of chickens. In: Eckert, J., Braun, R., Shirley, M.W., Coudert, P. (Eds.), Biotechnology-guidelines on Techniques in Coccidiosis Research. European Commission, Luxemburg, pp. 1–51. Shirley, M.W., Smith, A.L., Tomley, F.M., 2005. The biology of avian Emeria with an emphasis on their control by vaccination. Adv. Parasitol. 60, 285–330.
69
Sun, H., Wang, L.J., Wang, T.T., Zhang, J., Liu, Q., Chen, P.P., Wang, F.K., Li, H.M., Xiao, Y.H., Zhao, X.M., 2014. Display of Eimeria tenella EtMic2 protein on the surface of Saccharomyces cerevisiae as a potential oral vaccine against chicken coccidiosis. Vaccine 32, 1869–1872. Talebi, A., Mulcahy, G., 2005. Partial protection against Eimeria acervulina and Eimeria tenella induced by synthetic peptide vaccine. Exp. Parasitol. 110 (4), 342–348. Tomley, F.M., Bumstead, J.M., Billington, K.J., Dunn, P.P., 1996. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol. Biochim. Parasitol. 79 (2), 195–206. Tomley, F.M., Soldati, D.S., 2001. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends Parasitol. 17 (2), 81–88. Vermeulen, A.N., 1998. Progress in recombinant vaccine development against coccidiosis. A review and prospects into the next millennium. Int. J. Parasitol. 28 (7), 1121–1130. Xu, S.Z., Chen, T., Wang, M., 2006. Protective immunity enhanced by chimeric DNA prime-protein booster strategy against Eimeria tenella challenge. Avian Dis. 50 (4), 579–585. Yao, Z., Painter, S.L., Fanslow, W.C., Ulrich, D., Macduff, B.M., Spriggs, M.K., Armitage, R.J., 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155 (12), 5483–5486. Zhang, M.Q., Gao, M.X., Zhi, Y.X., Pan, J.R., Li, S.R., Lu, S.X., 2009. Effects of irradiation on biochemical properties and antigenicity of crab allergen. Sci. Agric. Sin. 42 (9), 3259–3264. Zhang, Y., Liu, H.L., Lin, Z.M., Li, S.L., Tan, S.Y., 2011. Epidemiological investigation on Wenchang chicken coccidiosis in Haikou city. Acta Agric. Boreal. Occident. Sin. 20 (8), 30–34.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Pichia pastoris expressed EtMic2 protein as a potential vaccine against chicken coccidiosis Jie Zhang a,b,1 , Peipei Chen a,b,1 , Hui Sun a,b , Qing Liu a,b , Longjiang Wang a,b , Tiantian Wang a,b , Wenyan Shi a,b , Hongmei Li a,b , Yihong Xiao a,b,c , Pengfei Wang a,b , Fangkun Wang a,b,∗ , Xiaomin Zhao a,b,∗ a Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China b Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China c Department of Basic Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61 Daizong Street, Taian City 271018, Shandong Province, China
a r t i c l e
i n f o
Article history: Received 26 January 2014 Received in revised form 19 June 2014 Accepted 28 June 2014 Keywords: Eimeria tenella EtMic2 Pichia pastoris Vaccine
a b s t r a c t Chicken coccidiosis caused by Eimeria species leads to tremendous economic losses to the avian industry worldwide. Identification of parasite life cycle specific antigens is a critical step in recombinant protein vaccine development against Eimeria infections. In the present study, we amplified and cloned the microneme-2 (EtMIC2) gene from Eimeria tenella wild type strain SD-01, and expressed the EtMic2 protein using Pichia pastoris and Escherichia coli expression systems, respectively. The EtMic2 proteins expressed by P. pastoris and E. coli were used as vaccines to immunize chickens and their protective efficacies were compared and evaluated. The results indicated that both P. pastoris and E. coli expressed EtMic2 proteins exhibited good immunogenicity in stimulating host immune responses and the Pichia expressed EtMic2 provided better protection than the E. coli expressed EtMic2 did by significantly increasing growth rate, inducing high specific antibody response, reducing the oocyst output and cecal lesions. Particularly, the Pichia expressed EtMic2 protein exhibited much better ability in inducing cell mediated immune response than the E. coli expressed EtMic2. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Chicken coccidiosis is caused by several protozoan parasites of the genus Eimeria. Direct and indirect annual
∗ Corresponding authors at: Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, 61, Daizong Street, Taian City 271018, Shandong Province, China. Tel.: +86 0538 8249921; fax: +86 538 8249921. E-mail address: [email protected] (X. Zhao). 1 Authors contributed equally to this work. http://dx.doi.org/10.1016/j.vetpar.2014.06.029 0304-4017/© 2014 Elsevier B.V. All rights reserved.
