PKCδ-IRAK1 axis regulates oxidized LDL induced IL-1β production in monocytes Rajiv Lochan Tiwari1#,Vishal Singh1#, Ankita Singh1#, Minakshi Rana1, Anupam Verma2, Nikhil Kothari3, Monica Kohli3, Jaishri Bogra3, Madhu Dikshit1 and Manoj Kumar Barthwal1*. 1. Pharmacology Division, CSIR-Central Drug Research Institute, B.S. 10/1, Sector 10, Sitapur Road, Jankipuram Extension, Lucknow 226031, India 2. Department of Transfusion Medicine, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, India 3. Department of Anaesthesia, King George's Medical University, Lucknow, India
Authors Contributed Equally To This Work.
* Correspondence to: Dr. Manoj Kumar Barthwal, Pharmacology Division, CSIR-Central Drug Research Institute, B.S 10/1, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow-226031. India Email: [email protected] Phone: 91-522-2771940, Extn-4610 CSIR-CDRI manuscript number: 145/2013/MB Abbreviated title: PKCδ mediates Ox-LDL induced IL-1β production
1
Downloaded from www.jlr.org by guest, on November 20, 2014
#
ABSTRACT Present study examined the role of IL-1R-associated kinase (IRAK) and protein kinase C (PKC) in Oxidized LDL (Ox-LDL) induced monocyte IL-1β production. In THP1 cells Ox-LDL induced time dependent secretory IL-1β, IRAK1 activity, IRAK4, IRAK3, CD36 protein expression, PKCδ-JNK1 phosphorylation and AP1 activation. IRAK1/4 siRNA and inhibitor attenuated Ox-LDL induced secreted IL-1β and pro-IL-1β mRNA, pro and mature IL-1β protein expression respectively. DPI (NADPH oxidase inhibitor) and NAC (Free radical scavenger) attenuated Ox-LDL induced reactive oxygen species (ROS) generation, caspase 1 activity and pro and mature IL-1β expression. Ox-LDL
31-8220, Go6976, Rottlerin and PKCδ siRNA. PKCδ siRNA, attenuated Ox-LDL induced increase in IRAK1 kinase activity, JNK1 phosphorylation and AP1 activation. In THP-1 macrophages, CD36, TLR2, 4, 6 and PKCδ SiRNA prevented Ox-LDL induced PKCδ, IRAK1 activation and IL-1β production. Enhanced Ox-LDL and IL-1β in SIRS patient plasma demonstrated positive correlation among each other and with disease severity scores. Ox-LDL containing plasma induced PKCδ, IRAK1 phosphorylation and IL-1β production in CD36, TLR 2,4 and 6 dependent manner in primary human monocytes. Results suggest involvement of CD36, TLR2,4,6 and PKCδ-IRAK1-JNK1-AP-1 axis in OxLDL induced IL-1β production.
Supplementary key words: Oxidized-low density lipoprotein, Protein kinase C delta, Interleukin-1 receptor associated kinase, inflammation, Monocytes
2
Downloaded from www.jlr.org by guest, on November 20, 2014
induced secretory IL-1β production was abrogated in presence of JNK Inhibitor II, Tanshinone IIa, Ro-
INTRODUCTION Oxidized-low density lipoprotein (Ox-LDL) in various acute or chronic inflammatory diseases can be an independent risk factor for cardiovascular complications (1, 2). Ox-LDL itself serves as proinflammatory molecule and contributes in generation of various inflammatory cytokine (3, 4). Elevated Ox-LDL and inflammatory response was observed in extreme pediatric obese subjects (5). Recent reports suggest that Ox-LDL can induce sterile inflammation by stimulating production of various inflammatory cytokines including interleukin-1 beta (IL-1β) (6, 7). Sterile inflammation is characterized by the recruitment of neutrophils and macrophages and production of inflammatory cytokines like IL-1β
and cytokines can induce sterile inflammation (8). In monocytic cells, Ox-LDL induced sterile inflammation was dependent on CD-36 induced hetero-dimerization of toll like receptor (TLR)-4 and 6 (6). Binding of Ox-LDL to CD36 was found to be the initial step important for TLR hetero-dimerization and induction of sterile inflammatory response (6). IL-1β induced sterile inflammation is also reported during acute pancreatitis (9). In addition IL-β has been shown to induce sterile inflammation by regulating macrophage migration (10). Moreover evidence for IL-β induced sterile inflammation also comes from studies in which mice were subjected to sterile injuries (11). Traumatic injury often induces a sterile systemic inflammatory response syndrome (SIRS) in humans and involves activation of the innate immune response (12). The severity of immune response is often associated with the amount of circulating cytokines present in the patient (12, 13). Incidence of multiple organ failure and mortality increases with the increasing inflammatory load (12). TLR2/4 expression on PBMC as well as serum TNF-α, IL-β, and IL-8 were significantly higher in the SIRS patients (14).
3
Downloaded from www.jlr.org by guest, on November 20, 2014
and TNF-α (8). Several exogenous agents like asbestos, silica and endogenous stimuli like RNA, DNA
Exposure of monocytic cells to organic dust leads to production of several inflammatory cytokines like TNF-α, IL-6 which seems to be mediated by Protein kinase C delta (PKCδ) along with some other PKC isoforms (15). PKCδ is a serine-threonine protein kinase that can be activated by calcium and diacylglycerol and plays an important role in inflammation (16-18). It has been shown to be involved in sepsis (19, 20) and seems to mediate sepsis induced lung injury (19). PKCδ also mediates high glucose induced activation of the TLR pathway and production of inflammatory cytokines in monocytic cells (21). Interestingly, the asbestos-induced peribronchiolar cell proliferation and cytokine production are attenuated in lungs of protein kinase C δ knockout mice (22).
immunity and plays a crucial role in the signaling cascade induced by the TLR/IL-1R family (17, 23-25). The IRAK family consists of four members, namely IRAK1, IRAK2, IRAK3 (IRAKM), and IRAK4. IRAK1, IRAK2, and IRAK4 positively regulate the immune response, and IRAK3 usually antagonizes their effect by disrupting the IRAK1/TNFR-associated factor 6 complex (17, 23, 25). Out of all of these kinases, IRAK1 and IRAK4 are widely studied proteins and have been proposed to be true kinases, but their kinase activity is still under investigation (17, 25). In the present study we hypothesized that Ox-LDL can modulate PKC and IRAK pathway in monocytic cells to induce sterile inflammation by stimulating IL-β production. Present study demonstrates role of PKCδ in Ox-LDL induced sterile inflammation by directly activating IRAK1-JNK axis for IL-1β production. This hypothesis has clinical relevance since high Ox-LDL plasma in SIRS individual’s primes monocytes for IL-β overproduction by activating PKCδ-IRAK1 axis.
