Bioscience, Biotechnology, and Biochemistry, 2014

Pinctada fucata mantle gene 4 (PFMG4) from pearl oyster mantle enhances osteoblast differentiation Xiaoyan Wang1,2,a, Kenichi Harimoto1,3,a, Ryosuke Fuji1,3, Jing Liu1, Liyuan Li1, Pan Wang1, Toshihiro Akaike3 and Zhao Wang1,* 1

Protein Science Key Laboratory of the Ministry of Education, School of Medicine, Tsinghua University, Beijing, P.R. China; 2Department of Chemistry and Biology, School of Science, National University of Defense Technology, Changsha, P.R. China; 3Department of Biomolecular Engineering, School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Japan Received August 22, 2014; accepted November 4, 2014 http://dx.doi.org/10.1080/09168451.2014.987206

The organic matrix of nacre has been reported for its effect on osteogenesis. It was found that PFMG4 (Pinctada fucata mantle gene 4) with an N-terminal signal peptide could be secreted into nacre of Pinctada fucata (P. fucata). Here, we report that PFMG4 is highly expressed in mantle tissue and has high homology with C1q protein in different species. In MC3T3-E1 osteoblast cells, we found that highly expressed PFMG4 could suppress cell proliferation and type I collagen expression, but it could increase alkaline phosphatase activity and mineralized deposition. These results show that PFMG4 has potential ability in enhancing osteoblast differentiation, suggesting a new idea in developing medicine for the therapy of osteoporosis. Key words:

Pinctada fucata mantle gene 4 (PFMG4); Pinctada fucata; MC3T3-E1; biomineralization

Osteogenesis is a biomineralization process regulated by multiple organic molecules secreted from osteoblasts.1,2) During this process, osteoblasts go through three stages: the proliferation stage, the differentiation stage, and the mineralization stage. The first stage is the proliferation stage. At the beginning of bone formation, pre-osteoblasts move to the surface of bone and proliferate there, and these cells express type I collagen and form basic extracellular matrix (ECM).3) Alkaline phosphatase (ALP) expression is increased at the end of the proliferation stage. After cells moved into the differentiation stage, pre-osteoblasts differentiate into osteoblasts under the regulation of growth factors, such as BMPs,4) and ECM is maturated at this stage.5) During the mineralization stage, the expression of proteins

relative to mineralization is increased and these proteins are secreted into the ECM to promote calcium accumulation.6) Ordinarily, this process takes about three weeks, and the first three days and the following ten days are regarded as proliferation stage and differentiation stage, respectively. Osteoblast MC3T3-E1 cells were used as a model to detect the effects of PFMG4 on biomineralization. MC3T3-E1 cell line was taken from the newborn mouse calvaria, and it performed the same to primary calvarial osteoblasts.7) Researchers used this cell line as a model to study osteoblast differentiation and ECM formation in vivo.8) Nacre, secreted from the mantle of pearl oyster, is an ideal substitute material for bone. The growth of nacre in molluscan is also regarded as a biomineralization process. It has good biological adaptability and bone mineralization activity, and promotes osteoblasts differentiation without serious immunoreactions.9) Nacre has been used for curing osteoporosis and promoting bone formation in traditional Chinese medicine for several years. Previous studies showed that the protein in nacre contains water-soluble organic matrix (WSM) and water-insoluble organic matrix (WISM). WISM is involved in the framework structure of shell layer.10) WSM proteins facilitate osteoblasts differentiation and matrix mineralization, for example, the proteins stimulate ALP activity, mRNA levels of osteoblast-specific marker genes, and the mineralized nodules formation in vitro.11) Taken together, WSM could play an essential role in facilitating mineralization process, and mantle which secrets WSM could be a potential tissue in regulating matrix formation. Peal powder is a traditional Chinese medicine used to cure the osteoporosis, but the vital component is still unknown. Pinctada fucata (P. fucata) is a kind of sea

