crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 42, pp. 22074 –22085, October 14, 2016 Published in the U.S.A.

Pigment Epithelium-derived Factor (PEDF) Blocks Wnt3a Protein-induced Autophagy in Pancreatic Intraepithelial Neoplasms* Received for publication, April 4, 2016, and in revised form, July 1, 2016 Published, JBC Papers in Press, August 24, 2016, DOI 10.1074/jbc.M116.729962

Jingjing Gong‡, Glenn Belinsky‡, Usman Sagheer§, Xuchen Zhang§¶, Paul J. Grippo储, and X Chuhan Chung‡§1 From the Departments of ‡Medicine and ¶Pathology, Yale University School of Medicine, New Haven, Connecticut 06520, the 储 Department of Medicine, University of Illinois School of Medicine, Chicago, Illinois 60612, and the §Veterans Affairs Connecticut Healthcare System, West Haven, Connecticut 06516 An increase in autophagy characterizes pancreatic carcinogenesis, but the signals that regulate this process are incompletely understood. Because canonical Wnt/␤-catenin signaling is necessary for the transition from early to advanced pancreatic intraepithelial neoplasia (PanIN) lesions, we assessed whether Wnt ligands and endogenous inhibitors of Wnt signaling modulate autophagy. In this study, canonical Wnt3a ligand induced autophagy markers and vacuoles in murine PanIN cells. Furthermore, pigment epithelium-derived factor (PEDF), a secreted glycoprotein known for its anti-tumor properties, blocked Wnt3a-directed induction of autophagy proteins. Autophagy inhibition was complemented by reciprocal regulation of the oxidative stress enzymes, superoxide dismutase 2 (SOD2) and catalase. Transcriptional control of Sod2 expression was mediated by PEDF-induced NF␬B nuclear translocation. PEDF-dependent SOD2 expression in PanIN lesions was recapitulated in a murine model of PanIN formation where PEDF was deleted. In human PanIN lesions, co-expression of PEDF and SOD2 was observed in the majority of early PanIN lesions (47/50, 94%), whereas PEDF and SOD2 immunolocalization in high-grade human PanIN-2/3 was uncommon (7/50, 14%). These results indicate that PEDF regulates autophagy through coordinate Wnt signaling blockade and NF␬B activation.

Pancreatic ductal adenocarcinoma (PDAC)2 is projected to become the second leading cause of cancer-related deaths in the United States by 2030 (1). Improvements in progressionfree survival have occurred, but the overall survival for PDAC patients remains dismal (2). Targeting precursors of PDAC, pancreatic intraepithelial neoplasia (PanIN) lesions, has been

* This

work was supported by National Institutes of Health Grant R21AA023607, National Institutes of Health Liver Center Core Grant DK34989, and a Veterans Affairs Merit Grant (to C. C.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. 1 To whom correspondence should be addressed: Section of Digestive Diseases, Dept. of Medicine, Yale University School of Medicine, New Haven, CT. Tel.: 203-932-5711 (Ext. 3680); Fax: 203-937-3852; E-mail: chuhan. [email protected]. 2 The abbreviations used are: PDAC, pancreatic ductal adenocarcinoma; PEDF, pigment epithelium-derived factor; PanIN, pancreatic intraepithelial neoplasia; SOD2, superoxide dismutase 2; ROS, reactive oxygen species; HCQ, hydroxychloroquine; IF, immunofluorescence.

22074 JOURNAL OF BIOLOGICAL CHEMISTRY

proposed as a way of identifying high-risk patients and preventing PDAC development. PanINs, however, are commonly found in autopsy series of non-malignant pancreatic disease. Therefore, insights into novel factors that determine PanIN biology may reveal regulators of indolent versus aggressive disease. Autophagy is an essential regulator of pancreatic carcinogenesis (3, 4). This conserved cellular recycling mechanism occurs at basal levels in the normal pancreatic ductal epithelium and early PanIN-1 lesions and increases in PanIN-2/3 and invasive PDAC to promote cancer cell survival (5, 6). Murine models of mutant Kras recapitulate pancreatic carcinogenesis where autophagy increases from PanINs through PDAC (6, 7). Functionally, autophagy maintains cellular homeostasis by removing damaged organelles that arise from heightened levels of reactive oxygen species (ROS) (8). Elevated ROS therefore stimulate autophagy, but the endogenous factors that curb ROS production and autophagy induction are incompletely understood (9). Activation of developmental signaling pathways necessary for pancreatic carcinogenesis can regulate autophagy. For instance, Wnt/␤-catenin signaling is necessary for PanIN development and activates mitochondrial biogenesis, thereby increasing ROS formation and autophagy (10, 11). Mice where ␤-catenin is genetically deleted or its inhibitors overexpressed in the context of mutant KrasG12D form early PanIN lesions that do not progress (10). These studies implicate Wnt/␤-catenin signaling, ROS generation, and autophagy induction in PanIN development. Thus, blockade of Wnt signaling may reduce ROS levels and ameliorate autophagy, thereby decreasing cancer cell survival. To test the hypothesis that inhibitors of Wnt/␤-catenin can reduce autophagy and ROS formation, we examined the role of pigment epithelium-derived factor (PEDF) in PanIN biology. PEDF is a 50-kDa non-inhibitory SERPIN with broad anti-tumor properties (12). In PDAC, retained tumor PEDF expression is associated with improved patient survival, and its experimental delivery inhibits PDAC growth in vivo (13, 14). These effects have typically been attributed to an anti-angiogenic effect (12, 15). The surprising discovery of the PEDF null state in humans as the cause of a classic genetic bone disease, osteogenesis imperfecta type VI, led to investigation of its role in developmental signaling pathways such as Wnt/␤-catenin signaling, a major effector for bone development (16 –19). Our VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 1. Canonical Wnt3a ligand regulates autophagy in murine PanIN cells. A, basal levels of autophagic vacuoles in PanIN cells. B, protein levels of p62 and LC3 were determined after Wnt3a (100 ng/ml) treatment for 6 h in PanIN cells. C, PanIN cells transfected with mCherry-YFP-LC3 and exposed to Wnt3a for 6 h. mCherry (red), YFP (yellow), and DAPI (blue) and differential interference contrast images were taken. D, autophagic vacuole formation in response to Wnt3a (100 ng/ml) for indicated time points in PanIN cells. E and F, PanIN cells were treated with indicated concentrations of CHIR99021, a Wnt activator. Autophagic vacuole formation and protein levels of LC3 and ␤-actin were determined by Western blotting. G, immunoblot of LC3 in response to the Wnt inhibitor, IWP-2. H, autophagic vacuole formation in response to IWP-2. Data presented as mean ⫾ S.D. *, p ⬍ 0.05; **, p ⬍ 0.01; ***, p ⬍ 0.001.

group and others have applied this insight from the PEDF null state in humans to identify a Wnt inhibitory function for PEDF in epithelial and cancer cells (20 –22). Here, we investigated whether PEDF inhibits Wnt/␤-catenin signaling in murine PanIN cells and determined its effects on autophagy. Our results indicate that canonical Wnt3a ligand activates autophagy in PanIN cells, and autophagy in turn inhibits Wnt activation through inhibition of low density lipoprotein receptor-related protein 6 (LRP6). PEDF inhibits canonical Wnt/␤-catenin signaling, Wnt3a-induced autophagy, and elevates superoxide dismutase (SOD) 2 through NF␬B activation. In mice, SOD2 expression was distinctly lower in the KrasG12D/PEDF KO double mutant compared with the KrasG12D mutant alone. Human PanIN lesions demonstrated SOD2 and PEDF localization in simple columnar cells (PanIN1), whereas loss of expression occurred in cells with advanced (PanIN 2/3) histological features. Our findings highlight a OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

mechanistic role for PEDF’s anti-tumor properties through the blockade of Wnt/␤-catenin-induced autophagy and the activation of NF␬B-dependent responses to modulate ROS in PanIN cells.