4
Downloaded from www.jlr.org by guest, on November 20, 2014
The IL-1R–associated kinase (IRAK) family of kinases represents important mediators of innate
METHODS Materials Pharmacological inhibitors including IRAK1/4 INH (inhibitor), JNK inhibitor II (JNK INH II), Rottlerin, Go6976 and Ro-31-8220 were purchased from Calbiochem (San Diego, California). Phorbol myristate acetate (PMA), Diphenyleneiodonium chloride (DPI), N-acetylcysteine (NAC), Myelin Basic Protein (MBP), protease inhibitor cocktail, antibodies against human IRAK1, IRAK2, IRAK3 and βactin were procured from Sigma (St. Louis, MO). IRAK1, IRAK4, pIRAK, pPKCδ, PKCδ antibodies were also procured from Cell Signaling Technology (Danvers, MA). Human anti-pJNK and anti-total
Tanshinone IIa, PKCδ siRNA, TLR-2, -4, -6 siRNA and control siRNA was purchased from Santacruz Biotech Inc. (Santa Cruz, USA). IRAKs siRNA were purchased from Santacruz Biotech Inc. and Dharmacon (Chicago, USA). Anti-CD-36 (FA6-152) antibody was procured from Abcam (Cambridge, MA). ECL reagent was from GE Healthcare (USA). Tissue culture reagents were procured from Invitrogen, USA. All other fine chemicals used in the study were procured from sigma (Spruce Street, St.Louis). Study Population In the present study 74 healthy volunteers and 41 SIRS patients were recruited and evaluated for circulating Ox-LDL and plasma IL-1β. Ethical approval was taken from the institutional ethics committee (human research) of CSIR-Central Drug Research Institute (CSIR-CDRI), King George's Medical University (KGMU), Sanjay Gandhi Post Graduate Institute of Medical Sciences (SGPGIMS), Lucknow and written consent was obtained from the patient’s surrogates. Kin, carers or guardians consented on the behalf of participants whose capacity to consent was reduced and institutional committee approved this consent procedure. Ethical guidelines were in agreement with Helsinki
5
Downloaded from www.jlr.org by guest, on November 20, 2014
JNK were from Millipore (Billerica, Massachusetts). Human anti-CD-36 (SMϕ), anti-TLR-2, -4, and -6,
declaration. Critically ill patients were admitted to the intensive care unit (ICU) of King George's Medical University, Lucknow and SIRS was diagnosed by the presence of two or more of the following criteria: temperature >38°C or 90 beats/minutes (min); respiratory rate >20 breaths/min or PaCO2 12,000 cells/µL. Inclusion criteria for the patients enrolled in present study were patients of trauma, post-operative surgical patients, and patients with respiratory illness (COPD, Asthma). The exclusion criteria for SIRS patients were patients older than 80 years, cardiac failure (class III or IV), liver insufficiency and the presence of HIV, HBV, HCV, infection or cancer. Disease severity index [Acute Physiology and
(SOFA)] (26) along with other clinical pathology tests were monitored at the time of admission in ICU. Among the SIRS patients, 68% were men and 32% were women, with a mean±SE age of 44±5 years (Table 1). Mean±SE age of healthy subjects was 42±4 years out of which male participants were 75% and female participants were 25% (Table 1). Blood samples were collected in tubes containing 3.8% trisodium citrate (9:1 ratio) from healthy subjects and SIRS patients with the help of central venous catheter and plasma was separated after centrifugation at 13000Xg for 7 min (27). It was used immediately or stored at −70°C for assessment of circulating Ox-LDL level and plasma IL-1β. Repeated freeze and thaw of samples were avoided to prevent degradation of plasma Ox-LDL and IL-1β level. Circulating Ox-LDL measurement Circulating Ox-LDL was measured using Ox-LDL competitive enzyme-linked immunosorbent assay (ELISA) kit (Mercodia AB, Uppsala, Sweden). As per manufacture’s protocol plasma samples were initially diluted with sample buffer. 25 µl of calibrator, control and diluted samples along with 100µl of assay buffer were added into appropriate wells pre-coated with anti-Ox-LDL monoclonal antibody. Plate was incubated on a plate shaker (700-900 rpm) for 2 h at room temperature (23-25°C). After rinsing
6
Downloaded from www.jlr.org by guest, on November 20, 2014
Chronic Health Evaluation Scores (APACHE II) and Sequential Organ system Failure Assessment score
with wash buffer 100µl of enzyme conjugate was added to each well and incubated for 1 h at room temperature. After subsequent washing TMB substrate was added and the developed color was measured using ELISA reader (Biotek Instrument Inc. USA) at a wavelength of 450 nm(28). Standard curve was prepared for each assay run using calibrators and control supplied along with the assay kit. Cu2+ modified LDL (50ng-500ng/ml) was used as standard solution(4) to quantify the circulating plasma Ox-LDL in µg/ml for the treatment in primary monocytes isolated from healthy volunteers. Human monocyte isolation, THP1 cell culture and treatments Human primary circulating monocytes were isolated as described earlier with slight modification (17,
and upper layer rich in platelets (PRP) was removed. Remaining blood was centrifuged at 650Xg for 20 min and buffy coat was collected. It was mixed with saline and subjected to dextran sedimentation. Upper layer rich in leukocyte was collected and centrifuged at 500Xg for 5 min at room temperature. Pellets were resuspended in HBSS containing glucose. Density gradient centrifugation utilizing percoll 1080 and 1065 was done at 700Xg for 15 min and interface layer was collected and washed with glucose HBSS. Pellet was resuspended in RPMI-1640 and loaded on hyper osmotic gradient and the interface layer of monocyte was adhered in RPMI-1640 containing 10% FBS for 1 h and subsequently used for experiments (17, 29). Viability of cells was found to be >95% as assessed by trypan blue staining and purity of cells was found to be >95% as assessed by CD14+ cells by flowcytometry. In addition to this human monocytic cell line THP1 was cultured in RPMI1640 containing 10% heat-inactivated FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin. THP1 monocytic cells were treated for 15, 30 min and 1, 6, 12, 24, 48 and 72 h with Ox-LDL (40µg/ml) (6, 30). As per requirement cells were also pretreated for 1 h with different pathway inhibitors, their vehicle control and antibodies at reported concentrations before Ox-LDL treatment. Inhibitors were always compared with their vehicle control for ruling out
7
Downloaded from www.jlr.org by guest, on November 20, 2014
29) from healthy donors after their informed consent. Whole blood was centrifuged at 250Xg for 20 min
non-specific effects. Inhibitors used in the present study were IRAK1/4 inhibitor (0.3µM), JNK INH II (10μM), General PKC inhibitor (Ro-31-8220,1µM), Classical PKC inhibitor (Go6976, 20nM), PKCδ inhibitor (Rottlerin, 2μM), AP-1 inhibitor (Tanshinone IIa, 1µM), DPI (10µM) and NAC (10 mM), vehicle DMSO (< 0.1%). Treatments with FA6-152 and isotype control antibodies were used at 5μg/ml. Primary monocytes were preincubated with CD36 antibody (5µg/ml) or with respective isotype and vehicle control for 1 h. Subsequently, monocytes were treated with 40% (v/v) plasma (4) from healthy subjects with low (6.7 ± 0.3 µg/ml) and high (26.5 ± 0.5 µg/ml) Ox-LDL and plasma from SIRS patients with low (12 ± 0.07µg/ml) and high (32 ± 2 µg/ml) Ox-LDL (4). After respective treatments supernatant
Isolation, purification and characterization of Ox-LDL LDL (d=1.019 to 1.063 g/mL) was isolated from the plasma of healthy volunteers by sequential ultracentrifugation (31). Ox-LDL was prepared by dialyzing the LDL in PBS for overnight at 4oC. LDL protein concentration was measured using bicinchoninic acid (BCA) protein assay kit (Pierce, City). Native LDL (0.2mg/ml) diluted in PBS was oxidized by exposure to 5 µM CuSO4 in PBS at 37oC for 24 h. The oxidation was terminated by addition of Na2 EDTA (0.2mM) and butylated hydroxytoluene (50 µM). The LDL oxidation was determined by measuring the relative electrophoretic mobility and thiobarbituric acid-reactive substances (6, 30, 32). Endotoxin concentration in the Ox-LDL preparations was < 0.1 EU/ml/mg protein as measured by Toxin sensor TM Chromomeric LAL Endotoxin assay kit (GenScript, City) (33). Samples including human plasma were routinely tested and excluded for endotoxin contamination. Assay for secretory interleukin 1β production Production of IL-1β after treatment with Ox-LDL, different pathway inhibitors and antibodies was measured in the media by conventional ELISA (BD OptEIATM set Human IL-1β, BD biosciences, San 8
Downloaded from www.jlr.org by guest, on November 20, 2014
was collected for IL-1β measurement and cell lysates were prepared for Western blotting.
Diego, USA) as described earlier (17). In brief, supernatant were collected from control and treated monocytic cells and incubated for 2 h at RT in overnight capture antibody coated ELISA plates. After incubation, wells were washed with PBS containing 0.05% Tween-20 and incubated with detection antibody followed by washing and enzyme reagent incubation. The colour was developed by adding TMB substrate reagent set (BD biosciences, San Diego, USA) and subsequently read at 450nm and 570 nm on ELISA plate reader (Biotek Instrument Inc. USA). Standard IL-1β provided in the kit was used for drawing the standard and calculation of absolute IL-1β levels. Western and phospho blotting
Tris HCl (pH 7.4), 0.001M EDTA (pH 7.4), aprotinin (1µg/ml), phenylmethylsulfonyl fluoride (100µg/ml), pepstatin (20µg/ml), sodium orthovanadate (2mM), sodium fluoride (2mM) and 1% triton X-100. The cell extracts were clarified at 15000Xg for 5 min and protein contents were measured by using Bradford reagent. Equal amount of lysate were boiled in lamelli buffer and separated on a denaturing 7-10% SDS-PAGE and transferred onto PVDF membranes. After blocking (5% BSA in TBST), the membrane was incubated with primary antibody against various candidate proteins like IRAKs (1:1000), p-IRAK1(1:1000), p-JNK(1:1000), JNK(1:1000), pPKCδ (1:500), PKCδ (1:1000), IL1β(1:1000), CD36(1:1000) and Actin (1:2000) as per manufacturers protocol. This was followed by incubation with specific HRP conjugated secondary antibody. The specific bands were detected by enhanced chemiluminescence as described earlier (17). The relative intensities of the bands were measured by LAS 4000 and image quant software. Results were expressed as fold change in relative image quant units.