economic losses caused by coccidiosis reach about 20 billion English pounds worldwide (Zhang et al., 2011). Etenella that completes its endogenous developmental stages in chicken cecal epithelial cells is one of the most pathogenic species of the seven chicken Eimeria species (Morris et al., 2007). The current strategies to control chicken coccidiosis are the use of anticoccidial drugs and live oocyst vaccine (Shirley et al., 2005). However, ubiquitous use of anticoccidial drugs has led to the emergence of drug resistant Eimeria strains (Li et al., 2011), and the use of live oocyst vaccine has some drawbacks including the pathogenicity, high production expenses and virulence reversibility of
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
coccidia (Vermeulen, 1998; Sharman et al., 2010). Efforts to develop new type vaccines have been relentless over the past several decades (Shirley et al., 2005; Sun et al., 2014). The most important task would be to screen and identify high immunogenicity antigens for developing efficient vaccines. The E. tenella microneme-2 (EtMic2) protein is secreted from the microneme and involved in coccidian invasion (Tomley and Soldati, 2001). Several studies suggested that the recombinant EtMic2 protein showed good immunogenicity and might be a good candidate for use in vaccine development (Ding and Jiang, 2002; Ding et al., 2005; Sathish et al., 2011). Although the recombinant EtMic2 protein was expressed in various host systems (Tomley et al., 1996; Jiang and Jiang, 1999; Liu et al., 2011; Sathish et al., 2011), it has never been expressed in Pichia pastoris expression system. Because both P. pastoris and E. tenella are single-celled eukaryotes, they may share similar protein synthesis mechanism. The coccidia proteins expressed by P. pastoris would be close to their native counterpart. In the present study, we amplified and cloned the EtMIC2 gene from E. tenella wild type strain SD-01, and expressed the EtMic2 protein using P. pastoris expression system. Chickens were immunized with the EtMic2 proteins expressed by P. pastoris and Escherichia coli, respectively, and their protective efficacies were compared and evaluated. The results showed both P. pastoris and E. coli expressed EtMic2 proteins exhibited good immunogenicity in stimulating host immune responses and P. pastoris expressed EtMic2 protein provided much better protection against homologous challenge. 2. Materials and methods 2.1. Ethics statement The study protocol and all animal studies were approved by the Shandong Agricultural University Animal Care and Use Committee (SACUC Permission number: AVM12030108). 2.2. Chickens and parasites One day-old, coccidia free, male Hy-Line Variety Brown layer chickens were purchased from Dongyue Hatcheries (Taian, China) and reared in isolated hoods. The birds were allowed to access to coccidiostat-free feed and water freely, and constant light was provided during the entire experimental period. E. tenella wild type strain SD-01 was isolated, identified and stored in our laboratory (Sun et al., 2014). E. tenella is maintained by passage through coccidia free two-week-old chickens at least every 6 months (Shirley, 1995). Propagation and purification of oocysts followed the method described by Fetterer and Barfield (2003).
63
post-infection and their cecal mucosae were scrapped. The total RNA was extracted from the cecal mucosa using Trizol kit (Kangwei, China) following the kit instruction, and was reverse transcribed into cDNA using random primers (Fermentas, Germany) (Hu et al., 2010). The fulllength of EtMIC2 gene coding region was PCR amplified from the cDNA using the EtMIC2 specific primers of EtMIC2F (5 -ATGGCTCGAGCGTTGTCGCTG-3 ) and EtMIC2R (5 -TCAGGATGACTGTTGAGTGTC-3 ) which were designed based on corresponding sequence deposited in GenBank (Z71755). The PrimeSTAR (Takara, Dalian, China), a pfu equivalent DNA Polymerase, was used for all of PCR reactions. PCR products were cloned into vector pJET1.2 (Fermentas, Germany) using standard molecular method and the cloned EtMIC2 gene of both strands was sequenced by Sangon Biotech Engineering Company (Shanghai). Sequence assembly and analysis were performed using lasergene analysis software (DNAstar Inc, Madison, WI). Sequences were manually trimmed and submitted to Genbank. 2.4. Expression of EtMic2 protein using Pichia expression system 2.4.1. Construction of expression vector The vector pPIC9 of Pichia expression system (Invitrogen, USA) was used to express the EtMic2 protein. The entire EtMIC2 coding region except the first 75 nucleotides (signal sequence) was PCR amplified from the EtMIC2 gene containing vector constructed in Section 2.3 using the primer pair of EtMIC2MatF (5 -CCCGAATTCGTCCC AGGCGAAGATAGC-3 ) and EtMIC2H6R (5 -CCCGCGGCC GCTCAGTGATGATGATGATGATGGGATGACTGTTGAGTGTC3 ). The restriction enzyme sites of EcoRI and NotI were built in the forward and reverse primers, respectively, for constructing the expression vector. The sequence encoding His6 polypeptides was also built in the reverse primer for protein purification. The PCR products were digested using restriction enzymes of EcoRI and NotI, and cloned into pPIC9 vector that was digested with same restriction enzymes. The correction of the cloning was confirmed by restriction enzyme digestions and sequencing of the inserts in both strands. The resultant plasmid was named pPIC9-EtMIC2.
2.3. Amplification and cloning of EtMIC2 gene
2.4.2. P. pastoris transformation and screening The plasmid pPIC9-EtMIC2 linearized by SacI digestion was transformed into P. pastoris strain GS115 using Lithium chloride transformation method (Daniel Gietz and Woods, 2002). The correct transformants were screened on RDB selective plates (1 M sorbitol, 2% dextrose, 1.34% yeast nitrogen base (YNB), 4 × 10−5 % biotin, 0.005% amino acids mixture, and 2% agar) and identified using PCR method. The P. pastoris transformed successfully with plasmid pPIC9EtMIC2 was named GS115-pPIC9-EtMIC2. The P. pastoris transformed with vector pPIC9 (GS115-pPIC9) was used as control.