Results Canonical Wnt Regulates Autophagy in Murine PanIN Cells—Autophagy increases as PanIN lesions progress. We tested protein levels of LC3 and autophagic vacuole formation in two murine PanIN cell lines (PI5505, PanIN-1/2; PI34, PanIN-3) (Fig. 1, A and B). Compared with PI5505 cells, protein levels of LC3 and autophagic vacuoles were significantly increased in PI34 (Fig. 1, A and B). The mCherry-YFP-LC3 construct results in a distinct mCherry and YFP labeling pattern (23). In the acidic conditions found in lysosomes, YFP loses fluorescence while mCherry fluorescence remains. Using this construct, PI34 cells demonstrated higher YFP and mCherry JOURNAL OF BIOLOGICAL CHEMISTRY

22075

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 2. Activation of autophagy inhibits activation of the Wnt receptor LRP6. A, expression of mCherry-YFP-LC3 was determined in response to different concentrations of glucose. B, autophagic vacuole formation under different concentrations of glucose treatment in PanIN cells was determined. C, protein levels of p-LRP6, LRP6, active ␤-catenin, ␤-catenin, and LC3 were determined by immunoblotting in response to different concentrations of glucose. D, quantification of p-LRP6/␤-actin. E, levels of active LRP6 and Wnt signaling components after exposure to rapamycin, an autophagy inducer; and F, HCQ, an autophagy inhibitor. G, quantification of protein levels obtained in F. Data presented as mean ⫾ S.D. *, p ⬍ 0.05; **, p ⬍ 0.01; and ***, p ⬍ 0.001.

levels than PI5505 cells, consistent with the levels of LC3 and autophagic vacuole formation (Fig. 1C). Thus, murine PanIN cells derived from the Kras mutant mouse model reveal a progressive increase in autophagy with increasing histological grade (7). To investigate whether canonical Wnt ligands regulate autophagy, protein levels of LC3 were determined 6 h postWnt3a treatment (100 ng/ml). Wnt3a increased LC3-II levels and decreased p62 content (Fig. 1B), a marker of enhanced autophagic flux. Enhanced mCherry fluorescence also occurred in response to Wnt3a treatment (Fig. 1C). Autophagic vacuole formation increased in PanIN cells in a time-dependent manner after Wnt3a (Fig. 1D). Chemical manipulation of canonical Wnt signaling further demonstrated Wnt-dependent effects on

22076 JOURNAL OF BIOLOGICAL CHEMISTRY

autophagic vacuole formation. Increasing concentrations of CHIR99021, a Wnt activator, increased autophagic vacuole formation and LC3-II levels (Fig. 1, E and F). In contrast, IWP2, a Wnt inhibitor, decreased autophagic vacuole formation and LC3-II protein levels (Fig. 1, G and H). These findings indicate that canonical Wnt signaling regulates autophagy in PanIN cells. Autophagy Induction Is Inversely Related to LRP6 Activation—Autophagy can be induced by starvation conditions (24). Low (1 mM) glucose induced LC3-II and autophagic vacuole formation in PI5505 and PI34 cells and reduced p-LRP6 and LRP6 without changing ␤-catenin activation (Fig. 2, A–D). This effect was confirmed using rapamycin, an autophagy VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs TABLE 1 Mouse MnSOD (SOD2) promoter sequence DNA sequence of mouse SOD2 promoter is shown. The predicted binding sites (red), primers for binding sites NF␬B1 (black, underlined), NF␬B2 (black, underlined), and NF␬B3 (blue, underlined) are shown. ATG (bold italics) is the translation start site.

TABLE 2 Predicted NF␬B binding to promoter sites of the mouse SOD2 gene Five putative sites were predicted with these settings (80%) in sequence named SOD2. This analysis has high sensitivity but low selectivity. In other words, while functional activity will be detected in most cases, most predictions will correspond to sites bound in vitro but with no function in vivo. A number of additional constraints of the analysis can improve the prediction; phylogenetic footprinting is the most common. We recommend using the ConSite service, which uses the JASPAR datasets. The review in Ref. 47 gives a comprehensive overview of transcription binding site prediction. Predicted NF␬B binding to putative sites of the mouse SOD2 promoter by JASPAR database. Model ID

Model name

Score

Relative score

MA0105.1 MA0105.1 MA0105.1 MA0105.1 MA0105.1

NF␬B1 NF␬B1 NF␬B1 NF␬B1 NF␬B1

7.873 9.869 7.701 9.006 9.096

0.82622031960139 0.874557955765429 0.822054952156393 0.853658466782681 0.855838019515528

inducer through inhibition of mechanistic target of rapamycin signaling (Fig. 2E). Hydroxychloroquine (HCQ), an autophagy inhibitor, increased p-LRP6 levels in PanIN cells (Fig. 2, F and G). Thus, autophagic activity negatively regulates components of the Wnt signaling apparatus such as LRP6, the co-receptor for canonical Wnt signaling. This suggests an internal negative feedback loop to curb Wnt signaling, a proliferative pathway, in conditions of nutrient deprivation. PEDF Blocks Canonical Wnt Signaling—PEDF inhibits canonical Wnt signaling in multiple cell types (20 –22). To address whether PEDF could function as a Wnt antagonist in PanINs, PEDF-mediated blockade of Wnt3a was assessed. Wnt3a increased active ␤-catenin in both PI5505 and PI34 cells, and PEDF inhibited this effect (Fig. 3A). Inhibitory effects were also detected in cellular fractionation extracts isolated from PanIN cells (Fig. 3A). Immunofluorescence imaging demonstrated that PEDF inhibits Wnt3a-mediated ␤-catenin translocation (arrows) in both PanIN cell lines (Fig. 3B). T-cell transcription factor 4 (TCF4) is the downstream effector of ␤-catenin responses through a transcriptional complex. PEDF protein inhibited activity of the TCF4-luciferase reporter (Fig. 3C) in the basal state and after Wn3a exposure (Fig. 3C). Either PEDF gene expression or adding the conditioned medium from PEDF-transfected cells yielded similar results in both PanIN cell lines (Fig. 3D). CyclinD1 and c-Jun are downstream targets of TCF4/␤-catenin and reflect Wnt signaling activation (25). CyclinD1 and c-Jun expression were significantly inhibited by PEDF (Fig. 3, E and F), indicating that canonical Wnt signaling is blocked by PEDF in PanIN cells. OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