9
Downloaded from www.jlr.org by guest, on November 20, 2014
Cells were harvested after desired treatments and lysed in lysis buffer containing 0.1M NaCl, 0.01M
Immunoprecipitation and in vitro kinase assay Cells from different experimental groups were lysed in 0.1% Nonidet P-40 lysis buffer (50 mM Tris-Cl, pH 8.0; 137 mM sodium chloride; 2 mM EDTA; 5% glycerol; 0.1% Nonidet P-40), supplemented with 1:100 protease inhibitor cocktail. The lysate were centrifuged at 15,500Xg, supernatants were collected, and protein concentration was measured. Pre clearing of cell lysate was performed by incubating 400µg of cell extracts from different experimental groups with 20µl protein A sepharose beads (50% slurry) for 45 min at 4°C. After centrifugation at 14000Xg for 10 min the supernatant was mixed with 2.0 µg/ml rabbit anti-IRAK1 antibody and incubated at 4°C overnight. Subsequently 20µl of protein A sepharose
spun down and washed 4 times with lysis buffer and 2 times with 0.1MLiCl. The immunoprecipitates were processed for immuno blotting as desired. IRAK1 kinase assay was performed as described earlier (17). Briefly, the immune-complexes were washed with kinase assay buffer (20 mM MOPS pH 7.2, 50 mM MgCl2, 2 mM EGTA, 1 mM dithiothreitol). Reaction was carried out in the presence of 5µg of MBP substrate, 0.5mM ATP, and 10 µCi of [γ32-P] ATP for 30 min at 30°C (17). Reactions were stopped by the addition of 15µl of 6 X SDS-PAGE sample buffers and subsequently boiled. Supernatant were subjected to SDS-PAGE and transferred to PVDF membranes. Phosphorylation of the substrate was measured by autoradiography. AP-1 activity assay AP-1 activity was measured at different time points of Ox-LDL treatment by using commercially available ELISA kit (TransAMTM AP-1-c-Jun, Active Motif Co. Ltd, Carlsbad, CA, USA). Nuclear extract were prepared as per kits instruction. Briefly monocytic cells after treatment were collected and washed
with
ice
cold
Phosphatase
inhibitor
buffer
(PIB,
125mM
NaF,250mM
β-
glycerophosphate,250mM para-nitrophenyl phosphate and 25mM NaVO3) and resuspended in 1ml of
10
Downloaded from www.jlr.org by guest, on November 20, 2014
beads (50% slurry) was mixed and further rotated for 2h at 4°C. The protein A sepharose beads were
ice-cold Hypotonic buffer (HB, 20mM Hepes, pH7.5, 5mM NaF,10μM Na2MoO4 and 0.1mM EDTA). The cells were allowed to swell for 15 min on ice. 50μl of 10% Nonidet P-40 was added and tube was shaken for 10seconds. Cell homogenate was centrifuged for 30 sec at 40C and supernatant (cytoplasmic fraction) was removed. Nuclear pellet was suspended in 50μl of complete lysis buffer for 30 min at a rocking platform. The lysate was centrifuged at 15000Xg at 4oC for 10 min and nuclear extract was used for AP-1 (c-jun) assay after protein quantification. AP-1 was measured by loading 10μg of nuclear extract on to well of 96-well microtitre plate coated with oligonucleotide 5’-TGAGTCA-3’ for 1 h. After washing 3 times, monoclonal antibody against c-jun was added to appropriate wells and incubated for
further incubated for 1 h at 25oC. Absorbance at 450nm was measured after the addition of tetramethylbenzene solution. Absolute levels of the transcription factor were quantified by setting up standard curves by the help of reagents provided in the kit. siRNA transfection Transfections were performed by using Amaxa nucleofector machine (Amaxa, Cologne, Germany) as described earlier (17) and in the optimized protocol for THP1 and primary monocytes as provided by the manufacturer. Briefly, 1X106 cells in 100μl transfection reagent provided in kit (Cell Line Nucleofactor kit V) were transfected with 3.0μg of control, IRAK1, 2, 3 4, TLR 2, 4, 6, CD36 or PKCδ siRNA. Nucleofector machine program V001 was used for THP-1 and Y001 for primary monocytes. After transfection cells were removed in 0.5ml RPMI and plated in 1 ml of pre warmed medium in 6 well plates. THP-1 macrophages were transfected with control, PKCδ, TLR2, TLR4, TLR6 or CD-36 siRNA using Lipofectamine 2000 transfection reagent according to the manufacturer's instructions. Briefly, THP-1 cells were differentiated with PMA (100nM) for 24 h. Lipofectamine and SiRNA (3 µg) were incubated together at room temperature for 20 min and the complex formed was added to the cells.
11
Downloaded from www.jlr.org by guest, on November 20, 2014
further 1 h at room temperature. Anti-IgG HRP-conjugate in a volume of 100μl was then added and
After 18h of transfection, Ox-LDL treatment was given for 15 min to measure PKCδ and IRAK1 phosphorylation in THP-1 cells, primary monocytes and THP-1 macrophages. CD36 expression was also measured in THP-1 macrophages. Secretory IL-1β was measured after 48 h of Ox-LDL treatment. Expression of recombinant GFP provided in the kit and FITC labeled control siRNA was used as markers for monitoring the transfection efficiency. Gene silencing was measured by Western blotting. Caspase 1 flourometric assay Caspase 1 activity was assayed by using Caspase 1 flourometric assay kit (R&D Systems Inc. Minneapolis, MN). After various treatments cells were collected by centrifugation at 250Xg for 10 min.
caspase 1 assay. 200 μg of total protein was mixed with equal volume of 2X reaction buffer in a microplate. Reactions were initiated by the addition 5 μl of caspase 1 fluorogenic substrate (WEHDAFC). Reaction was carried out at 37oC for 2 h. Plates were read at Excitation 400nm and Emission 505 nm in LS 55 florescence plate reader (Perkin Elmer, Massachusetts, USA). The results were expressed as fold increase in caspase 1 activity of induced cells over that of non-induced cells (34). Expression of IL-1β by real time PCR Total RNA from THP1 cells was extracted by using Tri-reagent. For qRT-PCR analysis of IL-1β, cDNA was synthesized from 1µg of RNA by using commercially available cDNA synthesis kit (Fermentas revert Aid first stand DNA synthesis kit, EU). Real time PCR was done in a 25μl reaction by using Maxima®CYBR green/ROX qPCR Master Mix (2X) (Fermentas Life Sciences, EU), IL-1β (FPCTCTCTCACCTCTCCTACTCAC, AACTGGAACGGTGAAGGTG,
RP-ACACTGCTACTTCTTGCCCC), RP-CTGTGTGGACTTGGGAGAGG)
specific
Actin primers
(FPand
LightCycler® 480 Real time PCR System (Roche Applied Science, Mannheim, Germany). Three step cycling protocol (initial denaturation- 95°C for 10 min, 35 cycle of 15 sec denaturation at 95°C, 30sec
12
Downloaded from www.jlr.org by guest, on November 20, 2014
Kit buffer was used for cell lysis. Supernatant obtained after centrifugation at 10000Xg was used for
annealing at 60°C and 30sec extension at 72°C) was used to amplify the genes (35, 36). Relative fold difference between an experimental and calibrator sample were calculated by using Comparative Ct (2-∆∆Ct) method. Actin was used as internal standard to calculate the relative expression (37). Determination of Intracellular ROS Intracellular reactive oxygen species (ROS) generation was measured by using cell permeable indicator 2 ′,7 ′ -dichlorodihydrofluorescein diacetate (DCF-DA, Sigma) . Briefly, THP-1cells were loaded with 5µM H2DCF-DA for 30 min and PBS washed cells were pretreated with DPI (10 μM), NAC (10 mM) and IRAK1/4 (0.3μM) inhibitor for 1 h before stimulation with Ox-LDL (40μg/ml, 1h) (38). ROS-
Statistical analysis Results are expressed as the mean ± standard error (S.E). The data obtained from control and SIRS patient samples were analyzed by Kolmogorov-Smirnov test for normal distribution. The Pearson product-moment correlation coefficient (r) was used to establish the association of the two variables. Unpaired Student‘t’ test was used to calculate significant difference between two groups. The significance of difference between the means of 3 or more groups was determined by one way ANOVA followed by Tukey-Kramer post-hoc multiple comparison test. A p value equal or less than 0.05 was considered as statistically significant. Blots represent one of three or more similar experiments. All statistical analyses were performed with the GraphPad Prism 5.0 program (GraphPad Inc., San Diego, CA).