The 11-day-old chickens were artificially infected with 5 × 104 E. tenella sporulated oocysts (SD-01) using oral gavage. Infected chickens were sacrificed at 112 h
2.4.3. Expression and analysis of EtMic2 protein The GS115-pPIC9-EtMIC2 was culture in Buffered Glycerol-complex Medium (BMGY) medium (1% yeast
64
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
extract, 2% peptone, 100 mM potassium phosphate buffer (PBS, pH 6.0), 1.34% YNB with amino acids, 4 × 10−5 % biotin, 1% glycerin) at 30 ◦ C for 20 h and then transferred to BMMY medium (1% yeast extract, 2% peptone, 100 mM PBS pH 6.0, 1.34% YNB with amino acids, 4 × 10−5 % biotin, 1% methanol) for 120 h continuous culturing at 30 ◦ C with vigorous shaking. Methanol was added to the culture to a final concentration of 1% every 24 h to induce EtMic2 expression. The strain GS115 of P. pastoris and GS115 transformed with pPIC9 cultured in the same conditions were used as controls. About 30 l supernatant from each culture was taken every 24 h for 5 days. All the samples were analyzed on 10% SDS-PAGE to detect the expressed protein. Once the expression conditions were optimized, the scaleup expression was carried out. The expressed protein was precipitated using ammonium sulfate method (Gao et al., 2006) and purified by Ni-NTA Purification system (Invitrogen, USA) following the manufacturer’s instruction. The purified proteins were dialyzed extensively against PBS to remove imidazole. The yield and concentration of the purified protein was determined using BCA protein assay kit (Beyotime, China) following the kit instruction. The purified EtMic2 protein was stored at –80 ◦ C for further use. The purified EtMic2 protein was identified using Western blot analysis. The recombinant EtMic2 protein was resolved on 10% SDS-PAGE under reducing conditions and the protein was transferred on to PVDF membrane (Millip, USA) using standard molecular method. The PVDF membrane was blocked overnight in 2.5% (w/v) skimmed milk powder dissolved in Phosphate Buffer SolutionTween (PBST) at 4 ◦ C. The recombinant EtMic2 protein was detected with 1:500 diluted anti-EtMic2 polyclonal antibody (prepared using E. coli expressed EtMic2 protein in our lab) and horseradish peroxidase-conjugated goat antimouse (1:2000, TransGen, China). 2.5. Immunization and parasite challenge infection The experimental design was summarized in Table 1. The experiment was repeated two times. One day old chickens were randomly divided into four groups of 20 each. Chickens were immunized by leg i.m. (100 g protein/chicken). The immunization schedule consisted of a primary dose emulsified with Freund’s complete adjuvant (Sigma, USA) on day 7 and two booster doses emulsified with Freund’s incomplete adjuvant (Sigma, USA) on day 14 and day 21, respectively. After 7 days post third immunization (day 28), all chickens of group II, group III and group IV were orally challenged with 6000 sporulated E. tenella oocysts as prepared Section 2.2. 2.6. Evaluation of protective efficacy Body weights of all chickens were measured on the 28th (the challenge day) and 35th (7 days after challenge) days. The body weight gains (BWG) were determined by the body weight of the birds on the 35th day subtracting the body weight on the 28th day of the experiment. The growth rate was calculated as BWG divided by the body weight on the 28th day (the challenge day). The relative growth
rate (RGR) was calculated as the growth rate of vaccinated group divided by the growth rate of group I. For the determination of fecal oocyst output, all chickens of every group were placed in oocyst collection cages separately and fecal samples (1 g) were collected on the 35th day (7 days after challenge). Oocysts per gram feces (OPG) were determined using a McMaster chamber (Xu et al., 2006) according to the following formula: total oocysts/bird = [oocyst count × dilution factor × (fecal sample volume/counting chamber volume)]/2. Oocyst decrease ratio (ODR) was calculated as follows: (the mean number of oocysts from the challenged control birds − the mean number of oocysts from vaccinated birds)/the mean number of oocysts from the challenged control birds × 100% (Rose and Mockett, 1983; Talebi and Mulcahy, 2005). At day 35, cecal lesion scores (LS, five birds per group) were determined using a numerical scale from 0 (normal) to 4 (severe) as described by Johnson and Reid (1970), and evaluated by three independent observers. Anti-coccidial index (ACI) was calculated as follows: (survival rate + relative growth rate) − (oocyst value + lesion value), among which the oocyst value was looked up in the “oocyst value table” according to OPG, and the lesion value was calculated by multiplying LS by 10 (Chapman and Shirly, 1989). 