Start

End

Strand

Predicted site sequence

280 800 811 918 918

289 809 820 927 927

⫺1 ⫺1 1 ⫺1 1

GGGGAATTGC GAGACTTTCC AGGGTTTCCC GGGGAACCCC GGGGTTCCCC

PEDF Inhibits Wnt3a-mediated Autophagy—Because canonical Wnt ligand enhances autophagy and PEDF blocks Wnt signaling, we next determined whether PEDF could inhibit autophagic responses. PEDF reduced LC3-II (Fig. 4A) and autophagic vacuole formation (Fig. 4B) in PI5505 and PI34 cells under basal conditions. PEDF also inhibited Wnt3a-induced LC3-II protein and autophagic vacuole formation in PI5505 and PI34 cells (Fig. 4, C and D). Analogous results were observed in PanIN cells transfected with mCherry-YFP-LC3 (data not shown). PEDF similarly blocked autophagic vacuole formation in rapamycin-treated cells (Fig. 4E). PEDF also inhibited hydroxychloroquine-mediated LC3-II up-regulation, indicating that PEDF-mediated LC3 inhibition occurs at an earlier stage of autophagy during the formation of autophagic vacuoles (Fig. 4F). PEDF Suppresses Catalase and Increases Superoxide Dismutase in PanIN Cells—ROS levels stimulate autophagy, and PEDF has been previously identified as an endogenous factor to counter ROS in multiple cell-based systems (8, 26). We examined PEDF-dependent effects on ROS levels and autophagy in PanIN cells. Under baseline conditions, advanced PanIN cells (PI34) had higher H2O2 levels than low grade PanIN cells (PI5505) (data not shown). Exogenous H2O2 induced autophagy by up-regulating LC3-II and autophagic vacuole formation in both PanIN cells (data not shown). We also tested whether PEDF modulates H2O2 generation in PanIN cells, and we observed a small but statistically significant (⬃10%) induction of H2O2 in response to PEDF treatment (Fig. 4G). Blockade of autophagy with HCQ similarly led to an increase in H2O2 JOURNAL OF BIOLOGICAL CHEMISTRY

22077

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 3. PEDF inhibits canonical Wnt signaling. A, active ␤-catenin (non-phosphorylated ␤-catenin) and total ␤-catenin levels in whole cell, and nuclear/ cytoplasmic fractions after exposure to PEDF (300 ng/ml) and Wnt3a (100 ng/ml). B, IF images demonstrating PEDF inhibition of Wnt-directed ␤-catenin (red) nuclear translocation. C, TCF4-luciferase reporter activity in response to PEDF (300 ng/ml) and Wnt3a ligand (100 ng/ml). D, TCF4-luciferase activity in response to PEDF expression vector (pCep4-PEDF) or vector control for 24 h. E and F, expression of cyclinD1 and c-Jun after PEDF (100 ng/ml) exposure (n ⫽ 4). Data are presented as mean ⫾ S.D. *, p ⬍ 0.05; **, p ⬍ 0.01; and ***, p ⬍ 0.001.

(Fig. 4H). The Wnt inhibitor IWP2 also increased H2O2 by more than 50% in the PI34 cells (Fig. 4I). These results indicate that Wnt blockade enhances H2O2 levels in murine PanIN cells. Because we had anticipated an overall reduction in ROS with Wnt blockade and PEDF treatment, but instead found enhanced H2O2 levels, we examined whether PEDF had selective effects on antioxidant enzymes involved in H2O2 metabolism as follows: SOD2, a mitochondrial matrix protein that converts the superoxide anion (O2. ) to H2O2, and catalase that converts H2O2 to water. In fact, PEDF increased SOD2 protein levels but decreased catalase in both PanIN cell lines (Fig. 4J). Thus, the increase in H2O2 seen with PEDF exposure parallels the consistent decrease in catalase levels seen with PEDF exposure. In addition, PEDF significantly increased mRNA expression of SOD2 in both PanIN cells (Fig. 4K), indicating that PEDF transcriptionally regulates SOD2. PEDF Regulates SOD2 Expression through NF␬B Activation—We next evaluated how PEDF alters Sod2 transcription. NF␬B increases Sod2 expression, and previous studies identified that PEDF provides protective effects against oxidative injury by inducing NF␬B activity (27, 28). To test PEDFmediated regulation of SOD2, NF␬B translocation and nuclear activity on the Sod2 promoter was assessed. PEDF led to p65

22078 JOURNAL OF BIOLOGICAL CHEMISTRY

translocation into the nucleus (Fig. 5, A and D) and enhanced NF␬B-luciferase activity in both PI5505 and PI34 cells (Fig. 5, B and C). Chromatin immunoprecipitation (ChIP) assays further revealed PEDF-directed activation of Sod2 transcription via NF␬B. Examination of the murine Sod2 promoter sequence (Table 1) identified four predicted NF␬B-binding sites (Fig. 5E and Table 2). Three sets of primers were designed (Table 3). Based on these promoter sequences, NF␬B has extremely low binding activity with primer 3 (Ct value ⬎35) compared with sites 1 and 2 (Ct value ⫽ 27–30). PEDF significantly increased the binding activity of NF␬B on the Sod2 promoter at NF␬Bbinding sites 1 and 2 (Fig. 5F). Amplification curves from ChIP studies revealed enhanced transcriptional responses in the presence of PEDF compared with control-treated cells (Fig. 5G). Electrophoretic mobility shift assay (EMSA) was performed to further evaluate the relative efficacy of NF␬B binding to Sod2 promoter sites in response to PEDF. EMSA was performed using wild type and mutant DNA oligonucleotidetargeting binding sites for NF␬B on the murine Sod2 promoter with or without biotin labeling (Table 4). Adding PEDF increased the binding affinity of NF␬B to both binding sequences (Fig. 5H). Mutation of these binding sites led to loss of greater than 80% binding activity for the NF␬B1 site and VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 4. PEDF inhibits Wnt3a-directed autophagy. A, LC3 levels after PEDF (300 ng/ml) for 2 or 24 h. B, autophagic vacuole formation after PEDF (300 ng/ml) (n ⫽ 2, mean ⫾ S.D.). C, PanIN cells were pretreated with PEDF (300 ng/ml) or untreated for 2 h, followed by Wnt3a (100 ng/ml) treatment or mock treatment for 6 h, and LC3 levels were determined. E and F, PEDF blunts the increase in autophagic vacuole formation induced by Wnt3a (100 ng/ml) (D), rapamycin 1 nM (E), or HCQ 25 ␮M (F). G and H, H2O2 levels after PEDF (300 ng/ml) (G) and HCQ 24 h of treatment (H). I, normalized H2O2 expression in response to IWP-2 (25 nM). J, SOD2 and catalase levels after PEDF (300 ng/ml) exposure. K, quantification of SOD2/␤-actin ratio. Loading control for Fig. 4, A and J are identical due to use of the same membrane to blot for two different targets. Data are presented as mean ⫾ S.D. Significance was calculated using unpaired two-tailed Student’s t test. *, p ⬍ 0.05; **, p ⬍ 0.01; and ***, p ⬍ 0.001.