13
Downloaded from www.jlr.org by guest, on November 20, 2014
dependent fluorescence was measured by a microplate reader at excitation 480 nm and emission 530 nm.
RESULTS Ox-LDL induces IL-1β production and activation of IRAK pathway THP-1 monocytic cells were treated with Ox-LDL (40μg/ml) for indicated time points and secretory IL1β was measured in the supernatant (Fig. 1A). A time dependent increase in IL-1β production was observed after Ox-LDL treatment (Fig. 1A). The treatment with Ox-LDL for 6 h significantly increases secreted IL-1β (~4 fold) and this was further increased with time reaching maximum at 48 h (~25 fold). At 72 h the secreted IL-1 β was not significantly different from the one observed at 48 h (Fig. 1A). However, LDL (40μg/ml) treatment for 72 h had no effect on IL-1β production (Fig. 1A). Since IRAK
of different IRAK protein was studied. We monitored time dependent expression of all IRAK isoforms up to 72 h in THP-1 monocytes, after Ox-LDL treatment (Fig. 1 B and C). A moderate but significant increase in expression of IRAK1 was observed after 15 and 30 min of Ox-LDL stimulation without any further increase at later time points (Fig. 1B). Further we also observed increased IRAK3 expression in a time dependent manner up to 72 h of Ox-LDL stimulation but no change was found in expression of IRAK 2 (Fig. 1 B and C).
No difference in expression of IRAK2 was observed after Ox-LDL
stimulation. Expression of IRAK3 was increased in a time dependent manner up to 72 h of Ox-LDL stimulation (Fig. 1B and C). Expression of IRAK4 was also significantly increased at 30 min of Ox-LDL stimulation and this was maximum at 24 h. A decrease in IRAK4 expression was observed at 48 and 72 h of Ox-LDL stimulation but this was still significantly more than the control levels (Fig. 1B and C). Since it is reported that IRAK1 is downstream to IRAK4 and relays the signal forward (25), we performed IRAK1 kinase assay for ascertaining the activation of IRAK4-IRAK1 signaling pathway. Significant increase in kinase activity of IRAK1 was observed after 15min (~2 fold) and 30 min (~ 4 fold) of Ox-LDL treatment which diminished at later time points (Fig. 1D), indicating activation of 14
Downloaded from www.jlr.org by guest, on November 20, 2014
family of proteins mediates innate immune response generated by TLR/IL-1R receptor (39), activation
TLR/IL1-R signaling pathway. A time dependent increase in CD36 protein expression was also observed after Ox-LDL treatment (Fig. S1). IRAK1, 4 mediates Ox-LDL induced IL-1β production To evaluate the role of IRAKs in Ox-LDL induced IL-1β production, secretory IL-1 β was measured in IRAK1/4 inhibitor pretreated THP-1 cells. Pretreatment of IRAK1/4 inhibitor significantly attenuated Ox-LDL induced secretory IL-1β production (~3 times, Fig. 2A). To determine the role of each IRAK isoform in Ox-LDL induced IL-1β production, isoform specific siRNAs were used. Significant reduction in IRAK1, 2, 3 and 4 expression was observed on treating with their specific siRNA (Fig. 2B-E). IRAK1
was observed with IRAK2 and IRAK3 siRNA (Fig. 2B-E). IRAK1, 4 regulates Ox-LDL induced IL-1β transcription Since IL-1β production is regulated at multiple levels including gene transcription, translation, and processing, expression of IL-1β at m-RNA level was measured by real-time RT-PCR and at protein levels by Western blotting. For assessing the processing of proIL-1β into mature IL-1β, caspase-1 activity was also evaluated by a fluorimetric assay. A significant induction in IL-1β mRNA (~6.5 fold) was observed after Ox-LDL treatment (Fig. 3A). A significant reduction (~ 3 fold) in IL-1β mRNA was observed in cells that were pretreated with IRAK1/4 inhibitor and subsequently stimulated with Ox-LDL (Fig. 3A). Ox-LDL stimulation also induced reactive oxygen species (ROS) generation (~1.9 fold) in THP-1 cells and this was reduced by DPI (~ 1.4 fold) and NAC (~ 1.8 fold, Fig. 3B). Induction in proIL-1β (~2.5 fold) and IL-1β (~3.6 fold) protein expression was observed after Ox-LDL stimulation and this was significantly attenuated in the presence of DPI (~ 2 and 1.8 fold respectively), NAC (1.7 and 1.5 ~ fold respectively) and IRAK1/4 inhibitor (~1.9 and 1.8 fold respectively, Fig. 3C). Caspase-1 activity was increased (~ 1.5 fold) upon Ox-LDL stimulation (Fig. 3D). Pretreatment of DPI and NAC
15
Downloaded from www.jlr.org by guest, on November 20, 2014
and IRAK4 specific siRNA significantly inhibited Ox-LDL induced secretory IL-1β while no change
significantly reduced (~1.5 and 1.6 fold respectively) Ox-LDL induced caspase-1 activation (Fig. 3D). However, no change in caspase-1 activity was observed in IRAK1/4 inhibitor pretreated cells that were stimulated with Ox-LDL (Fig. 3D). Involvement of JNK1-AP-1 Axis in Ox-LDL induced IL-1β production Since downstream signaling of IRAK involves JNK pathway (40), we performed phospho-JNK blotting in THP-1 lysates obtained after Ox-LDL stimulation for different time points. An initial activation of JNK 1(~ 2-4 fold) at 15 and 30 min of Ox-LDL treatment was observed which subsided at later time points (Fig. 4A). Interestingly, specific activation of JNK1 was observed but there was no significant
signaling of JNK involves AP-1 induced gene transcription, we therefore evaluated nuclear AP-1 DNA binding activity by using Trans AM TM AP-1-c-Jun ELISA kit (Fig. 4B). Ox-LDL induces time dependent activation of AP-1 (~2-3 folds) from 15 min-24 h. Maximum induction was observed at 30 min (~3 folds) of Ox-LDL stimulation which decreases subsequently (Fig. 4B). Pretreatment with JNK and AP-1 inhibitors significantly reduced secreted IL-1β indicating the positive role of JNK-AP-1 axis in Ox-LDL induced IL-1β production (Fig. 4C). PKCδ mediates Ox-LDL induced IRAK1 activation and IL-1β production Previous reports suggest crucial role of PKC in IL-1β production from monocytes (18). To evaluate the role of various PKC isoforms in secretory IL-1β production, experiments were carried out in the presence of different class of PKC inhibitors (Fig. 5A). Ox-LDL induced IL-1β production was measured in the presence of general (Ro-31-8220) and classical (G06976) PKC inhibitors. The Ro-318220 and Go-6976 significantly reduced Ox-LDL induced secretory IL-1β production (Fig. 5A). More importantly PKCδ specific inhibitor Rottlerin also significantly reduced Ox-LDL induced IL-1β production (Fig. 5A). Previous studies had also suggested a role of PKCδ in IL-1β production from
16
Downloaded from www.jlr.org by guest, on November 20, 2014
increase in JNK2 phosphorylation after Ox-LDL treatment (Fig. 4A). Since further downstream
monocytes (18). On expected lines we did see a time dependent activation of PKCδ after Ox-LDL treatment (Fig. 5B). PKCδ activation was observed starting from 15 min up to 72 h and activation was maximum (~5fold) at 12 h, confirming that Ox-LDL treatment activates PKCδ (Fig. 5B). PKCδ specific siRNA significantly inhibited Ox-LDL induced IL-1β production (Fig. 5C). To test whether PKC and specific isoform δ feeds into the IRAK pathway, IRAK1 kinase assay was performed in THP-1 lysates obtained after Ox-LDL, Ro-31-8220, Go-6976 and Rottlerin treatment (Fig. 5D). We observed inhibition in Ox-LDL induced IRAK1 activity in Ro-31-8220 and Rottlerin pretreated THP-1 monocytic cells thus indicating a role of PKCδ in Ox-LDL induced IRAK1 activation (Fig. 5D). Since