2.7. Measurement of serum antibody levels Blood samples were collected from the wing static vein of the birds (five per group) randomly chosen in each group at days 7, 14, 21, 28 and 35. Serum was prepared by low speed centrifugation for 5 min and stored at −20 ◦ C until further analysis. Specific antibody against EtMic2 was measured using an indirect ELISA (Li et al., 2012). The ELISA plates were coated with P. pastoris expressed EtMic2 protein (2 g/ml) to assess specific antibody titers of immunized chicken sera (1:10 dilution). Optical density values at 450 nm (OD450 ) were measured using an automated microplate reader (Bio-Rad, USA). All samples were analyzed in triplicates. 2.8. Cytokine measurement For the measurement of splenocyte cytokines, nine chickens of each group randomly taken were used for the splenocyte preparation. The chicken spleens were removed at day 35 as described by Sasai et al. (2000) and splenocytes were isolated using chicken lymphocytes separation kit (Solarbio, China) according to the manufacturer’s instruction. Single-cell clones from spleens were prepared following the method described by Sasai et al. (2000). The splenocytes were adjusted to desired density (details shown in Table 2) using RPMI containing 2% fetal bovine serum. The appropriate numbers of cells were seeded per well in a 24 well tissue culture plate, and Concanavalin A (ConA,Sigma, USA) with appropriate concentration (Table 2) was added to each well. The supernatants of cell cultures incubating at 37 ◦ C were collected at a specific time (Table 2). The levels of IFN-␥,
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
65
Table 1 Experimental groups of chickens in immunization and challenge experiment. Group
Treatment group
Number of chickens
Immunization dose (g)
Immunization time (day)
Challenge time (day)
I II III IV
Non-vaccinated, non-infected Non-vaccinated, infected E. Coli expressed EtMic2 protein Pichia expressed EtMic2 protein
20 20 20 20
– – 100 100
– – 7, 14, 21 7, 14, 21
– 28 28 28
IL-6, and IL-17 were measured by chicken IFN-␥, IL-6, or IL-17 ELISA Kit (Assay Biotech, USA) following the kit instruction.
2.9. Splenocytes analysis The density of the spleenocytes prepared above was adjusted to 5 × 105 /ml using RPMI containing 2% FBS. One hundred microliter splenocyte suspension were added to each well of a 96-well plate and 100 l RPMI 1640 medium were used as control. To each well (except the controls), 10 l 0.5 mg/ml ConA were added and the plates were incubated at 37 ◦ C for 66 h in a 5% CO2 atmosphere. 70 l supernatant from each well was discarded and 10 l 0.5% MTT (Sigma, USA) were added. After 4 h incubation, 100 l N,N-dimethylformamide (DMF) were added to each well. Plates were incubated for 2 h with shaking and the OD value was read at 490 nm with a microplate reader. The cells without ConA stimulation were used as controls. The experiment was repeated three times. For analysis of the subsets of CD4+ and CD8+ splenocytes, the splenocytes prepared in Section 2.8 were incubated with R-PE-conjugated mouse anti-chicken CD8 ␣ antibody (0.1 mg/ml) (Abcam, UK) and FITC-conjugated mouse anti-chicken CD4 antibody (0.5 mg/ml) (Abcam, UK) for 20 min at 4 ◦ C in dark, and then detected by flow cytometry (Guava, USA) for evaluation of the percentages of CD4+ and CD8+ cells.
2.10. Statistical analysis All data were expressed as the mean ± SD of 3–10 birds per group with three replicates per sample. Comparisons of the mean values were performed by one-way analysis of variance followed by the Duncan’s multiple range test using SPSS software (SPSS 17.0 for Windows; SPSS). Differences between groups were considered statistically significant at P < 0.05.
Table 2 Cytokines detection conditions of spleenocytes stimulated by Concanavalin A. Cytokines
IFN-␥ IL-6 IL17
Cell concentration (cells/ml) 3 × 106 5 × 106 1 × 107
ConA final concentration (g/ml) 30 3 2.5
Supernatant collection time (h) 60 28 52
3. Results 3.1. Cloning and sequence analysis of EtMIC2 gene The full length of EtMIC2 gene of the E. tenella wild type strain SD-01 was amplified, cloned, and sequenced. Its protein sequence was predicted using online software ExPASy-Translate tool. The results of sequence analysis indicated that the EtMIC2 coding region is 1026 nucleotides in length that encodes 342 amino acids. The sequence comparisons with available EtMIC2 sequences deposited in GenBank showed that there are two nucleotide differences between SD-01 and Houghton strain (Z71755) at nucleotide positions 28 (C → T) and 164 (A → T). The change of 164th nucleotide A to T caused the change of 54th amino acid (D → V), while another change is silent. When compared the Beijing strain (AF111839), one nucleotide difference at 203 (C → T) that caused the 69th amino acid change (P → L) was found. Two nucleotide differences were noticed between SD-01 and India strain (FJ807654). One of the two changes is same with the Beijing strain, while another change occurred at nucleotide 733 (G → A), which caused the 245th amino acid change (G → S). The DNA sequence of the EtMIC2 gene from strain SD-01 has been submitted to GenBank and assigned access number as KC333870.