⬃50% binding activity for the NF␬B2 site. Thus, PEDF activates NF␬B-mediated transcription of SOD2 through two sites on the Sod2 promoter with preferential binding to the NF␬B1 site. Loss of SOD2 Occurs in Advanced PanINs in Murine and Human Pancreatic Tissues—Increased expression of SOD2 has been reported with advancing grades of cancer, but its expression levels in PanINs remains unclear. We determined whether PEDF regulates SOD2 expression in transgenic p48-Cre;LSLKrasG12D (herein referred to as KC) and KC/PEDF KO mice. SOD2 staining was barely detectable in KC/PEDF KO mice, although KC mice demonstrated SOD2 labeling in acinar-toductal metaplasia and early PanINs in KC mice (Fig. 6A). Next, human PDAC sections were analyzed and PanIN lesions OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

stained for SOD2. Within the same PanIN lesions containing both low and high grade PanIN cells, SOD2 labeling was diminished in higher grade PanIN cells (arrows, Fig. 6B). In contrast, simple columnar cells (PanIN-1) within the same PanIN lesion displayed both SOD2 and PEDF labeling (arrowheads, Fig. 6B). Quantification data showed that 47 out 50 PanIN-1 lesions had positive SOD2 labeling, whereas only a minority of PanIN-2/3 displayed SOD2 (Fig. 6C). We evaluated the autophagy adaptor protein p62 in relation to PanIN histological grade and SOD2/ PEDF localization. Immunolabeling of SOD2 and PEDF occurred in simple columnar cells (Fig. 6D, arrowheads), although p62 was prominent in advanced but not early PanIN cells (Fig. 6D, arrows). This inverse correlation between p62 JOURNAL OF BIOLOGICAL CHEMISTRY

22079

PEDF Regulates SOD2 and Autophagy in PanINs

22080 JOURNAL OF BIOLOGICAL CHEMISTRY

VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs TABLE 3 ChIP primers for NF␬B-binding sites on mouse SOD2 promoter Binding sites NF␬B1 NF␬B2 NF␬B3

Forward

Reverse

AAGACACAGGTCATCCATACA (sense) ⫺999 to ⫺978 GGGCCCTGATTACTCCATAATTC (sense) ⫺458 to ⫺435 GAAATAGAGTGGAAGCTTTGCAG (sense) ⫺374 to ⫺351

GATGACAGGGCTTAGGGTAA (antisense) ⫺915 to ⫺895 GCTGCAAAGCTTCCACTCTA (antisense) ⫺378 to ⫺353 CCGCGTGCTTGCTACAG (antisense) ⫺242 to ⫺225

TABLE 4 Oligonucleotides used for EMSA experiments NF␬B1 and NF␬B2 were either unlabeled or 5⬘- and 3⬘-biotin-labeled. Mutant NF␬B1- and NF␬B2-binding sites were 5⬘- and 3⬘-biotin-labeled. Binding sites NF␬B1 NF␬B2 Mutant NF␬B1 Mutant NF␬B2

Forward

Reverse

CTCCCTACCGGAAAGCATCCTCTTGCA ATTCCCCTTACCCTAAGCCCTGTCATCC CCAGCAGCAGAGCCTTGGCTTTCCGGAAAGT CTCCAGGGTTTCCCAGAAGCAGGA CTCCCTACCGGAAAGCATCCTCTTAAC CGCAGGATTACCCTAAGCCCTGTCATCC CCAGCAGCAGAGCCTTGGCTTTCCAACCGCA GGACAACCGCAGACAGAAGCAGGA

GGATGACAGGGCTTAGGGTAAGGG GAATTGCAAGAGGATGCTTTCCGGTAGGGAG TCCTGCTTCTGGGAAACCCTGGAGACTTT CCGGAAAGCCAAGGCTCTGCTGCTGG GGATGACAGGGCTTAGGGTAATCCTG CGGTTAAGAGGATGCTTTCCGGTAGGGAG TCCTGCTTCTGTCTGCGGTTGTCCTGCGGT TGGAAAGCCAAGGCTCTGCTGCTGG

and PEDF is consistent with PEDF-mediated regulation of SOD2 and autophagy, and is diminished in advanced PanIN lesions.

Discussion Reciprocal regulation of canonical Wnt signaling and NF␬B activity couples two fundamental and mutually exclusive transcriptional programs that direct cellular activity toward proliferative versus cellular protective responses (29, 30). In this study we defined a Wnt inhibitory activity for PEDF in PanIN cells that resulted in NF␬B activation and SOD2 transcription (Fig. 7). Through this mechanism, PEDF modulated the levels of ROS and reduced autophagic vacuole formation after Wnt ligand exposure. In contrast to its tumor-inhibitory activity through apoptosis of endothelial cells or immune activation (31, 32), we describe here a cancer cell-specific mechanism that limits Wnt ligand-directed autophagy induction. Previous studies using constitutively active mutant KrasG12D, which does not develop invasive PDAC, found that concomitant PEDF deficiency led to invasive PDAC in a subset of older animals (33, 34). This finding complements the study by Zhang et al. (10), who determined an absolute requirement for Wnt signaling for progression beyond the PanIN stage in the transgenic murine model of pancreatic carcinogenesis. In that study, forced expression of Dkk1, an endogenous secreted inhibitor of Wnt signaling, abrogated the development of PDAC. Similarly, in other organs such as the liver, the absence of PEDF resulted in a gene expression and biochemical pattern consistent with Wnt signaling activation (21). Thus, PEDF functional activity as a tumor inhibitor stems in part from its ability to inhibit Wnt signaling. In human tissue, SOD2 labeling and PEDF labeling were observed in early PanIN lesions but were largely absent in

advanced PanIN cells. We confirmed the role of PEDF in regulating SOD2 through KC/PEDF KO mice where SOD2 labeling was diminished compared with KC mice where PEDF was present. These results highlight a role for SOD2 in pancreatic carcinogenesis and PEDF’s role in its regulation. In the murine KrasG12D model, increased ROS advances PanIN cell histology through the induction of growth factor signaling, whereas blunting ROS levels impedes PanIN progression (35, 36, 38, 39). Polymorphisms in the human SOD2 gene confer a 2-fold increase in risk of developing pancreatic cancer, supporting the idea that dysregulated ROS predispose to PDAC (40). Thus, regulation of SOD2 in PanIN cells supports a novel anti-cancer cell mode of action for PEDF. A central finding of this study is that PEDF can direct NF␬B nuclear translocation/activity, enhance NF␬B binding to the Sod2 promoter, and induce SOD2 levels. Previous studies in neuronal cells demonstrated that PEDF regulates protective responses through an NF␬B-dependent mechanism (27). This study links PEDF-mediated blockade of Wnt/␤-catenin signaling with PEDF-directed NF␬B activation, which increased measures to curb specific ROS. It has been demonstrated that mutant KrasG12D cells generate excess ROS that induces signaling proteins that favor malignant transformation (35, 36). In contrast, PEDF stimulated SOD2 and blocked catalase, thereby resulting in an incremental and defined increase in H2O2 levels. Whether this selective increase in ROS species with PEDF exposure maintains protective versus harmful NF␬B responses remains unclear (35, 37). Because PEDF selectively modulates ROS by increasing SOD2/decreasing catalase, this supports the view that PEDF fine-tunes, rather than eliminates, the endogenous levels of ROS. Because a certain degree of ROS is necessary for signal transduction pathways (8, 41), this suggests that reciprocal reg-