reasonable to conclude that both classical PKC (PKCα and β) and non-classical PKC (PKCδ) activation contributes to Ox-LDL induced IL-1β production. However since IRAK1 activity is inhibited only by Ro-31-8220 and Rottlerin and not by Go-6976, it can be concluded that IRAK1 mainly mediates PKCδ induced IL-1 β production. This was further confirmed since a significant decrease in Ox-LDL induced IRAK1 phosphorylation was observed with PKCδ specific siRNA (Fig. 5E). PKCδ-IRAK1 axis activates JNK1-AP-1 pathway during Ox-LDL induced IL-1β production Although we did observe activation of PKCδ -IRAK1 and JNK-AP-1 axis during Ox-LDL induced IL1β production, experiments were performed to test whether PKCδ-IRAK pathway feeds into the JNKAP-1 axis during Ox-LDL induced IL-1β production. Ox-LDL induced JNK-AP-1 axis activation was evaluated in the presence of Rottlerin and IRAK1/4 inhibitor. JNK activation was monitored at 15 min of Ox-LDL stimulation after pretreatment of Rottlerin, IRAK1/4 inhibitor (Fig. 6A) and PKCδ siRNA (Fig. 6B). Significant inhibition in JNK phosphorylation was observed in presence of these inhibitors and PKCδ siRNA thus indicating that PKCδ-IRAK1 axis feeds into JNK pathway. Since AP-1 inhibition by Tanshinone IIa also inhibits Ox-LDL induced IL-1β production, we determined the AP-1 level at 30 min
17
Downloaded from www.jlr.org by guest, on November 20, 2014
Rottlerin also significantly attenuated Ox-LDL induced secretory IL-1β production (Fig. 5A), it is quite
of Ox-LDL stimulation in Rottlerin, IRAK1/4 INH, JNK INH II and PKCδ siRNA pretreated THP1 cells (Fig. 6C). Significant inhibition in Ox-LDL induced AP-1 activity by these inhibitors and PKCδ siRNA indicates that PKCδ induced IL-1β production involves PKCδ-IRAK1-JNK-AP-1 axis. In primary human monocytes also Ox-LDL induced time dependent PKCδ phosphorylation (Fig. 6D). A trend of increase in PKCδ phosphorylation was observed from as early as 5min of Ox-LDL treatment and a significant increase was observed from 15min of treatment. The increase in PKCδ phosphorylation was sustained till the last point of analysis. Ox-LDL significantly enhanced IL-1β production in primary human monocytes while LDL had no significant effect (Fig. 6E). Rottlerin (Fig. 6E) and PKCδ siRNA
(Fig. 6E and 6F respectively). Role of CD36, TLR in Ox-LDL induced IL-1β production To explore the involvement of CD36 and TLRs in Ox-LDL induced IL-1β production, THP-1 cells were pretreated with TLR6, 4, 2 and CD36 siRNA and subsequently stimulated with Ox-LDL. TLR6, 4, 2 and CD36 specific siRNA significantly reduced respective protein expression (~1.4, 1.5, 1.3 and 1.5 fold, Fig. S2A-D). Moreover, treatment with TLR6, 4, 2 and CD36 siRNA significantly prevented Ox-LDL induced PKCδ phosphorylation (~1.5, 1.5, 1.7 and 1.3 fold respectively, Fig. 7A), IRAK1 activation (~1.6, 1.5, 1.3 and 1.3 fold respectively, Fig. 7B) and IL-1β production (~1.4, 1.2, 1.3 and 1.3 fold respectively) in THP-1 cells (Fig. 7C). Further, we explored the role of CD36 and TLRs in Ox-LDL induced PKCδ, IRAK1 activation and IL1β production in THP-1 monocyte derived macrophages. Ox-LDL enhanced PKCδ (~3.3 fold, Fig. S3A), IRAK1 (~2.8 fold, Fig. S3B) phosphorylation and IL-1β (~14 fold, Fig. S3C) production in THP1 macrophages (Fig. S3).
18
Downloaded from www.jlr.org by guest, on November 20, 2014
(Fig. 6F) pretreatment significantly attenuated Ox-LDL induced IL-1β production in these cells as well
Treatment with TLR6, 4, 2, CD36 and PKCδ siRNA significantly reduced respective protein expression (~1.3, 1.3, 1.3, 2 and 1.8 fold Fig. S4A-E) and Ox-LDL induced PKCδ phosphorylation (~2.8, 1.7, 1.7 and 1.7 fold respectively, Fig. S5A), IRAK1 activation (~1.6, 1.6, 2, 2 and 1.3 fold respectively, Fig. S5B) and IL-1β production (~1.4, 1.3, 1.3, 1.6 and 1.3 fold respectively, Fig. S5C) in THP-1 macrophages. Interestingly PKCδ siRNA significantly reduced Ox-LDL induced CD36 up-regulation, indicating a positive feedback of the kinase on the receptor (Fig. S5D). Elevated Ox-LDL and IL-1β in SIRS patients
Patient demographic characteristics including heart rate, mean arterial pressure and disease severity scores (SOFA and APACHE II) are listed in Table 1. A significant increase in the circulating Ox-LDL (p
Authors Contributed Equally To This Work.
* Correspondence to: Dr. Manoj Kumar Barthwal, Pharmacology Division, CSIR-Central Drug Research Institute, B.S 10/1, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow-226031. India Email: [email protected] Phone: 91-522-2771940, Extn-4610 CSIR-CDRI manuscript number: 145/2013/MB Abbreviated title: PKCδ mediates Ox-LDL induced IL-1β production
1
Downloaded from www.jlr.org by guest, on November 20, 2014
#
ABSTRACT Present study examined the role of IL-1R-associated kinase (IRAK) and protein kinase C (PKC) in Oxidized LDL (Ox-LDL) induced monocyte IL-1β production. In THP1 cells Ox-LDL induced time dependent secretory IL-1β, IRAK1 activity, IRAK4, IRAK3, CD36 protein expression, PKCδ-JNK1 phosphorylation and AP1 activation. IRAK1/4 siRNA and inhibitor attenuated Ox-LDL induced secreted IL-1β and pro-IL-1β mRNA, pro and mature IL-1β protein expression respectively. DPI (NADPH oxidase inhibitor) and NAC (Free radical scavenger) attenuated Ox-LDL induced reactive oxygen species (ROS) generation, caspase 1 activity and pro and mature IL-1β expression. Ox-LDL
31-8220, Go6976, Rottlerin and PKCδ siRNA. PKCδ siRNA, attenuated Ox-LDL induced increase in IRAK1 kinase activity, JNK1 phosphorylation and AP1 activation. In THP-1 macrophages, CD36, TLR2, 4, 6 and PKCδ SiRNA prevented Ox-LDL induced PKCδ, IRAK1 activation and IL-1β production. Enhanced Ox-LDL and IL-1β in SIRS patient plasma demonstrated positive correlation among each other and with disease severity scores. Ox-LDL containing plasma induced PKCδ, IRAK1 phosphorylation and IL-1β production in CD36, TLR 2,4 and 6 dependent manner in primary human monocytes. Results suggest involvement of CD36, TLR2,4,6 and PKCδ-IRAK1-JNK1-AP-1 axis in OxLDL induced IL-1β production.
Supplementary key words: Oxidized-low density lipoprotein, Protein kinase C delta, Interleukin-1 receptor associated kinase, inflammation, Monocytes
2
Downloaded from www.jlr.org by guest, on November 20, 2014
induced secretory IL-1β production was abrogated in presence of JNK Inhibitor II, Tanshinone IIa, Ro-
INTRODUCTION Oxidized-low density lipoprotein (Ox-LDL) in various acute or chronic inflammatory diseases can be an independent risk factor for cardiovascular complications (1, 2). Ox-LDL itself serves as proinflammatory molecule and contributes in generation of various inflammatory cytokine (3, 4). Elevated Ox-LDL and inflammatory response was observed in extreme pediatric obese subjects (5). Recent reports suggest that Ox-LDL can induce sterile inflammation by stimulating production of various inflammatory cytokines including interleukin-1 beta (IL-1β) (6, 7). Sterile inflammation is characterized by the recruitment of neutrophils and macrophages and production of inflammatory cytokines like IL-1β
and cytokines can induce sterile inflammation (8). In monocytic cells, Ox-LDL induced sterile inflammation was dependent on CD-36 induced hetero-dimerization of toll like receptor (TLR)-4 and 6 (6). Binding of Ox-LDL to CD36 was found to be the initial step important for TLR hetero-dimerization and induction of sterile inflammatory response (6). IL-1β induced sterile inflammation is also reported during acute pancreatitis (9). In addition IL-β has been shown to induce sterile inflammation by regulating macrophage migration (10). Moreover evidence for IL-β induced sterile inflammation also comes from studies in which mice were subjected to sterile injuries (11). Traumatic injury often induces a sterile systemic inflammatory response syndrome (SIRS) in humans and involves activation of the innate immune response (12). The severity of immune response is often associated with the amount of circulating cytokines present in the patient (12, 13). Incidence of multiple organ failure and mortality increases with the increasing inflammatory load (12). TLR2/4 expression on PBMC as well as serum TNF-α, IL-β, and IL-8 were significantly higher in the SIRS patients (14).