*Corresponding author. Email: [email protected] a Xiaoyan Wang and Kenichi Harimoto contributed equally to this work. Abbreviations: PFMG4, Pinctada fucata mantle gene 4; P. fucata, Pinctada fucata; ALP, alkaline phosphatase; ECM, extracellular matrix; WSM, water soluble organic matrix; WISM, water insoluble organic matrix; SSH, suppression subtractive hybridization; αMEM, α minimal essential medium; ocn, Osteocalcin; osx, Osterix; opn, Osteopontin; gapdh, glyceraldehyde 3-phosphate dehydrogenase; MTT, methyl thiazolyl tetrazolium; NEG, non-enzymatic glycation. © 2014 Japan Society for Bioscience, Biotechnology, and Agrochemistry

2

X. Wang et al.

shell and valued for big pearl production. A pfmg4 (DQ104258) gene was first cloned using suppression subtract hybridization and nested PCR from mantle gene library.11,12) We have found three genes by using this method. PFMG1 plays an important role in the biomineralization process and pearl formation.11) PFMG3 facilitates osteoblasts differentiation and mineralization, as well as calcium carbonate deposition.13) PFMG5 inhibits osteoblasts differentiation.14) We also found that PFMG4 has a signal peptide, and it could be secreted into the organic matrix.11) However, the role of PFMG4 in shell biomineralization and osteoblast differentiation has not been elucidated. Although the pfmg4 gene has been cloned for a few years, little is known about its function in P. fucata and in mineralization process in osteoblast cells. In this study, we investigated the characteristics of PFMG4 in P. fucata and reported that PFMG4 enhances osteoblast differentiation using MC3T3-E1 cell.

Materials and methods Prediction and analysis of putative protein. The amino acid composition, the isoelectric point, and the molecular mass of the putative PFMG4 protein were predicted by ProtParam at the ExPASy Proteomics Server, served by the Swiss Institute of Bioinformatics (http://www.expasy.ch/). Using NCBI BLAST (http:// blast.ncbi.nlm.nih.gov/Blast.cgi) program, the putative conserved domain was predicted. Multiple alignments and phylogenetic trees were created by ClustalW2, served by the European Bioinformatics Institute (http:// www.ebi.ac.uk/). Cell culture and transfection. MC3T3-E1 cells were seeded at 1 × 105 cells/mL in six-well plate for transfection. Cells were maintained in α minimal essential medium (αMEM) (Gibco, USA) containing 10% fetal bovine serum (FBS), 100 μg/mL streptomycin, and 100 units/mL penicillin. Mineralization medium was prepared by αMEM containing 50 μg/mL ascorbic acid (Sigma, USA) and 10 mM β-glycerophosphate (Sigma, USA). The pfmg4 gene was first cloned from the mantle cDNA library.11) We subcloned pfmg4 into pcDNA3.1myc plasmid and then transfected the pcDNA3.1pfmg4-myc plasmid into MC3T3-E1 cells using Lipofectamine 2000 (Life Technologies, USA). We plated 2 × 105 MC3T3-E1 cells in 500 μL of αMEM supplemented with 10% FBS (Minhai, China) in 24-well plate one day before transfection, so that cells were 70% confluent at the time of transfection. Diluted 0.8 μg plasmid in 50 μL Opti-MEM I Reduced Serum Medium (Life Technologies, USA) without serum, and diluted 1 μL Lipofectamine 2000 in 50 μL Opti-MEM I Medium, incubated for 5 min at room temperature at the same time. After that, they were mixed and incubated for 20 min. Then, 100 μL of mixture was added to the well and the medium was changed 6 h later. Cells were passed into the fresh well at 1:10 24 h after transfection. The Pfmg4-overexpression stable cell line (MC3T3-E1-Pfmg4) was established by selection with G418 (750 μg/mL) (Amresco, USA) the following day and maintained with G418 (300 μg/mL).