FIGURE 5. PEDF induces NF␬B nuclear translocation and transcriptional activation. A, determination of cytoplasmic (Cyto) and nuclear fractions for p65 levels in response to PEDF 24 h (300 ng/ml) exposure. GAPDH and lamin serve as the controls for cytoplasmic and nuclear fractions, respectively. B and C, NF␬B luciferase reporter activity increases in response to PEDF. D, IF imaging of p65 in response to PEDF (300 ng/ml). E, representation of three putative binding sites for NF␬B on the murine Sod2 promoter. Ctrl, control. F, chromatin immunoprecipitation assays of NF␬B binding to the murine Sod2 promoter sequences in the presence and absence of 24 h treatment of PEDF (300 ng/ml) (n ⫽ 2, triplicate, mean ⫾ S.D.). IgG was used as negative control. Primer sequences are shown in Table 3. G, amplification curves of ChIP assays. H, EMSA of NF␬B binding to the murine Sod2 promoter sequences in the presence and absence of 24-h treatment of PEDF (300 ng/ml). #, Epstein-Barr nuclear antigen control extract. Data were presented as mean ⫾ S.D. Significance was calculated using unpaired two-tailed Student’s t test. ***, p ⬍ 0.001. SS, supershift; NE, nuclear extract.

OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

JOURNAL OF BIOLOGICAL CHEMISTRY

22081

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 6. SOD2 and p62 expression in human and mouse PanIN tissues. A, pancreas from KC and KC/PEDF null mice were stained for SOD2 and PEDF (n ⫽ 3). B, human PanIN tissues were stained for SOD2 (green), PEDF (red), and DAPI (blue) (n ⫽ 8). PanIN-1 cells (arrowheads) and PanIN-2/3 cells (arrows) within the same PanIN lesion. C, quantification of SOD2-positive PanIN lesions out of total PanIN lesions counted in PanIN-1 and PanIN-2/3. D, SOD2, PEDF, and p62 levels were stained in two serial sections (panels i and ii) of human PanIN specimens (n ⫽ 3). PanIN-1 cells (arrowheads) and PanIN-2/3 cells (arrows) are seen within the same ductular lesion. DIC, differential interference contrast.

ulation of Wnt and NF␬B signaling by PEDF functions to maintain ROS homeostasis. With advancing histological features, loss of PEDF occurs and may contribute to dysregulation of ROS and the enhancement of pro-tumor signaling pathways. Future studies examining whether reciprocal regulation of SOD2 and catalase occurs in other cell types and how this alters signaling pathways will allow assessment of PEDF’s anti-cancer properties within this context. In summary, Wnt3a promotes autophagy in murine PanIN cells, which can be blocked by PEDF. Mechanistically, PEDF inhibits canonical Wnt signaling and permits NF␬B activation to enhance SOD2 expression. In human PanIN lesions, co-localization of PEDF and SOD2 occurs in early PanIN lesions and is lost in advanced PanINs. This was confirmed in genetically engineered mouse models of pancreatic carcinogenesis and PEDF deficiency. These data provide additional evidence to support direct anti-cancer cell properties of PEDF through the inhibition of canonical Wnt/␤-catenin signaling.

22082 JOURNAL OF BIOLOGICAL CHEMISTRY

Experimental Procedures Study Approval—All experiments involving the use of mice were performed following protocols approved by either the Institutional Animal Care and Use Committee or local IRB at the Northwestern University (P. J. G.). Patient slides were obtained in a de-identified fashion after approval from the human investigations committee at the Veterans Affairs Connecticut Healthcare System. Cell Lines and Chemicals—Two primary murine PanIN cell lines, PI5505 (PanIN-1/2) and PI34 (PanIN-3), were derived from Pdx-Cre;LSL-KrasG12D;p16fl/fl;YFP mice at 6 weeks of age, prior to the advent of histological pancreatic cancer (42, 43). PanIN cell lines were grown in DMEM (Life Technologies, Inc.) supplemented with high glucose, 10% fetal bovine serum, and 100 ␮g/ml penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2. Antibodies against LC-3 (catalog no. 2775S), p62 (catalog no. 5114S), SOD2 (catalog no. 13141S), catalase VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs

FIGURE 7. Schematic diagram of findings. Canonical Wnt3a ligand enhances autophagic vacuole formation in PanIN cells. PEDF inhibits the effects of canonical Wnt3a ligand and blocks autophagosome formation. In contrast, PEDF causes NF␬B nuclear translocation and enhances NF␬B binding to the SOD2 promoter. Increased SOD2 levels and decreased catalase lead to selective modulation of ROS by PEDF. Purple arrows represent PEDF-dependent effects.

(catalog no. 14097S), total LRP6 (catalog no. 2560S), p-LRP6 (catalog no. 2568S), total ␤-catenin (catalog no. 9562), nonphosphorylated (active) ␤-catenin (catalog no. 8814S), and ␤-actin (catalog no. 3700S) were used according to the manufacturer’s instructions (Cell Signaling Technologies, Beverly, MA). PEDF antibodies were purchased from EMD Millipore (catalog no. MAB1059) and Bioproducts MD (Middletown, MD). For staining of p62 in tissue sections, a monoclonal p62 antibody (catalog no. H00008878-M01, Novus, CO) was used. IWP-2, rapamycin, hydroxychloroquine (HCQ), and CHIR99021 were used at specified concentrations (EMD Millipore, Billerica, MA; and Cayman Chemicals, Ann Arbor, MI). Wnt3a was purchased from R&D Systems. His-PEDF Purification—His-PEDF was purified from HEK cells, which have been transfected with the full-length PEDF cDNA and a His6 tag at the C terminus (pCEP4-PEDF), and cloned into a hygromycin-resistance expression pCEP4 vector. Transfected HEK cells were maintained in DMEM with 10% FCS and penicillin/streptomycin. Hygromycin (400 ␮g/ml) was added for selection. When cells reached 90 –100% confluence, serum-free DMEM was used for 24 – 48 h. Conditioned media were collected and purified as described previously (44). Transfection of Autophagy and NF␬B Constructs—The mCherry-YFP-LC3 plasmid was provided by Dr. Thomas Melia (Yale University School of Medicine). 5 ⫻ 104 PanIN cells were transfected with 1 ␮g of DNA by Lipofectamine 3000 (Life Technologies, Inc.) in each well. YFP and mCherry expressions were observed after 24 h of transfection. Cells were treated with PEDF in serum-free medium. For quantification of fluorescence, images of 10 random fields were visualized. TCF4-luciferase reporter and blank vector pcDNA3.1 were provided by Dr. Carlo Spirli (Yale University School of Medicine). NF␬Bluciferase reporter was purchased from Qiagen. 5 ⫻ 104 PanIN OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