3
Downloaded from www.jlr.org by guest, on November 20, 2014
and TNF-α (8). Several exogenous agents like asbestos, silica and endogenous stimuli like RNA, DNA
Exposure of monocytic cells to organic dust leads to production of several inflammatory cytokines like TNF-α, IL-6 which seems to be mediated by Protein kinase C delta (PKCδ) along with some other PKC isoforms (15). PKCδ is a serine-threonine protein kinase that can be activated by calcium and diacylglycerol and plays an important role in inflammation (16-18). It has been shown to be involved in sepsis (19, 20) and seems to mediate sepsis induced lung injury (19). PKCδ also mediates high glucose induced activation of the TLR pathway and production of inflammatory cytokines in monocytic cells (21). Interestingly, the asbestos-induced peribronchiolar cell proliferation and cytokine production are attenuated in lungs of protein kinase C δ knockout mice (22).
immunity and plays a crucial role in the signaling cascade induced by the TLR/IL-1R family (17, 23-25). The IRAK family consists of four members, namely IRAK1, IRAK2, IRAK3 (IRAKM), and IRAK4. IRAK1, IRAK2, and IRAK4 positively regulate the immune response, and IRAK3 usually antagonizes their effect by disrupting the IRAK1/TNFR-associated factor 6 complex (17, 23, 25). Out of all of these kinases, IRAK1 and IRAK4 are widely studied proteins and have been proposed to be true kinases, but their kinase activity is still under investigation (17, 25). In the present study we hypothesized that Ox-LDL can modulate PKC and IRAK pathway in monocytic cells to induce sterile inflammation by stimulating IL-β production. Present study demonstrates role of PKCδ in Ox-LDL induced sterile inflammation by directly activating IRAK1-JNK axis for IL-1β production. This hypothesis has clinical relevance since high Ox-LDL plasma in SIRS individual’s primes monocytes for IL-β overproduction by activating PKCδ-IRAK1 axis.
4
Downloaded from www.jlr.org by guest, on November 20, 2014
The IL-1R–associated kinase (IRAK) family of kinases represents important mediators of innate
METHODS Materials Pharmacological inhibitors including IRAK1/4 INH (inhibitor), JNK inhibitor II (JNK INH II), Rottlerin, Go6976 and Ro-31-8220 were purchased from Calbiochem (San Diego, California). Phorbol myristate acetate (PMA), Diphenyleneiodonium chloride (DPI), N-acetylcysteine (NAC), Myelin Basic Protein (MBP), protease inhibitor cocktail, antibodies against human IRAK1, IRAK2, IRAK3 and βactin were procured from Sigma (St. Louis, MO). IRAK1, IRAK4, pIRAK, pPKCδ, PKCδ antibodies were also procured from Cell Signaling Technology (Danvers, MA). Human anti-pJNK and anti-total
Tanshinone IIa, PKCδ siRNA, TLR-2, -4, -6 siRNA and control siRNA was purchased from Santacruz Biotech Inc. (Santa Cruz, USA). IRAKs siRNA were purchased from Santacruz Biotech Inc. and Dharmacon (Chicago, USA). Anti-CD-36 (FA6-152) antibody was procured from Abcam (Cambridge, MA). ECL reagent was from GE Healthcare (USA). Tissue culture reagents were procured from Invitrogen, USA. All other fine chemicals used in the study were procured from sigma (Spruce Street, St.Louis). Study Population In the present study 74 healthy volunteers and 41 SIRS patients were recruited and evaluated for circulating Ox-LDL and plasma IL-1β. Ethical approval was taken from the institutional ethics committee (human research) of CSIR-Central Drug Research Institute (CSIR-CDRI), King George's Medical University (KGMU), Sanjay Gandhi Post Graduate Institute of Medical Sciences (SGPGIMS), Lucknow and written consent was obtained from the patient’s surrogates. Kin, carers or guardians consented on the behalf of participants whose capacity to consent was reduced and institutional committee approved this consent procedure. Ethical guidelines were in agreement with Helsinki
5
Downloaded from www.jlr.org by guest, on November 20, 2014
JNK were from Millipore (Billerica, Massachusetts). Human anti-CD-36 (SMϕ), anti-TLR-2, -4, and -6,
declaration. Critically ill patients were admitted to the intensive care unit (ICU) of King George's Medical University, Lucknow and SIRS was diagnosed by the presence of two or more of the following criteria: temperature >38°C or 90 beats/minutes (min); respiratory rate >20 breaths/min or PaCO2 12,000 cells/µL. Inclusion criteria for the patients enrolled in present study were patients of trauma, post-operative surgical patients, and patients with respiratory illness (COPD, Asthma). The exclusion criteria for SIRS patients were patients older than 80 years, cardiac failure (class III or IV), liver insufficiency and the presence of HIV, HBV, HCV, infection or cancer. Disease severity index [Acute Physiology and
(SOFA)] (26) along with other clinical pathology tests were monitored at the time of admission in ICU. Among the SIRS patients, 68% were men and 32% were women, with a mean±SE age of 44±5 years (Table 1). Mean±SE age of healthy subjects was 42±4 years out of which male participants were 75% and female participants were 25% (Table 1). Blood samples were collected in tubes containing 3.8% trisodium citrate (9:1 ratio) from healthy subjects and SIRS patients with the help of central venous catheter and plasma was separated after centrifugation at 13000Xg for 7 min (27). It was used immediately or stored at −70°C for assessment of circulating Ox-LDL level and plasma IL-1β. Repeated freeze and thaw of samples were avoided to prevent degradation of plasma Ox-LDL and IL-1β level. Circulating Ox-LDL measurement Circulating Ox-LDL was measured using Ox-LDL competitive enzyme-linked immunosorbent assay (ELISA) kit (Mercodia AB, Uppsala, Sweden). As per manufacture’s protocol plasma samples were initially diluted with sample buffer. 25 µl of calibrator, control and diluted samples along with 100µl of assay buffer were added into appropriate wells pre-coated with anti-Ox-LDL monoclonal antibody. Plate was incubated on a plate shaker (700-900 rpm) for 2 h at room temperature (23-25°C). After rinsing
6
Downloaded from www.jlr.org by guest, on November 20, 2014
Chronic Health Evaluation Scores (APACHE II) and Sequential Organ system Failure Assessment score
with wash buffer 100µl of enzyme conjugate was added to each well and incubated for 1 h at room temperature. After subsequent washing TMB substrate was added and the developed color was measured using ELISA reader (Biotek Instrument Inc. USA) at a wavelength of 450 nm(28). Standard curve was prepared for each assay run using calibrators and control supplied along with the assay kit. Cu2+ modified LDL (50ng-500ng/ml) was used as standard solution(4) to quantify the circulating plasma Ox-LDL in µg/ml for the treatment in primary monocytes isolated from healthy volunteers. Human monocyte isolation, THP1 cell culture and treatments Human primary circulating monocytes were isolated as described earlier with slight modification (17,
and upper layer rich in platelets (PRP) was removed. Remaining blood was centrifuged at 650Xg for 20 min and buffy coat was collected. It was mixed with saline and subjected to dextran sedimentation. Upper layer rich in leukocyte was collected and centrifuged at 500Xg for 5 min at room temperature. Pellets were resuspended in HBSS containing glucose. Density gradient centrifugation utilizing percoll 1080 and 1065 was done at 700Xg for 15 min and interface layer was collected and washed with glucose HBSS. Pellet was resuspended in RPMI-1640 and loaded on hyper osmotic gradient and the interface layer of monocyte was adhered in RPMI-1640 containing 10% FBS for 1 h and subsequently used for experiments (17, 29). Viability of cells was found to be >95% as assessed by trypan blue staining and purity of cells was found to be >95% as assessed by CD14+ cells by flowcytometry. In addition to this human monocytic cell line THP1 was cultured in RPMI1640 containing 10% heat-inactivated FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin. THP1 monocytic cells were treated for 15, 30 min and 1, 6, 12, 24, 48 and 72 h with Ox-LDL (40µg/ml) (6, 30). As per requirement cells were also pretreated for 1 h with different pathway inhibitors, their vehicle control and antibodies at reported concentrations before Ox-LDL treatment. Inhibitors were always compared with their vehicle control for ruling out