Semi-quantitative RT-PCR. MC3T3-E1-Pfmg4 cells were maintained in αMEM containing 10% FBS, 100 μg/mL streptomycin, and 100 units/mL penicillin for three days. Then, the medium is changed into mineralization medium which is prepared by αMEM containing 50 μg/mL ascorbic acid (Sigma, USA), 10 mM β-glycerophosphate (Sigma, USA), 10% FBS, 100 μg/mL streptomycin, and 100 units/mL penicillin. Cells were collected after culturing for nine days, and then detected the gene expression. Total RNA was extracted from cells using Trizol (Invitrogen, USA). The cDNA was made with SuperScript III (Invitrogen, USA) using oligo-(dT)18 as primers. The following forward and reverse primers were used, respectively: type I collagen, 5′-CCTGGTAAAGATGGTGCC-3′ and 5′-CACCAGG TTCACCTTTCGCACC-3′; Osteocalcin (ocn), 5′CCTCAGTCCCCAGCCCAGATCC-3′ and 5′-CAGGGCAGAGAGAGAGGACAGG-3′; Osterix (osx), 5′-GTCAAGAGTCTTAGCCAAACTC-3′ and 5′AAATGATGTGAGGCCAGATGG-3′; Osteopontin (opn), 5′-TCACCATTCGGATGAGTCTG-3′ and 5′-ACTTGTGGCTCTGATGTTCC-3′; β-actin, 5′TGGACTTCGAGCAAGAGATG G-3′ and 5′-ATCTCCTTCTGCATCCTGTCG-3′. The amplification is carried out at 94 °C for 90 s, followed by 25 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and a final extension of one cycle of 72 °C for 10 min. The following forward and reverse primers were used, respectively, in pfmg4 amplification from different tissues of P. fucata: pfmg4, 5′- TGATGTTGACAGTGATGGTTG-3′ and 5′-TGCTTGTGCACGACTTACTC-3′; glyceraldehyde 3-phosphate dehydrogenase (gapdh), 5′-GATGGTGCCGAGTATGTGGTA-3′ and 5′-CGTTGATTATCTTGGCGAGTG-3′.15) The amplification is carried out at 94 °C for 90 s, followed by 30 cycles of 94 °C for 30 s, 53 °C for 30 s 72 °C for 1 min, and a final extension of one cycle of 72 °C for 5 min. The PCR product was applied to 1.5% agarose gel, stained with ethidium bromide. Molecular analyst software, Quantity One (Bio-Rad, USA), was used to detect the density of interested areas in the RT-PCR experiment. The housekeeping gene, β-actin was used as an internal control. The density ratio gene of interest/gene of internal control was computed and represented. The pfmg4 expression in an adductor muscle is at the lowest level, so we use it as a control for the calculation of fold 1 and in the detection of pfmg4 mRNA localization. Western blot analysis The cells were harvested and lysated with TEN-T buffer (150 mM NaCl, 10 mM Tris/HCl (pH 7.4), 5 mM EDTA (pH 8.0), 1% Triton X-100, 1% 1 mM PMSF, 0.1% 2 g/mL aprotinin) for 30 min at 4 °C. Cell lysates were centrifuged at 10,000 g for 15 min at 4 °C to discard the cell debris. An amount of 50 μg total protein per sample was separated by 12% SDS-polyacrylamide gel. The proteins were transferred to PVDF membrane and then blocked with 5% (w/v) skim milk in TBST (50 mM Tris/HCl (pH 7.4), 0.5 M NaCl, 0.05% Tween 20) for 2 h. An antibody against c-Myc