cells were transfected with 1 ␮g of luciferase reporter and 10 ng/well Renilla luciferase by Lipofectamine 2000 (Life Technologies, Inc.) in each well. After 48 h of transfection, cells were lysed, and then luciferase and Renilla expressions were determined using Dual-Luciferase威 reporter assay (Promega, Madison, WI). Triplicate reactions were performed for each sample, and experiments were repeated three times. H2O2 Detection—H2O2 levels were determined by Image-iTTM LIVE Green Reactive Oxygen Species detection kit (Life Technologies, Inc.). Indicated cells were incubated with 5-(and-6)carboxy-2⬘,7⬘-dichlorodihydrofluorescein diacetate for 30 min at 37 °C. H2O2 levels were measured by flow cytometry according to the manufacturer’s protocol, and values were reported as mean fluorescence intensity. Autophagy Detection—Autophagic vacuole formation was detected using Cyto-ID autophagy detection kit according to the manufacturer’s instructions (Enzo Life Science, Farmingdale, NY) and quantified by flow cytometry with values reported as mean fluorescence intensity. All experiments were performed at least twice. Immunoblotting—Cells were washed with PBS and lysed with the M-Per mammalian protein extraction reagent (Thermo Scientific, Waltham, MA) with protease and phosphatase inhibitors (Roche Applied Science, Basel, Switzerland). Nuclear and cytoplasmic extractions from PanIN cells were isolated using NE-PERTM nuclear and cytoplasmic extraction kit (ThermoFisher Scientific) according to the manufacturer’s instruction. Cell lysates were separated using SDS-polyacrylamide gel (Mini-protean TGX precast gels, Bio-Rad) and probed with corresponding antibodies. Real Time Quantitative PCR—Total RNA was isolated from PanIN cells (TRIzol reagent; Invitrogen), according to the manufacturer’s instruction. Real time PCR was performed as described previously (45). The primers used are as follows: mouse Sod2 primers: forward primer, 5⬘-CCATTTTCTGGACAAACCTGA-3⬘, and reverse primer, 5⬘-GACCCAAAGTCACGCTTGATA-3⬘; mouse cyclin D1 primers: forward primer, 5⬘-GCCGAGAAGTTGTGCATCTA-3⬘, and reverse primer, 5⬘AGGTTCCACTTGAGCTTGTT-3⬘ (46); mouse c-Jun primers: forward primer, 5⬘-AATGGGCACATCACCACTAC-3⬘, and reverse primer, 5⬘-TGTTCTGGCTATGCAGTTCAG-3⬘. Data were normalized to either ␤-actin or GAPDH transcript levels. All experiments were performed at least in triplicate, and similar results were obtained on repeated experiments. Chromatin Immunoprecipitation Assay—Chromatin immunoprecipitation assay (ChIP) was performed using ChIP-it express kit (Active Motif, Carlsbad, CA) per the manufacturer’s instructions. Briefly, logarithmically growing cells treated with PEDF for 24 h were cross-linked with 1% formaldehyde for 10 min at room temperature followed by termination with 125 mmol/liter glycine for 5 min, and nuclei were isolated. Isolated nuclei were sonicated on ice to break chromatin DNA to an average length of ⬃500 bp. Soluble chromatin was immunoprecipitated with NF␬B antibody and immunoglobulin G (IgG) as a negative control using protein G magnetic beads. Ten percent of the input extract was saved as input control for normalization before adding antibody for immunoprecipitation. After washing the beads, elution buffer was added to obtain a mixture JOURNAL OF BIOLOGICAL CHEMISTRY

22083

PEDF Regulates SOD2 and Autophagy in PanINs of DNA and proteins. This was followed by proteinase K digestion. Immunoprecipitated DNA was amplified by primer pairs corresponding to three NF␬B-binding sites in mouse Sod2 promoter by real time PCR. Primers used are shown in Table 3. Triplicate PCRs were performed for each sample, and the expression data were normalized to respective input values. Data are presented as the mean ⫾ S.D. Electrophoretic Mobility Shift Assay—EMSA was performed using LightShift Chemiluminescent EMSA kit (Thermo Fisher Scientific). Wild type or mutant oligonucleotides were labeled with or without 5⬘- and 3⬘-labeled biotin and designed according to NF␬B-binding sites in the murine SOD2 promoter (Table 4). Double strand DNA was annealed before the experiment. Following binding of nuclear extracts (1.6 ␮g) with DNA, samples were separated in 6% acrylamide TBE gel and transferred to positive charged nylon membranes for final development. An excess of unlabeled DNA was used as a negative control. Epstein-Barr nuclear antigen extract with control DNA was used as a positive control. Immunohistochemistry/Immunofluorescence Staining—Pancreatic tissue was harvested from p48-Cre;LSL-KrasG12D (KC) and double transgenic (KC/PEDF KO) mice (33). Immunohistochemistry and immunofluorescence (IF) labeling were performed as described (44). For immunohistochemistry, tissues were fixed with formalin, embedded in paraffin, sectioned, and stained with H&E. For IF staining, tissues were deparaffinized, rehydrated, and blocked with goat serum for 30 min at room temperature. Sections were incubated with primary antibody (1:200) overnight at 4 °C, followed by respective secondary antibodies conjugated to Alexa Fluor 555 or 488 (1:500; Invitrogen) for 1 h at room temperature. After rinsing in PBS, slides were mounted with ProLong Gold with DAPI (Invitrogen). Twenty IF images were obtained using Zeiss Axiovert fluorescence microscope for each sample. Tissues stained without antibodies were used as negative controls. IF labeling was performed on PanIN cells using coverslips. Cells were rinsed with PBS, permeabilized with 100% cold methanol at ⫺20 °C for 20 min, and blocked in 2% bovine serum albumin. Samples were incubated with primary antibody at 37 °C for 1 h and followed by secondary antibody at 37 °C for 1 h. Then they were mounted with ProLong Gold with DAPI. Control slides were incubated in secondary antibody only. Twenty IF images were randomly obtained using Zeiss Axiovert Fluorescence Microscope or CLSM 710 spectral confocal laser scanning microscope for each sample. All experiments were repeated at least twice. Statistical Analysis—Data were presented as average ⫾ S.D. Statistical significance was determined using GraphPad Prism Version 6 software by analysis of variance for multiple groups or by t test between two groups, and p values ⬍0.05 were considered significant. Author Contributions—J. G. and C. C. designed and performed experiments; U. S. performed experiments. J. G., X. Z., P. J. G., and G. B. analyzed the data. J. G. and C. C. wrote the paper. C. C. was responsible for conception and oversaw the project. All authors reviewed the results and approved the final version of the manuscript.