7
Downloaded from www.jlr.org by guest, on November 20, 2014
29) from healthy donors after their informed consent. Whole blood was centrifuged at 250Xg for 20 min
non-specific effects. Inhibitors used in the present study were IRAK1/4 inhibitor (0.3µM), JNK INH II (10μM), General PKC inhibitor (Ro-31-8220,1µM), Classical PKC inhibitor (Go6976, 20nM), PKCδ inhibitor (Rottlerin, 2μM), AP-1 inhibitor (Tanshinone IIa, 1µM), DPI (10µM) and NAC (10 mM), vehicle DMSO (< 0.1%). Treatments with FA6-152 and isotype control antibodies were used at 5μg/ml. Primary monocytes were preincubated with CD36 antibody (5µg/ml) or with respective isotype and vehicle control for 1 h. Subsequently, monocytes were treated with 40% (v/v) plasma (4) from healthy subjects with low (6.7 ± 0.3 µg/ml) and high (26.5 ± 0.5 µg/ml) Ox-LDL and plasma from SIRS patients with low (12 ± 0.07µg/ml) and high (32 ± 2 µg/ml) Ox-LDL (4). After respective treatments supernatant
Isolation, purification and characterization of Ox-LDL LDL (d=1.019 to 1.063 g/mL) was isolated from the plasma of healthy volunteers by sequential ultracentrifugation (31). Ox-LDL was prepared by dialyzing the LDL in PBS for overnight at 4oC. LDL protein concentration was measured using bicinchoninic acid (BCA) protein assay kit (Pierce, City). Native LDL (0.2mg/ml) diluted in PBS was oxidized by exposure to 5 µM CuSO4 in PBS at 37oC for 24 h. The oxidation was terminated by addition of Na2 EDTA (0.2mM) and butylated hydroxytoluene (50 µM). The LDL oxidation was determined by measuring the relative electrophoretic mobility and thiobarbituric acid-reactive substances (6, 30, 32). Endotoxin concentration in the Ox-LDL preparations was < 0.1 EU/ml/mg protein as measured by Toxin sensor TM Chromomeric LAL Endotoxin assay kit (GenScript, City) (33). Samples including human plasma were routinely tested and excluded for endotoxin contamination. Assay for secretory interleukin 1β production Production of IL-1β after treatment with Ox-LDL, different pathway inhibitors and antibodies was measured in the media by conventional ELISA (BD OptEIATM set Human IL-1β, BD biosciences, San 8
Downloaded from www.jlr.org by guest, on November 20, 2014
was collected for IL-1β measurement and cell lysates were prepared for Western blotting.
Diego, USA) as described earlier (17). In brief, supernatant were collected from control and treated monocytic cells and incubated for 2 h at RT in overnight capture antibody coated ELISA plates. After incubation, wells were washed with PBS containing 0.05% Tween-20 and incubated with detection antibody followed by washing and enzyme reagent incubation. The colour was developed by adding TMB substrate reagent set (BD biosciences, San Diego, USA) and subsequently read at 450nm and 570 nm on ELISA plate reader (Biotek Instrument Inc. USA). Standard IL-1β provided in the kit was used for drawing the standard and calculation of absolute IL-1β levels. Western and phospho blotting
Tris HCl (pH 7.4), 0.001M EDTA (pH 7.4), aprotinin (1µg/ml), phenylmethylsulfonyl fluoride (100µg/ml), pepstatin (20µg/ml), sodium orthovanadate (2mM), sodium fluoride (2mM) and 1% triton X-100. The cell extracts were clarified at 15000Xg for 5 min and protein contents were measured by using Bradford reagent. Equal amount of lysate were boiled in lamelli buffer and separated on a denaturing 7-10% SDS-PAGE and transferred onto PVDF membranes. After blocking (5% BSA in TBST), the membrane was incubated with primary antibody against various candidate proteins like IRAKs (1:1000), p-IRAK1(1:1000), p-JNK(1:1000), JNK(1:1000), pPKCδ (1:500), PKCδ (1:1000), IL1β(1:1000), CD36(1:1000) and Actin (1:2000) as per manufacturers protocol. This was followed by incubation with specific HRP conjugated secondary antibody. The specific bands were detected by enhanced chemiluminescence as described earlier (17). The relative intensities of the bands were measured by LAS 4000 and image quant software. Results were expressed as fold change in relative image quant units.
9
Downloaded from www.jlr.org by guest, on November 20, 2014
Cells were harvested after desired treatments and lysed in lysis buffer containing 0.1M NaCl, 0.01M
Immunoprecipitation and in vitro kinase assay Cells from different experimental groups were lysed in 0.1% Nonidet P-40 lysis buffer (50 mM Tris-Cl, pH 8.0; 137 mM sodium chloride; 2 mM EDTA; 5% glycerol; 0.1% Nonidet P-40), supplemented with 1:100 protease inhibitor cocktail. The lysate were centrifuged at 15,500Xg, supernatants were collected, and protein concentration was measured. Pre clearing of cell lysate was performed by incubating 400µg of cell extracts from different experimental groups with 20µl protein A sepharose beads (50% slurry) for 45 min at 4°C. After centrifugation at 14000Xg for 10 min the supernatant was mixed with 2.0 µg/ml rabbit anti-IRAK1 antibody and incubated at 4°C overnight. Subsequently 20µl of protein A sepharose
spun down and washed 4 times with lysis buffer and 2 times with 0.1MLiCl. The immunoprecipitates were processed for immuno blotting as desired. IRAK1 kinase assay was performed as described earlier (17). Briefly, the immune-complexes were washed with kinase assay buffer (20 mM MOPS pH 7.2, 50 mM MgCl2, 2 mM EGTA, 1 mM dithiothreitol). Reaction was carried out in the presence of 5µg of MBP substrate, 0.5mM ATP, and 10 µCi of [γ32-P] ATP for 30 min at 30°C (17). Reactions were stopped by the addition of 15µl of 6 X SDS-PAGE sample buffers and subsequently boiled. Supernatant were subjected to SDS-PAGE and transferred to PVDF membranes. Phosphorylation of the substrate was measured by autoradiography. AP-1 activity assay AP-1 activity was measured at different time points of Ox-LDL treatment by using commercially available ELISA kit (TransAMTM AP-1-c-Jun, Active Motif Co. Ltd, Carlsbad, CA, USA). Nuclear extract were prepared as per kits instruction. Briefly monocytic cells after treatment were collected and washed
with
ice
cold
Phosphatase
inhibitor
buffer
(PIB,
125mM
NaF,250mM
β-
glycerophosphate,250mM para-nitrophenyl phosphate and 25mM NaVO3) and resuspended in 1ml of
10
Downloaded from www.jlr.org by guest, on November 20, 2014
beads (50% slurry) was mixed and further rotated for 2h at 4°C. The protein A sepharose beads were
ice-cold Hypotonic buffer (HB, 20mM Hepes, pH7.5, 5mM NaF,10μM Na2MoO4 and 0.1mM EDTA). The cells were allowed to swell for 15 min on ice. 50μl of 10% Nonidet P-40 was added and tube was shaken for 10seconds. Cell homogenate was centrifuged for 30 sec at 40C and supernatant (cytoplasmic fraction) was removed. Nuclear pellet was suspended in 50μl of complete lysis buffer for 30 min at a rocking platform. The lysate was centrifuged at 15000Xg at 4oC for 10 min and nuclear extract was used for AP-1 (c-jun) assay after protein quantification. AP-1 was measured by loading 10μg of nuclear extract on to well of 96-well microtitre plate coated with oligonucleotide 5’-TGAGTCA-3’ for 1 h. After washing 3 times, monoclonal antibody against c-jun was added to appropriate wells and incubated for
further incubated for 1 h at 25oC. Absorbance at 450nm was measured after the addition of tetramethylbenzene solution. Absolute levels of the transcription factor were quantified by setting up standard curves by the help of reagents provided in the kit. siRNA transfection Transfections were performed by using Amaxa nucleofector machine (Amaxa, Cologne, Germany) as described earlier (17) and in the optimized protocol for THP1 and primary monocytes as provided by the manufacturer. Briefly, 1X106 cells in 100μl transfection reagent provided in kit (Cell Line Nucleofactor kit V) were transfected with 3.0μg of control, IRAK1, 2, 3 4, TLR 2, 4, 6, CD36 or PKCδ siRNA. Nucleofector machine program V001 was used for THP-1 and Y001 for primary monocytes. After transfection cells were removed in 0.5ml RPMI and plated in 1 ml of pre warmed medium in 6 well plates. THP-1 macrophages were transfected with control, PKCδ, TLR2, TLR4, TLR6 or CD-36 siRNA using Lipofectamine 2000 transfection reagent according to the manufacturer's instructions. Briefly, THP-1 cells were differentiated with PMA (100nM) for 24 h. Lipofectamine and SiRNA (3 µg) were incubated together at room temperature for 20 min and the complex formed was added to the cells.