PFMG4 promotes osteoblast differentiation

3

was used at 1:200 (Santa Cruz, USA) dilution, and β-actin at 1:10,000 (Sigma, USA) for blotting overnight at 4 °C, respectively. Second antibody, anti-mouse IgG (Jackson ImmunoResearch, USA) was used at 1:10,000 dilution. An enhanced chemiluminescent substrate for HRP detection (Pierce, USA) was used to visualize immuno-reactivity.16,17) Cell proliferation. The cells were seeded at 2.5 × 104 cells/mL into 96-well plates. The cells proliferation was determined after two, four and six days, respectively by methyl thiazolyl tetrazolium (MTT) assay. Each well was added with 20 μL MTT (5 mg/mL), and the plate was incubated for an additional 5 h. Then, the medium was removed and 150 μL DMSO was added into each well. After shaking for 15 min, the absorbance was measured at 490 nm.18) ALP activity. The cells were seeded at 2.5 × 104 cells/mL into 96-well plates and separated into two groups. One group was used for the determination of protein concentration. Total protein concentration was determined using BCA protein assay kit (Pierce, USA), with the absorbance measured at 550 nm. The other group was used for ALP assay. Cells were incubated in 0.1 M NaHCO3-Na2CO3 buffer (pH 10.0), containing 0.1% Triton X-100, 2 mM MgSO4, and 6 mM PNPP for 30 min at 37 °C. The absorbance was measured at 405 nm. ALP-specific activity ratio was calculated by the following formula: value of absorbance at 405 nm/ value of absorbance at 550 nm.13) Calcium accumulation. Cells were plated into a six-well plate at the density of 2.5 × 104 cells/cm2 for osteoblast differentiation. The medium was changed into mineralization medium after three days. Three weeks later, the cells were fixed with 70% ethanol and stained by Alizarin Red solution (40 mM, pH 4.2) to visualize the calcium deposits. Statistical analysis All data were expressed as mean values ± SE from at least three independent experiments. Statistical significance was subjected to an unpaired Student’s t-test. A p < 0.05 was considered statistically significant.

Results Sequence analysis of PFMG4 PFMG4 was previously purified from the mantle of P. fucata.11) A potential glycation site is predicted at Lysine 42 (K42) (Fig. 1). An open reading frame with signal peptide codes for a 17.9 kDa protein that is rich in Asn (9.5%), Val (9.5%), Thr (8.9%), Ser (7.6%), Gly (7.6%), and Phe (7.6%) residues (Table 1). The amino acid component in PFMG4 is similar to MSI31, MSI60,19) nacrein,20) and PFMG313) which are rich in Gly. The theoretical isoelectric point of PFMG4 is 7.81, and it belongs to the basic protein group which is similar to PFMG3, but it is different from MSI31, MSI60, and nacrein.

Fig. 1. Analysis of pfmg4 gene sequence and cDNA predicted protein sequence. Notes: The boxed sequence is the start codon, the asterisk (*) sequence is the stop codon, the shadowed Lysine 42 (K42) is the potential glycation site, and the underlined sequence (aataaa) is the polyadenylation signal sequence.

Table 1. region. Amino acid Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val Pyl Sec

Predicted amino acid composition from the coding

Residues

Mol (%)

6 9 15 9 2 10 3 12 3 7 7 4 4 12 5 12 14 4 5 15 0 0

3.8 5.7 9.5 5.7 1.3 6.3 1.9 7.6 1.9 4.4 4.4 2.5 2.5 7.6 3.2 7.6 8.9 2.5 3.2 9.5 0 0

Localization of pfmg4 mRNA To determine the expression pattern of pfmg4 mRNA in adult oyster, semi-quantitative RT-PCR was performed. The pfmg4 mRNA was highly expressed in the mantle tissue, and lower expression was observed in foot, gill, adductor muscle, and viscera (Fig. 2(A) and (B)), suggesting that its expression may play an important role in the mantle tissue of P. fucata. Homologic and phylogenetic analysis of PFMG4 PFMG4 was observed to contain a globular C1q domain (Fig. 3(A), NCBI BLAST). Since C1q domain could bind Ca2+,21,22) PFMG4 has a potential ability to promote calcium carbonate deposition and