22084 JOURNAL OF BIOLOGICAL CHEMISTRY

Acknowledgments—We thank Drs. Carlo Spirli and Thomas Melia (Yale University School of Medicine) for TCF4-luciferase and LC3mCherry-YFP vectors. References 1. Rahib, L., Smith, B. D., Aizenberg, R., Rosenzweig, A. B., Fleshman, J. M., and Matrisian, L. M. (2014) Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 74, 2913–2921 2. Wang, Z., Li, Y., Ahmad, A., Banerjee, S., Azmi, A. S., Kong, D., and Sarkar, F. H. (2011) Pancreatic cancer: understanding and overcoming chemoresistance. Nat. Rev. Gastroenterol. Hepatol. 8, 27–33 3. Gukovsky, I., Li, N., Todoric, J., Gukovskaya, A., and Karin, M. (2013) Inflammation, autophagy, and obesity: common features in the pathogenesis of pancreatitis and pancreatic cancer. Gastroenterology 144, 1199 –1209 4. White, E. (2015) The role for autophagy in cancer. J. Clin. Invest. 125, 42– 46 5. Yang, S., and Kimmelman, A. C. (2011) A critical role for autophagy in pancreatic cancer. Autophagy 7, 912–913 6. Fujii, S., Mitsunaga, S., Yamazaki, M., Hasebe, T., Ishii, G., Kojima, M., Kinoshita, T., Ueno, T., Esumi, H., and Ochiai, A. (2008) Autophagy is activated in pancreatic cancer cells and correlates with poor patient outcome. Cancer Sci. 99, 1813–1819 7. Yang, S., Wang, X., Contino, G., Liesa, M., Sahin, E., Ying, H., Bause, A., Li, Y., Stommel, J. M., Dell’antonio, G., Mautner, J., Tonon, G., Haigis, M., Shirihai, O. S., Doglioni, C., Bardeesy, N., and Kimmelman, A. C. (2011) Pancreatic cancers require autophagy for tumor growth. Genes Dev. 25, 717–729 8. Azad, M. B., Chen, Y., and Gibson, S. B. (2009) Regulation of autophagy by reactive oxygen species (ROS): implications for cancer progression and treatment. Antioxid. Redox Signal. 11, 777–790 9. Gibson, S. B. (2010) A matter of balance between life and death: targeting reactive oxygen species (ROS)-induced autophagy for cancer therapy. Autophagy 6, 835– 837 10. Zhang, Y., Morris J. P., 4th., Yan, W., Schofield, H. K., Gurney, A., Simeone, D. M., Millar, S. E., Hoey, T., Hebrok, M., and Pasca di Magliano, M. (2013) Canonical wnt signaling is required for pancreatic carcinogenesis. Cancer Res. 73, 4909 – 4922 11. Yoon, J. C., Ng, A., Kim, B. H., Bianco, A., Xavier, R. J., and Elledge, S. J. (2010) Wnt signaling regulates mitochondrial physiology and insulin sensitivity. Genes Dev. 24, 1507–1518 12. Becerra, S. P., and Notario, V. (2013) The effects of PEDF on cancer biology: mechanisms of action and therapeutic potential. Nat. Rev. Cancer 13, 258 –271 13. Hase, R., Miyamoto, M., Uehara, H., Kadoya, M., Ebihara, Y., Murakami, Y., Takahashi, R., Mega, S., Li, L., Shichinohe, T., Kawarada, Y., and Kondo, S. (2005) Pigment epithelium-derived factor gene therapy inhibits human pancreatic cancer in mice. Clin. Cancer Res. 11, 8737– 8744 14. Uehara, H., Miyamoto, M., Kato, K., Ebihara, Y., Kaneko, H., Hashimoto, H., Murakami, Y., Hase, R., Takahashi, R., Mega, S., Shichinohe, T., Kawarada, Y., Itoh, T., Okushiba, S., Kondo, S., and Katoh, H. (2004) Expression of pigment epithelium-derived factor decreases liver metastasis and correlates with favorable prognosis for patients with ductal pancreatic adenocarcinoma. Cancer Res. 64, 3533–3537 15. Dawson, D. W., Volpert, O. V., Gillis, P., Crawford, S. E., Xu, H., Benedict, W., and Bouck, N. P. (1999) Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science 285, 245–248 16. Becker, J., Semler, O., Gilissen, C., Li, Y., Bolz, H. J., Giunta, C., Bergmann, C., Rohrbach, M., Koerber, F., Zimmermann, K., de Vries, P., Wirth, B., Schoenau, E., Wollnik, B., Veltman, J. A., et al. (2011) Exome sequencing identifies truncating mutations in human SERPINF1 in autosomal-recessive osteogenesis imperfecta. Am. J. Hum. Genet. 88, 362–371 17. Gattu, A. K., Swenson, E. S., Iwakiri, Y., Samuel, V. T., Troiano, N., Berry, R., Church, C. D., Rodeheffer, M. S., Carpenter, T. O., and Chung, C. (2013) Determination of mesenchymal stem cell fate by pigment epithe-

VOLUME 291 • NUMBER 42 • OCTOBER 14, 2016

PEDF Regulates SOD2 and Autophagy in PanINs

18.

19. 20.

21.

22.

23.

24. 25.

26.

27.

28.

29.

30.

31.

32.

33.

lium-derived factor (PEDF) results in increased adiposity and reduced bone mineral content. FASEB J. 27, 4384 – 4394 Li, F., Song, N., Tombran-Tink, J., and Niyibizi, C. (2015) Pigment epithelium derived factor suppresses expression of sost/sclerostin by osteocytes: implication for its role in bone matrix mineralization. J. Cell Physiol. 230, 1243–1249 Baron, R., and Kneissel, M. (2013) WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat. Med. 19, 179 –192 Park, K., Lee, K., Zhang, B., Zhou, T., He, X., Gao, G., Murray, A. R., and Ma, J. X. (2011) Identification of a novel inhibitor of the canonical Wnt pathway. Mol. Cell. Biol. 31, 3038 –3051 Protiva, P., Gong, J., Sreekumar, B., Torres, R., Zhang, X., Belinsky, G. S., Cornwell, M., Crawford, S. E., Iwakiri, Y., and Chung, C. (2015) Pigment epithelium-derived factor (PEDF) inhibits Wnt/␤-catenin signaling in the liver. Cell. Mol. Gastroenterol. Hepatol. 1, 535–549 Qi, W., Yang, C., Dai, Z., Che, D., Feng, J., Mao, Y., Cheng, R., Wang, Z., He, X., Zhou, T., Gu, X., Yan, L., Yang, X., Ma, J. X., and Gao, G. (2015) High levels of pigment epithelium-derived factor in diabetes impair wound healing through suppression of Wnt signaling. Diabetes 64, 1407–1419 Kimura, S., Noda, T., and Yoshimori, T. (2007) Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 3, 452– 460 Mathew, R., Karantza-Wadsworth, V., and White, E. (2007) Role of autophagy in cancer. Nat. Rev. Cancer 7, 961–967 Mann, B., Gelos, M., Siedow, A., Hanski, M. L., Gratchev, A., Ilyas, M., Bodmer, W. F., Moyer, M. P., Riecken, E. O., Buhr, H. J., and Hanski, C. (1999) Target genes of ␤-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal carcinomas. Proc. Natl. Acad. Sci. U.S.A. 96, 1603–1608 Garg, A. D., Dudek, A. M., Ferreira, G. B., Verfaillie, T., Vandenabeele, P., Krysko, D. V., Mathieu, C., and Agostinis, P. (2013) ROS-induced autophagy in cancer cells assists in evasion from determinants of immunogenic cell death. Autophagy 9, 1292–1307 Yabe, T., Wilson, D., and Schwartz, J. P. (2001) NF␬B activation is required for the neuroprotective effects of pigment epithelium-derived factor (PEDF) on cerebellar granule neurons. J. Biol. Chem. 276, 43313– 43319 Pang, I. H., Zeng, H., Fleenor, D. L., and Clark, A. F. (2007) Pigment epithelium-derived factor protects retinal ganglion cells. BMC Neurosci. 8, 11 Du, Q., Zhang, X., Cardinal, J., Cao, Z., Guo, Z., Shao, L., and Geller, D. A. (2009) Wnt/␤-catenin signaling regulates cytokine-induced human inducible nitric oxide synthase expression by inhibiting nuclear factor-␬B activation in cancer cells. Cancer Res. 69, 3764 –3771 Ma, B., Fey, M., and Hottiger, M. O. (2015) WNT/␤-catenin signaling inhibits CBP-mediated RelA acetylation and expression of proinflammatory NF-␬B target genes. J. Cell Sci. 128, 2430 –2436 Ho, T. C., Chen, S. L., Shih, S. C., Chang, S. J., Yang, S. L., Hsieh, J. W., Cheng, H. C., Chen, L. J., and Tsao, Y. P. (2011) Pigment epitheliumderived factor (PEDF) promotes tumor cell death by inducing macrophage membrane tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Biol. Chem. 286, 35943–35954 Ho, T. C., Chen, S. L., Yang, Y. C., Liao, C. L., Cheng, H. C., and Tsao, Y. P. (2007) PEDF induces p53-mediated apoptosis through PPAR␥ signaling in human umbilical vein endothelial cells. Cardiovasc. Res. 76, 213–223 Grippo, P. J., Fitchev, P. S., Bentrem, D. J., Melstrom, L. G., Dangi-Garimella, S., Krantz, S. B., Heiferman, M. J., Chung, C., Adrian, K., Cornwell, M. L., Flesche, J. B., Rao, S. M., Talamonti, M. S., Munshi, H. G., and Crawford, S. E. (2012) Concurrent PEDF deficiency and Kras mutation