3.2. EtMic2 protein expression and identification The strain GS115-pPIC9-EtMIC2 was cultured in BMMY medium with 1% methanol to induce the EtMic2 protein expression. SDS-PAGE detection of the cultured supernatants collected at different time points showed that the recombinant EtMic2 protein became detectable from 72 h induction, and the quantity increased with the extension of the induction time and stabilized at 96 h (Fig. 1A). The scaleup expression under optimized expression conditions was performed and the expressed EtMic2 protein was purified using Ni-NTA Purification system. The purified EtMic2 protein expressed by Pichia system was analyzed together with the E. coli expressed EtMic2 protein (prepared in our lab). The result showed that Pichia expressed EtMic2 protein is about 48 kDa in size, about 14 kDa bigger than the theoretical value (34 kDa), and about 7 kDa smaller than the E. coli expressed EtMic2 protein (Fig. 1B) that is about 15 kDa bigger than its theoretical value (39.8 kDa). The Western blot analysis (Fig. 1C) using specific anti-EtMic2 protein (E. coli expressed) polyclonal antibody indicated that the expressed EtMic2 protein was pure and recognized by its specific antibody, which suggested that both Pichia and E. coli expressed EtMic2 proteins were pure, good in quality.
66
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
Fig. 1. Pichia pastoris expressed EtMic2 protein analyzed by SDS-PAGE and Western blot. (A) SDS-PAGE analyzed the P. pastoris expressed EtMic2 protein at different time points. (M) Marker; (1) GS115 induced for 120 h; (2) GS115-pPIC9 induced for 120 h; (3–7) GS115-pPIC9-EtMIC2 induced for 24 h, 48 h, 72 h, 96 h, 120 h, respectively; BMGY was used as culture medium for all strains and 30 l supernant of cultures were loaded. (B) SDS-PAGE analyzed the purified recombinant EtMic2 proteins. (M) Marker; (1) EtMic2 protein expressed by E. coli (5 g); (2) EtMic2 protein expressed by P. Pastoris (5 g). (C) Western-blot analysis of the recombinant EtMIC2 proteins. (M) Marker; (1) EtMic2 protein expressed by E. coli (2 g); (2) EtMic2 protein expressed by P. Pastoris (2 g).
3.3. Protective efficacy of EtMic2 proteins The protective efficacy of vaccines against challenge was evaluated based on survival rate (SR), BWG, RGR, OPG, ODR, LS, and ACI. No chicken died from E. tenella challenge in any group. The BWG of chickens in non-immunized and challenged group (group II) were significantly decreased compared to the non-immunized, non-challenged control (group I). The RGR in group II was only 66.39%, which indicates that E. tenella infection greatly reduce the growth rate of chicken. Chickens of the two immunized groups exhibited significantly improved BWG compared to group II, while chickens of group IV (immunized with Pichia expressed EtMic2 protein) showed significantly better BWG than that of group III (immunized with E. coli expressed EtMic2 protein). The RGR in group III was 88.92% while that in group IV reached 93.66% (Table 3). The OPG of chickens in the two immunized groups was greatly reduced compared to the challenged control group. The ODR of group IV was 85.01%, which is much better than group III (74.66%, Table 3). The LS of group IV was significantly decreased than that of group III, while LSs of both groups III and IV were significantly reduced compared to the challenged control group (II) (Table 3). The ACI of all groups was calculated and summarized in Table 3. 3.4. Serum specific antibody response The results showed that no obvious difference in mean EtMic2 antibody titers was detected at days 7 and 14 in
Fig. 2. The antibody level of chickens in four experiment groups measured in different days. The asterisks represented significant increase of serum antibody when compared with the non-vaccinated, infected, group (P < 0.05). Bars not sharing the same letters were significantly different according to the Duncan’s multiple range (P < 0.05).
chickens of all the groups. The specific EtMic2 antibody levels of the immunized chickens (group III and IV) were significantly higher than controls on the day 21 (7 days after 2nd immunization), and continued to increase significantly on the days 28 (7 days after 3rd immunization) and 35 (7 days after challenge). The Pichia expressed EtMic2 protein induced higher specific EtMic2 antibody levels than the E. coli expressed EtMic2 protein did in the immunized chickens on days 28 and 35 (Fig. 2). 3.5. Evaluation of cell mediated immune response The results showed that the splenocyte proliferation values without ConA stimulation from all challenged groups showed no significant difference and were significantly higher than that in group I (P < 0.05). After stimulation with ConA, the splenocytes showed increased proliferation ability in all groups; no significant difference
Table 3 Protective efficacy of vaccination against Eimeria tenella challenge. Group I II III IV
SR (%) 100 100 100 100
BWG (g) 84.25 56.40 68.75 79.47
± ± ± ±
d
1.85 2.58a 3.05b 2.70c
RGR (%)
OPG (×106 )
ODR (%)
LS
100.00 66.39 88.92 93.66
0.00 3.67 0.93 0.55
± ± ± ±
100.00 0.00 74.66 85.01
0.00 3.40 1.76 1.22
00a 0.04d 0.01c 0.00b
ACI ± ± ± ±
0a 0.17d 0.06c 0.08b
200.00 122.39 170.32 180.46
SR: survival rate, BWG: body weight gain, RGR: relative growth rate, OPG: oocysts per gram of content, ODR: oocyst decrease ratio, LS: cecal lesion score, ACI: Anti-coccidial index. Values with different letters in the same column are significantly different (P < 0.05).