4

X. Wang et al.

plasmid into MC3T3-E1 cells to establish the MC3T3E1-Pfmg4 stable cell line. Therefore, PFMG4 protein is connected with Myc protein which is a tag in PFMG4myc recombinant protein. We have used C-Myc antibody to detect the Myc protein, so that the Myc protein level is same as that of the PFMG4 protein level. In MC3T3-E1-Pfmg4 stable cell line, the results showed that pfmg4 mRNA expression level is high (Fig. 4(A)), and PFMG4 protein level is high by detecting the C-Myc protein level (Fig. 4(B)). PFMG4 suppressed MC3T3-E1 cell growth To examine the biological effect of PFMG4 on MC3T3-E1 cells, we performed MTT assay to measure the growth of MC3T3-E1-Pfmg4 cells (Fig. 5). We observed that the proliferation of MC3T3-E1-Pfmg4 cells was dramatically suppressed after culturing for four days when compared to MC3T3-E1 cells. Hence, this result suggested that the cell proliferation was suppressed by PFMG4. Fig. 2. RT-PCR analysis of pfmg4 gene expression in five tissues from P. fucata. Notes: (A) pfmg4 mRNA was detected in five tissues. 1, mantle; 2, foot; 3, gill; 4, adductor muscle; 5, viscera. The housekeeping gene encoding glyceraldehyde 3-phosphate dehydrogenase (Pf-gapdh) was included as an internal control. The PCR product of pfmg4 is 293 bp and Pf-gapdh is 229 bp in length. (B) Relative expression of pfmg4 mRNA in tissues of the pearl oyster. 1, mantle; 2, foot; 3, gill; 4, adductor muscle; 5, viscera. pfmg4 expression in adductor muscle is used for the calculation of fold 1.

mineralization process. We used multiple sequence alignments to predict the probable function of PFMG4. The results showed that PFMG4 has 36% identities (49% positive) with Mus musculus complement component 1, q subcomponent-like 2, 36% identities (49% positive) with Rattus norvegicus complement component 1, q like protein 2, 36% identities (49% positive) with Macaca mulatta complement component 1, q like protein 2, 37% identities (51% positive) with Homo sapiens C1QL3 protein, 34% identities (51% positive) with Xenopus laevis complement component 1, q subcomponent-like 4 protein, and 37% identities (48% positive) with Bos taurus complement C1q protein 3 (Fig. 3(B)). From these results, we speculated that PFMG4 may perform the same function as C1q domain. In order to find the evolutionary relationships of PFMG4 in P. fucata and the complement C1q protein in different species, we built a phylogenetic tree to align primary amino acid sequences (EMBL-EBI) by ClustalW2. The result showed that PFMG4 was close to the complement C1q protein in B. taurus (Fig. 3(C)). Expression of PFMG4 in MC3T3-E1 cells Based on our prediction that PFMG4 may promote biomineralization process since PFMG4 has a C1q domain at the C-terminus, which has been reported to bind Ca2+, we examined whether PFMG4 promotes osteoblast differentiation in MC3T3-E1 cells. For this purpose, we subcloned pfmg4 gene into pcDNA3.1-myc plasmid and then transfected the pcDNA3.1-pfmg4-myc

PFMG4 suppressed type I collagen expression To evaluate the gene expression in osteoblast differentiation, we performed semi-quantitative RT-PCR to examine the expression of osteoblast differentiation marker genes. The results showed that the expression of type I collagen, the marker gene of differentiation stage, was significantly decreased in MC3T3-E1-Pfmg4 cells (Fig. 6(A)). We also tested the expressions of osteoblast differentiation marker genes, ocn, osx, and opn. Since the cells were just cultured for three days, they were at the proliferation stage, and these gene expressions remained almost unchanged compared to the control cells (Fig. 6(B)–(E)). PFMG4 enhanced osteoblast differentiation and mineralization in vitro To examine the effect of PFMG4 on osteoblast differentiation, we tested the ALP specific activity which is the marker at the beginning of differentiation stage (Fig. 7). ALP specific activity was remarkably increased in the MC3T3-E1-Pfmg4 cells induced by the mineralization medium. We next observed the mineralized nodules by Alizarin Red staining. More mineralized nodules were observed in MC3T3-E1Pfmg4 cells than in control cells (Fig. 8). These results indicate that PFMG4 enhances osteoblast differentiation and mineralization.