OCTOBER 14, 2016 • VOLUME 291 • NUMBER 42

34.

35.

36.

37.

38.

39.

40.

41. 42.

43.

44.

45.

46.

47.

induce invasive pancreatic cancer and adipose-rich stroma in mice. Gut 61, 1454 –1464 Principe, D. R., DeCant, B., Diaz, A. M., Mangan, R. J., Hwang, R., Lowy, A., Shetuni, B. B., Sreekumar, B. K., Chung, C., Bentrem, D. J., Munshi, H. G., Jung, B., Grippo, P. J., and Bishehsari, F. (2016) PEDF inhibits pancreatic tumorigenesis by attenuating the fibroinflammatory reaction. Oncotarget 7, 28218 –28234 Liou, G. Y., Do¨ppler, H., DelGiorno, K. E., Zhang, L., Leitges, M., Crawford, H. C., Murphy, M. P., and Storz, P. (2016) Mutant KRas-induced mitochondrial oxidative stress in acinar cells upregulates EGFR signaling to drive formation of pancreatic precancerous lesions. Cell Rep. 14, 2325–2336 Al Saati, T., Clerc, P., Hanoun, N., Peuget, S., Lulka, H., Gigoux, V., Capilla, F., Be´luchon, B., Couvelard, A., Selves, J., Buscail, L., Carrier, A., Dusetti, N., and Dufresne, M. (2013) Oxidative stress induced by inactivation of TP53INP1 cooperates with KrasG12D to initiate and promote pancreatic carcinogenesis in the murine pancreas. Am. J. Pathol. 182, 1996 –2004 Takada, Y., Mukhopadhyay, A., Kundu, G. C., Mahabeleshwar, G. H., Singh, S., and Aggarwal, B. B. (2003) Hydrogen peroxide activates NF-␬B through tyrosine phosphorylation of I␬B␣ and serine phosphorylation of p65: evidence for the involvement of I␬B␣ kinase and Syk protein-tyrosine kinase. J. Biol. Chem. 278, 24233–24241 Philip, B., Roland, C. L., Daniluk, J., Liu, Y., Chatterjee, D., Gomez, S. B., Ji, B., Huang, H., Wang, H., Fleming, J. B., Logsdon, C. D., and Cruz-Monserrate, Z. (2013) A high-fat diet activates oncogenic Kras and COX2 to induce development of pancreatic ductal adenocarcinoma in mice. Gastroenterology 145, 1449 –1458 Rao, C. V., Mohammed, A., Janakiram, N. B., Li, Q., Ritchie, R. L., Lightfoot, S., Vibhudutta, A., and Steele, V. E. (2012) Inhibition of pancreatic intraepithelial neoplasia progression to carcinoma by nitric oxide-releasing aspirin in p48(Cre/⫹)-LSL-Kras(G12D/⫹) mice. Neoplasia 14, 778 –787 Wheatley-Price, P., Asomaning, K., Reid, A., Zhai, R., Su, L., Zhou, W., Zhu, A., Ryan, D. P., Christiani, D. C., and Liu, G. (2008) Myeloperoxidase and superoxide dismutase polymorphisms are associated with an increased risk of developing pancreatic adenocarcinoma. Cancer 112, 1037–1042 Liou, G. Y., and Storz, P. (2010) Reactive oxygen species in cancer. Free Radic. Res. 44, 479 – 496 Rhim, A. D., Mirek, E. T., Aiello, N. M., Maitra, A., Bailey, J. M., McAllister, F., Reichert, M., Beatty, G. L., Rustgi, A. K., Vonderheide, R. H., Leach, S. D., and Stanger, B. Z. (2012) EMT and dissemination precede pancreatic tumor formation. Cell 148, 349 –361 Sreekumar, B. K., Belinsky, G. S., Einwachter, H., Rhim, A. D., Schmid, R., and Chung, C. (2014) Polarization of the vacuolar adenosine triphosphatase delineates a transition to high-grade pancreatic intraepithelial neoplasm lesions. Pancreas 43, 1256 –1263 Chung, C., Shugrue, C., Nagar, A., Doll, J. A., Cornwell, M., Gattu, A., Kolodecik, T., Pandol, S. J., and Gorelick, F. (2009) Ethanol exposure depletes hepatic pigment epithelium-derived factor, a novel lipid regulator. Gastroenterology 136, 331–340 Gong, J., Mun˜oz, A. R., Chan, D., Ghosh, R., and Kumar, A. P. (2014) STAT3 down regulates LC3 to inhibit autophagy and pancreatic cancer cell growth. Oncotarget 5, 2529 –2541 Williams, J. A., Thomas, A. M., Li, G., Kong, B., Zhan, L., Inaba, Y., Xie, W., Ding, W. X., and Guo, G. L. (2012) Tissue specific induction of p62/ Sqstm1 by farnesoid X receptor. PLoS ONE 7, e43961 Wasserman, W. W., and Sandelin, A. (2004) Applied bioinformatics for the identification of regulatory elements. Nat. Rev. Genet. 5, 276 –287

JOURNAL OF BIOLOGICAL CHEMISTRY

22085