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
67
Table 4 The percentages of CD4+, CD8+ splenocytes and splenocytes proliferation. Group
Percentages of CD4+/CD8+ splenocytes CD4 (%)
I II III IV
13.85 17.11 18.30 21.65
± ± ± ±
Splenocytes proliferation
CD8 (%) 1.05a 0.56b 0.31b 0.58c
19.88 23.37 25.07 29.79
± ± ± ±
No ConA Stimulated 0.78a 2.23b 1.69b 0.27c
0.185 0.262 0.257 0.269
± ± ± ±
0.0128a 0.0184b 0.0079b 0.028b
ConA Stimulated 0.215 0.327 0.342 0.383
± ± ± ±
0.0167a 0.0279b 0.1058b 0.0954c
Values with different letters in the same column are significantly different (P < 0.05).
Fig. 3. The average expression level of IFN-␥, IL-6, IL-17. Bars not sharing the same letters were significantly different according to the Duncan’s multiple range (P < 0.05).
of the splenocyte proliferation values with ConA stimulation was found in chickens between group II and group III; the splenocyte proliferation values with ConA stimulation in chickens immunized with Pichia expressed EtMic2 protein was significant higher than that of all other groups (Table 4). The results of the splenocyte subset analysis showed that both the CD4+ and CD8+ splenocytes of all the challenged groups were significantly increased compared to that of group I (P < 0.01) and that of group IV was significant higher than that of all other groups. No significant difference of CD4+ and CD8+ splenocytes was found in chickens between group II and group III (Table 4). The average expression levels of IFN-␥ in all the challenged groups (II–IV) were significantly decreased compared to the unchallenged control (group I). Significant differences of the average IL-6 expression levels were observed among all the groups, the highest to the lowest expression level of IL-6 was found in group IV, then group III, group II, and group I in order. The average expression level of IL-17 in the challenged groups (II–IV) was increased compared to the group I, and the highest expression level was found in group II and group IV (Fig. 3). 4. Discussion E. tenella is considered to be the most important poultry infection worldwide (Zhang et al., 2011). Identification of life cycle stage specific antigens inducing protective immunity is a critical step in recombinant protein vaccine development against Eimeria infections. Tomley et al. (1996) first cloned and identified the full length EtMIC2 gene from sporozoites of E. tenella, and verified that EtMic2
protein could also be expressed in the second-generation merozoites using Western- and Southern-blot hybridization. Jiang and Jiang (2002) cloned the coding sequence of the EtMIC2 gene from the second-generation merozoites of E. tenella Beijing strain, and detected EtMic2 protein expression throughout the asexual process from sporozoites to the second generation merozoites. Very recently, Liu et al. in our laboratory first detected the EtMic2 protein expressed in the sexual developmental stages of gematocytes and zygotes in chickens artificially infected with E. tenella using immunostaining and Western blot analysis with a monoclonal anti-EtMic2 antibody. Those data indicate that EtMic2 protein is actually expressed abundantly in all the endogenous developmental stages of E. tenella, which suggests that the EtMic2 protein would be a good candidate for vaccine development. In the present study, we cloned and sequenced the EtMIC2 gene from the second-generation merozoite RNA and expressed the EtMic2 protein using Pichia expression system. The result of sequence analysis revealed that the EtMIC2 gene of strain SD-01 is 99.9%, 99.8%, 99.8% homologous to that of Beijing strain, Houghton strain, and Indian strain of E. tenella, respectively, which indicates that the EtMIC2 gene is highly conserved among different strains. The EtMIC2 gene or recombinant EtMic2 proteins expressed using prokaryotic or plant expression systems have been used as DNA vaccine or sub-unite vaccine to immunize chickens to against homologous challenge in several early studies (Ding et al., 2005; Sathish et al., 2011). All the reports suggested that EtMic2 protein could provide partial protection against challenge, although the protective levels were different among the studies. In the present study, the EtMic2 proteins expressed by P. pastoris and E. coli were used to immunize chickens and their protective efficacies were compared and evaluated. The results showed that both EtMic2 proteins expressed by Pichia and E. coli systems provided protection against challenge by significantly improving the body weight gains, reducing oocyst shedding and alleviating cecal lesions compared to controls. The ACI of chickens immunized with Pichia and E. coli systems reached 180.46 and 170.32, respectively, which suggest a good protection against challenge. The significant increase of the specific antibody levels in all immunized chicken groups, particularly in group IV, from 7 days after 2nd immunization is consistent with the data of body weight gain, cecal lesion score, oocyst decrease rate, and ACI, which suggests that the recombinant EtMic2 protein can induce humoral immune response and the specific EtMic2 antibody may play roles in protection against challenge.