Discussion Despite the fact that pfmg4 has been cloned from the mantle of P. fucata for a few years,11) the role of PFMG4 in biomineralization process in P. fucata has not been known yet. In this study, the pfmg4 expression was significantly high in the mantle tissue, and indicating that it may play an important role in mantle the tissue. Since mantle is the main tissue in shell formation, it is considered that PFMG4 may play an important role in the biomineralization process. Therefore, we further investigated the role of PFMG4

PFMG4 promotes osteoblast differentiation

5

Fig. 3. Putative conserved sequence of PFMG4 protein and phylogenetic analysis. Notes: (A) A putative conserved C1q domain is found at the C-terminus. (B) Alignments of PFMG4 and complement component 1, q protein in M. musculus [Mus] (EDL39796.1), R. norvegicus [Rattus] NP_001099419, M. mulatta [Macaca] NP_001180709.1, H. sapiens [Homo] AAI27718.1, X. laevis [Xenopus] NP_001090380.1, and B. taurus [Bos] NP_001094608.1. “*” indicates residues that are identical in all sequences in the alignment. “:” indicates the presence of conserved substitutions. “.” indicates the presence of semi-conserved substitutions. (C) Phylogenetic analysis of PFMG4 protein and its closest putative homologue in different species. Phylogenetic tree shows the evolutionary relationship of PFMG4 with the protein from species mentioned in B.

Fig. 4. pfmg4 mRNA and PFMG4 protein level in MC3T3-E1Pfmg4 stable cell line. Notes: (A) RT-PCR for analysis of pfmg4 mRNA expression level. M, marker; 1, pfmg4 mRNA in MC3T3-E1 cells; 2, pfmg4 mRNA in MC3T3-E1-Pfmg4 cells. The whole length of pfmg4 is 474 bp. (B) Western blot for analysis of the tag of C-Myc protein level which is also the PFMG4 protein level. 1, C-Myc protein in MC3T3-E1 cells; 2, C-Myc protein in MC3T3-E1-Pfmg4 cells. β-actin is an internal control.

whether it can promote biomineralization process in murine osteoblast cells. Non-enzymatic glycation (NEG) products are involved in the role of stiffening in tissue remodeling.23) Osteocalcin, noncollagenous protein involving in the bone formation, was found to be glycated with age.24) NEG-mediated changes in collagen are observed not only in the bone but also in the connective tissues, and these changes augment skeletal fragility and fracture risk.25,26) From the result of bioinformatics

Fig. 5. Cell proliferation of MC3T3-E1-Pfmg4 cells. Notes: MTT assay was done in MC3T3-E1-Pfmg4 cells after culturing for two, four, and six days, respectively. MC3T3-E1 cells were used as control. Data were expressed as mean ± SE from all experiments, as indicated **p < 0.01.

6

X. Wang et al.

Fig. 6. mRNA level of osteoblastic specific marker genes in MC3T3-E1-Pfmg4 cells. Notes: (A) type I collagen. (B) ocn. (C) osx. (D) opn. (E) β-actin. The mRNA level of osteoblastic marker genes in MC3T3-E1 cells were used as control. The housekeeping gene β-actin was used as an internal control. Data were expressed as mean ± SE from all experiments, as indicated **p < 0.01.

prediction, it was found that PFMG4 has only one glycation site, although other matrix proteins have several glycation sites. Thus, PFMG4 has the potential to play a role in enhaningc tissue stiffening. PFMG4 harboring C1q domain and signal peptide was presumed to be secreted into the matrix to do its function based on the bioinformatics analysis.11) Overexpression of PFMG4 in the MC3T3-E1-Pfmg4 cells significantly suppressed the collagen expression compared to the control in any stages. Three reasons were considered at least: the first, the C1q domain containing a collagen-like region in PFMG4 plays the role to promote matrix formation with collagen; the second, although the mRNA expression of collagen is usually detected at the early stage of mineralization in osteo-

blast cells, low level expression of it was observed at the early stage in MC3T3-E1-Pfmg4 cells; the third, the collagen protein is immediately secreted into the matrix after its mRNA translation. This proposal system is efficient to promote mineralization and the collagen mRNA expression level is enough for the protein translation in MC3T3-E1-Pfmg4 cells. Some researchers demonstrated that when osteoblast proliferation was shutdown, the cells went into the differentiation stage, and ALP expression was enhanced immediately and induced by hydroxyurea.5) Also in this study, the osteoblast proliferation was effectively suppressed in the MC3T3-E1-Pfmg4 cells (Figs. 5 and 7), but the ALP specific activity was concurrently increased, indicating that the overexpression of PFMG4

PFMG4 promotes osteoblast differentiation

7

This research provides the potential compound as the bone remodeling material and also provides important clues to discover a new promising compound for osteoporosis treatment.