68
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69
Although EtMic2 has been expressed by several investigators using E. coli, Hela cell, and plant cell expression systems previously (Tomley et al., 1996; Jiang and Jiang, 1999; Liu et al., 2011; Sathish et al., 2011), P. pastoris, a one-cell eukaryote, has never been used to express the EtMic2 protein. The antigenic property of proteins is determined not only by their primary sequence, but also by their structural folding features which are greatly affected during their translation and post-translation modifications (Nagy et al., 2009; Zhang et al., 2009). The selection of an expression system to express a heterologous protein would be important. The closer of the protein expressed by a heterologous host to its native structure, the more functional the heterologous expressed protein would be. In the case of Eimeria species, although they are far related to P. pastoris in classification (protozoa vs. fungus), they are all eukaryotic and one cell organisms. Therefore, the EtMic2 expressed by P. pastoris would be maximally close to its native structure and biological activity. In addition, the Pichia system has advantages of high level of expression, stability of the exogenous gene, and easily to purify the product over the bacteria and plant systems (Ou Yang et al., 2000). Our results in the present study showed that the Pichia expressed EtMic2 provided significant higher protection than the E. coli expressed EtMic2. It is interesting to note that no significant difference of the percentages of CD4+ and CD8+ splenocytes and the splenocyte proliferation ability with ConA stimulation was found between the group II (unimmunized challenged control) and group III (immunized with E. coli expressed EtMic2), while the chickens immunized with the Pichia expressed EtMic2 (group IV) showed significant increases (P < 0.05) of the percentages of CD4+ and CD8+ splenocytes and the splenocyte proliferation ability with ConA stimulation compared to group II and group III (Table 4). These data may give a clue that the Pichia expressed EtMic2 is better in inducing cell mediated immune response than the E. coli expressed EtMic2. While the cell mediated immune response may play more important roles in resisting Eimeria species infections (Rose and Long, 1971). IFN-␥ was reported to be associated with protective immune responses to avian coccidiosis (Min et al., 2003; Lillehoj et al., 2004). IL-6, a cytokine produced by T cells and macrophages, acts as both a pro-inflammatory and an anti-inflammatory cytokine. IL-17 may induce fibroblasts to secrete other cytokines involved in proinflammatory or hematopoietic processes (Yao et al., 1995). Our current results demonstrated that the expression levels of IL-6 in group III and group IV were significantly higher than control groups. However, the average expression levels of IFN-␥ in vaccinated groups were significantly decreased compared to control groups. The expression level of IL-17 in group II and group IV were significantly higher than that of other groups. The reasons for these were unknown. 5. Conclusion In conclusion, the results showed both P. pastoris and E. coli expressed EtMic2 proteins showed good immunogenicity in stimulating host immune responses and the Pichia expressed EtMic2 provided better protection than
the E. coli expressed EtMic2 did by significantly increasing growth rate, inducing high specific antibody response, reducing the oocysts output and cecal lesions. Particularly, the Pichia expressed EtMic2 protein exhibited much better ability in inducing cell mediated immune response than the E. coli expressed EtMic2 did. Conflict of interest statement None of the authors has any financial or personal relationships that could inappropriately influence or bias the content of the paper. Acknowledgements This work was supported by the grant from the National Natural Science Foundation of China to XZ (No. 31172314) and the grant from Shandong Province Science and Technology Development Program to XZ (No. 2013GNC11017). References Chapman, H.D., Shirly, M.W., 1989. Sensitivity of field isolates of Eimeria species to monensin and lasalocid in the chicken. Res. Vet. Sci. 46 (1), 114–117. Daniel Gietz, R., Woods, R.A., 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Method. Enzymol. 350, 87–96. Ding, X.C., Jiang, J.S., 2002. Protection of chickens against three species of Eimeria by EtMIC-2 expressed protein. Chin. J. Anim. Vet. Sci. 2, 029. Ding, X., Lillehoj, H.S., Dalloul, R.A., Min, W., Sato, T., Yasuda, A., Lillehoj, E.P., 2005. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 23 (28), 3733–3740. Fetterer, R.H., Barfield, R.C., 2003. Characterization of a developmentally regulated oocyst protein from Eimeria tenella. J. Parasitol. 89 (3), 553–564. Gao, D.H., Mei, L.H., Sheng, Q., Xu, J., Lin, D.Q., Yao, S.J., 2006. Separation and purification of nattokinase produced by Bacillus subtilis with ammonium sulfate precipitation and chromatography. J. Chem. Eng. Chin. Univ. 20 (1), 63–67. Hu, B.X., Li, W., Han, C.X., 2010. Recombinant expression of 3-1E gene from Eimeria tenella Harbin strain and immunoprotection induced by the expressed recombinant protein. Chin. Vet. Sci. 4, 013. Jiang, J.L., Jiang, J.S., 1999. Expression of microneme gene mic2-7 h in E. coli. Rev. Chin. Agric. Sci. Technol. 1, 022. Jiang, J.L., Jiang, J.S., 2002. Cloning and sequence of EtMIC-2 gene from second generation of merizoites of Eimeria tenella. Chin. J. Vet. Med. 38 (3), 7–10. Johnson, J., Reid, W.M., 1970. Anticoccidial drug: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28 (1), 30–36. Li, J.H., Zheng, J., Gong, P., Zhang, X., 2012. Efficacy of Eimeria tenella rhomboid-like protein as a subunit vaccine in protective immunity against homologous challenge. Parasitol. Res. 110 (3), 1139–1145. Li, Y.Y., Li, P.G., Zhang, Y.Y., Zhang, X.Z., Zhang, W.X., Jia, Q.H., 2011. Research approach in drug-resistant detection of Eimeria tenella. Chin. J. Vet. Sci. 31 (3), 449–455. Lillehoj, H.S., Min, W., Dalloul, R.A., 2004. Recent progress on the cytokine regulation of intestinal immune responses to Eimeria. Poult. Sci. 83 (4), 611–623. Liu, Y.L., Li, J.H., Zhang, J., Zhang, X.C., 2011. Construction of an eukaryotic expression vector containing EtMIC-2 gene of Eimeria tenella and its expression in Hela cells. Chin. J. Vet. Sci. 8, 014. Min, W., Lillehoj, H.S., Kim, S., Zhu, J.J., Beard, H., Alkharouf, N., Matthews, B.F., 2003. Profiling local gene expression changes associated with Eimeria maxima and Eimeria acervulina using cDNA microarray. Appl. Microbiol. Biotechnol. 62, 392–399. Morris, G.M., Woods, W.G., Grant Richards, D., Gasser, R.B., 2007. The application of a polymerase chain reaction (PCR)-based capillary electrophoretic technique provides detailed insights into Eimeria populations in intensive poultry establishments. Mol. Cell. Probes 21 (4), 288–294.
J. Zhang et al. / Veterinary Parasitology 205 (2014) 62–69 Nagy, A., Marciniak-Darmochwal, K., Krawczuk, S., Mierzejewska, D., Kostyra, H., Gelencser, E., 2009. Influence of glycation and pepsin hydrolysis on immunoreactivity of albumin/globulin fraction of herbicide resistant wheat line. Czech J. Food Sci. 27 (5), 320–329. Ou Yang, L.M., Zhang, H.Z., Zhang, S.L., Liu, Z.M., 2000. Advances in the studies of Pichia pastoris as a heterologous gene expression system. Prog. Biochim. Biophys. 27 (2), 151–154. Rose, M.E., Long, P.L., 1971. Immunity to coccidiosis: protective effects of transferred serum and cells investigated in chick embryos infected with Eimeria tenella. Parasitology 63 (2), 299–313. Rose, M.E., Mockett, A.P., 1983. Antibodies to coccidia: detection by the enzyme-linked immunosorbent assay (ELISA). Parasite Immunol. 5 (5), 479–489. Sasai, K., Aita, M., Lillehoj, H.S., Miyamoto, T., Fukata, T., Baba, E., 2000. Dynamics of lymphocyte subpopulation changes in the cecal tonsils of chickens infected with Salmonella enteritidis. Vet. Microbiol. 74 (4), 345–351. Sathish, K., Sriraman, R., Subramanian, B.M., Rao, N.H., Balaji, K., Narasu, M.L., Srinivasan, V.A., 2011. Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken coccidiosis. Vaccine 29 (49), 9201–9208. Sharman, P.A., Smith, N.C., Wallach, M.G., Katrib, M., 2010. Chasing the golden egg: vaccination against poultry coccidiosis. Parasite Immunol. 32 (8), 590–598. Shirley, M.W., 1995. Eimeria species and strains of chickens. In: Eckert, J., Braun, R., Shirley, M.W., Coudert, P. (Eds.), Biotechnology-guidelines on Techniques in Coccidiosis Research. European Commission, Luxemburg, pp. 1–51. Shirley, M.W., Smith, A.L., Tomley, F.M., 2005. The biology of avian Emeria with an emphasis on their control by vaccination. Adv. Parasitol. 60, 285–330.
69
Sun, H., Wang, L.J., Wang, T.T., Zhang, J., Liu, Q., Chen, P.P., Wang, F.K., Li, H.M., Xiao, Y.H., Zhao, X.M., 2014. Display of Eimeria tenella EtMic2 protein on the surface of Saccharomyces cerevisiae as a potential oral vaccine against chicken coccidiosis. Vaccine 32, 1869–1872. Talebi, A., Mulcahy, G., 2005. Partial protection against Eimeria acervulina and Eimeria tenella induced by synthetic peptide vaccine. Exp. Parasitol. 110 (4), 342–348. Tomley, F.M., Bumstead, J.M., Billington, K.J., Dunn, P.P., 1996. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol. Biochim. Parasitol. 79 (2), 195–206. Tomley, F.M., Soldati, D.S., 2001. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends Parasitol. 17 (2), 81–88. Vermeulen, A.N., 1998. Progress in recombinant vaccine development against coccidiosis. A review and prospects into the next millennium. Int. J. Parasitol. 28 (7), 1121–1130. Xu, S.Z., Chen, T., Wang, M., 2006. Protective immunity enhanced by chimeric DNA prime-protein booster strategy against Eimeria tenella challenge. Avian Dis. 50 (4), 579–585. Yao, Z., Painter, S.L., Fanslow, W.C., Ulrich, D., Macduff, B.M., Spriggs, M.K., Armitage, R.J., 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155 (12), 5483–5486. Zhang, M.Q., Gao, M.X., Zhi, Y.X., Pan, J.R., Li, S.R., Lu, S.X., 2009. Effects of irradiation on biochemical properties and antigenicity of crab allergen. Sci. Agric. Sin. 42 (9), 3259–3264. Zhang, Y., Liu, H.L., Lin, Z.M., Li, S.L., Tan, S.Y., 2011. Epidemiological investigation on Wenchang chicken coccidiosis in Haikou city. Acta Agric. Boreal. Occident. Sin. 20 (8), 30–34.