Conflict of interest All authors have no conflicts of interest. Funding This work was financially supported by the National Basic Research Program (973 Project) of China [grant number 2007CB507406], the Tsinghua-Yue-Yuen Medical Sciences Fund [grant number THYY20070008], and National University of Defense Technology Yu-Yan Fund [grant number JC12-02-14]. Fig. 7. ALP specific activity in MC3T3-E1-Pfmg4 cells. Notes: ALP specific activity was detected after cells cultured for four, five, and six days, respectively. The ALP specific activity in MC3T3-E1 cells was used as control. Data were expressed as mean ± SE from all experiments, as indicated **p < 0.01.

Fig. 8. Mineralized deposits in MC3T3-E1-Pfmg4 cells. Notes: The mineralized deposits were stained by Alizarin Red solution. The mineralized deposits in MC3T3-E1 cells were used as control.

may effectively inhibit osteoblast proliferation and cells undergo the differentiation stage. In a way that is consistent with this result, the mineralized nodule formation was also significantly increased in MC3T3-E1Pfmg4 cells overexpressed with PFMG4 (Fig. 8). On the other hand, in the hydroxyurea experiment, the mRNA expression levels of ocn and opn were the same as the control cells.5) In this study, we also confirmed that the mRNA expression levels of ocn, osx, and opn genes in MC3T3-E1-Pfmg4 cells were the same as those of the control cells. It is indicated that collagen expression is related with osteoblasts proliferation, which is consistent with the previous study.27) The present study demonstrated that the massive presence of PFMG4 protein in the matrix would shutdown the osteoblasts proliferation.5) Therefore, we suppose that PFMG4 might be a matrix protein, which has a C1q domain same as collagen, and it might play the role as an inhibiting signal on the osteoblast proliferation (Fig. 5) along with suppression of collagen expression (Fig. 6). In conclusion, we have investigated the role of PFMG4 in biomineralization process. The results indicate that PFMG4 inhibits osteoblast proliferation and enhances osteoblast differentiation and mineralization.

References [1] Zheng MH, Wood DJ, Papadimitriou JM. What’s new in the role of cytokines on osteoblast proliferation and differentiation? Pathol. Res. Pract. 1992;188:1104–1121. [2] Deng ZL, Sharff KA, Tang N, Song WX, Luo J, Luo X, Chen J, Bennett E, Reid R, Manning D, Xue A, Montag AG, Luu HH, Haydon RC, He TC. Regulation of osteogenic differentiation during skeletal development. Front Biosci. 2008;13:2001–2021. [3] Rodan GA, Noda M. Gene expression in osteoblastic cells. Crit. Rev. Eukaryot Gene Expr. 1991;1:85–98. [4] Linkhart TA, Mohan S, Baylink DJ. Growth factors for bone growth and repair: IGF, TGF beta and BMP. Bone. 1996;19:1S– 12S. [5] Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, Kennedy MB, Pockwinse S, Lian JB, Stein GS. Progressive development of the rat osteoblast phenotype in vitro: reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J. Cell Physiol. 1990;143:420–430. [6] van Leeuwen JP, van Driel M, van den Bemd GJ, Pols HA. Vitamin D control of osteoblast function and bone extracellular matrix mineralization. Crit. Rev. Eukaryot Gene Expr. 2001;11:199–226. [7] Sudo H, Kodama HA, Amagai Y, Yamamoto S, Kasai S. In vitro differentiation and calcification in a new clonal osteogenic cell line derived from newborn mouse calvaria. J. Cell Biol. 1983;96:191–198. [8] Wang D, Christensen K, Chawla K, Xiao G, Krebsbach PH, Franceschi RT. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/ mineralization potential. J. Bone Miner. Res. 1999;14:893–903. [9] Atlan G, Delattre O, Berland S, LeFaou A, Nabias G, Cot D, Lopez E. Interface between bone and nacre implants in sheep. Biomaterials. 1999;20:1017–1022. [10] Kroger N. Biochemistry. The molecular basis of nacre formation. Science. 2009;325:1351–1352. [11] Liu HL, Liu SF, Ge YJ, Liu J, Wang XY, Xie LP, Zhang RQ, Wang Z. Identification and characterization of a biomineralization related gene PFMG1 highly expressed in the mantle of Pinctada fucata. Biochemistry. 2007;46:844–851. [12] Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Nat. Acad. Sci. USA. 1996;93:6025–6030. [13] Wang X, Liu S, Xie L, Zhang R, Wang Z. Pinctada fucata mantle gene 3 (PFMG3) promotes differentiation in mouse osteoblasts (MC3T3-E1). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 2011;158:173–180. [14] Wang X, Hinshaw S, Liu S, Wang Z. Pinctada fucata mantle gene 5 (PFMG5) from pearl oyster mantle inhibits osteoblast differentiation. Biosci. Biotechnol. Biochem. 2011;75:991–993.

8

X. Wang et al.

[15] Zhou Y, He Z, Huang J, Gong N, Yan Z, Liu X, Sun J, Wang H, Zhang G, Xie L, Zhang R. Cloning and characterization of the activin like receptor 1 homolog (Pf-ALR1) in the pearl oyster, Pinctada fucata. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 2010;156:158–167. [16] Wang X, Harimoto K, Xie S, Cheng H, Liu J, Wang Z. Matrix protein biglycan induces osteoblast differentiation through extracellular signal-regulated kinase and Smad pathways. Biol. Pharm. Bull. 2010;33:1891–1897. [17] Wang X, Harimoto K, Liu J, Guo J, Hinshaw S, Chang Z, Wang Z. Spata4 promotes osteoblast differentiation through Erk-activated Runx2 pathway. J. Bone Miner. Res. 2011;26:1964–1973. [18] Choi EM. Protective effect of quercitrin against hydrogen peroxide-induced dysfunction in osteoblastic MC3T3-E1 cells. Exp. Toxicol. Pathol. 2010; 64: 211–216. [19] Sudo S, Fujikawa T, Nagakura T, Ohkubo T, Sakaguchi K, Tanaka M, Nakashima K, Takahashi T. Structures of mollusc shell framework proteins. Nature. 1997;387:563–564. [20] Miyamoto H, Miyashita T, Okushima M, Nakano S, Morita T, Matsushiro A. A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Nat. Acad. Sci. USA. 1996;93:9657–9660. [21] Innamorati G, Bianchi E, Whang MI. An intracellular role for the C1q-globular domain. Cell. Signalling. 2006;18:761–770.

[22] Roumenina LT, Kantardjiev AA, Atanasov BP, Waters P, Gadjeva M, Reid KB, Mantovani A, Kishore U, Kojouharova MS. Role of Ca2+ in the electrostatic stability and the functional activity of the globular domain of human C1q. Biochemistry. 2005;44:14097–14109. [23] Bank RA, Bayliss MT, Lafeber FP, Maroudas A, Tekoppele JM. Ageing and zonal variation in post-translational modification of collagen in normal human articular cartilage. The age-related increase in non-enzymatic glycation affects biomechanical properties of cartilage. Biochem. J. 1998;330:345–351. [24] Gundberg CM, Anderson M, Dickson I, Gallop PM. “Glycated” osteocalcin in human and bovine bone. The effect of age. J. Biol. Chem. 1986;261:14557–14561. [25] Vashishth D, Gibson GJ, Khoury JI, Schaffler MB, Kimura J, Fyhrie DP. Influence of nonenzymatic glycation on biomechanical properties of cortical bone. Bone. 2001;28:195–201. [26] Bradke BS, Vashishth D. N-phenacylthiazolium bromide reduces bone fragility induced by nonenzymatic glycation. PLoS One. 2014;9:e103199. [27] Wang ML, Nesti LJ, Tuli R, Lazatin J, Danielson KG, Sharkey PF, Tuan RS. Titanium particles suppress expression of osteoblastic phenotype in human mesenchymal stem cells. J. Orthop. Res. 2002;20:1175–1184.