11
Downloaded from www.jlr.org by guest, on November 20, 2014
further 1 h at room temperature. Anti-IgG HRP-conjugate in a volume of 100μl was then added and
After 18h of transfection, Ox-LDL treatment was given for 15 min to measure PKCδ and IRAK1 phosphorylation in THP-1 cells, primary monocytes and THP-1 macrophages. CD36 expression was also measured in THP-1 macrophages. Secretory IL-1β was measured after 48 h of Ox-LDL treatment. Expression of recombinant GFP provided in the kit and FITC labeled control siRNA was used as markers for monitoring the transfection efficiency. Gene silencing was measured by Western blotting. Caspase 1 flourometric assay Caspase 1 activity was assayed by using Caspase 1 flourometric assay kit (R&D Systems Inc. Minneapolis, MN). After various treatments cells were collected by centrifugation at 250Xg for 10 min.
caspase 1 assay. 200 μg of total protein was mixed with equal volume of 2X reaction buffer in a microplate. Reactions were initiated by the addition 5 μl of caspase 1 fluorogenic substrate (WEHDAFC). Reaction was carried out at 37oC for 2 h. Plates were read at Excitation 400nm and Emission 505 nm in LS 55 florescence plate reader (Perkin Elmer, Massachusetts, USA). The results were expressed as fold increase in caspase 1 activity of induced cells over that of non-induced cells (34). Expression of IL-1β by real time PCR Total RNA from THP1 cells was extracted by using Tri-reagent. For qRT-PCR analysis of IL-1β, cDNA was synthesized from 1µg of RNA by using commercially available cDNA synthesis kit (Fermentas revert Aid first stand DNA synthesis kit, EU). Real time PCR was done in a 25μl reaction by using Maxima®CYBR green/ROX qPCR Master Mix (2X) (Fermentas Life Sciences, EU), IL-1β (FPCTCTCTCACCTCTCCTACTCAC, AACTGGAACGGTGAAGGTG,
RP-ACACTGCTACTTCTTGCCCC), RP-CTGTGTGGACTTGGGAGAGG)
specific
Actin primers
(FPand
LightCycler® 480 Real time PCR System (Roche Applied Science, Mannheim, Germany). Three step cycling protocol (initial denaturation- 95°C for 10 min, 35 cycle of 15 sec denaturation at 95°C, 30sec
12
Downloaded from www.jlr.org by guest, on November 20, 2014
Kit buffer was used for cell lysis. Supernatant obtained after centrifugation at 10000Xg was used for
annealing at 60°C and 30sec extension at 72°C) was used to amplify the genes (35, 36). Relative fold difference between an experimental and calibrator sample were calculated by using Comparative Ct (2-∆∆Ct) method. Actin was used as internal standard to calculate the relative expression (37). Determination of Intracellular ROS Intracellular reactive oxygen species (ROS) generation was measured by using cell permeable indicator 2 ′,7 ′ -dichlorodihydrofluorescein diacetate (DCF-DA, Sigma) . Briefly, THP-1cells were loaded with 5µM H2DCF-DA for 30 min and PBS washed cells were pretreated with DPI (10 μM), NAC (10 mM) and IRAK1/4 (0.3μM) inhibitor for 1 h before stimulation with Ox-LDL (40μg/ml, 1h) (38). ROS-
Statistical analysis Results are expressed as the mean ± standard error (S.E). The data obtained from control and SIRS patient samples were analyzed by Kolmogorov-Smirnov test for normal distribution. The Pearson product-moment correlation coefficient (r) was used to establish the association of the two variables. Unpaired Student‘t’ test was used to calculate significant difference between two groups. The significance of difference between the means of 3 or more groups was determined by one way ANOVA followed by Tukey-Kramer post-hoc multiple comparison test. A p value equal or less than 0.05 was considered as statistically significant. Blots represent one of three or more similar experiments. All statistical analyses were performed with the GraphPad Prism 5.0 program (GraphPad Inc., San Diego, CA).
13
Downloaded from www.jlr.org by guest, on November 20, 2014
dependent fluorescence was measured by a microplate reader at excitation 480 nm and emission 530 nm.
RESULTS Ox-LDL induces IL-1β production and activation of IRAK pathway THP-1 monocytic cells were treated with Ox-LDL (40μg/ml) for indicated time points and secretory IL1β was measured in the supernatant (Fig. 1A). A time dependent increase in IL-1β production was observed after Ox-LDL treatment (Fig. 1A). The treatment with Ox-LDL for 6 h significantly increases secreted IL-1β (~4 fold) and this was further increased with time reaching maximum at 48 h (~25 fold). At 72 h the secreted IL-1 β was not significantly different from the one observed at 48 h (Fig. 1A). However, LDL (40μg/ml) treatment for 72 h had no effect on IL-1β production (Fig. 1A). Since IRAK
of different IRAK protein was studied. We monitored time dependent expression of all IRAK isoforms up to 72 h in THP-1 monocytes, after Ox-LDL treatment (Fig. 1 B and C). A moderate but significant increase in expression of IRAK1 was observed after 15 and 30 min of Ox-LDL stimulation without any further increase at later time points (Fig. 1B). Further we also observed increased IRAK3 expression in a time dependent manner up to 72 h of Ox-LDL stimulation but no change was found in expression of IRAK 2 (Fig. 1 B and C).
No difference in expression of IRAK2 was observed after Ox-LDL
stimulation. Expression of IRAK3 was increased in a time dependent manner up to 72 h of Ox-LDL stimulation (Fig. 1B and C). Expression of IRAK4 was also significantly increased at 30 min of Ox-LDL stimulation and this was maximum at 24 h. A decrease in IRAK4 expression was observed at 48 and 72 h of Ox-LDL stimulation but this was still significantly more than the control levels (Fig. 1B and C). Since it is reported that IRAK1 is downstream to IRAK4 and relays the signal forward (25), we performed IRAK1 kinase assay for ascertaining the activation of IRAK4-IRAK1 signaling pathway. Significant increase in kinase activity of IRAK1 was observed after 15min (~2 fold) and 30 min (~ 4 fold) of Ox-LDL treatment which diminished at later time points (Fig. 1D), indicating activation of 14
Downloaded from www.jlr.org by guest, on November 20, 2014
family of proteins mediates innate immune response generated by TLR/IL-1R receptor (39), activation
TLR/IL1-R signaling pathway. A time dependent increase in CD36 protein expression was also observed after Ox-LDL treatment (Fig. S1). IRAK1, 4 mediates Ox-LDL induced IL-1β production To evaluate the role of IRAKs in Ox-LDL induced IL-1β production, secretory IL-1 β was measured in IRAK1/4 inhibitor pretreated THP-1 cells. Pretreatment of IRAK1/4 inhibitor significantly attenuated Ox-LDL induced secretory IL-1β production (~3 times, Fig. 2A). To determine the role of each IRAK isoform in Ox-LDL induced IL-1β production, isoform specific siRNAs were used. Significant reduction in IRAK1, 2, 3 and 4 expression was observed on treating with their specific siRNA (Fig. 2B-E). IRAK1
was observed with IRAK2 and IRAK3 siRNA (Fig. 2B-E). IRAK1, 4 regulates Ox-LDL induced IL-1β transcription Since IL-1β production is regulated at multiple levels including gene transcription, translation, and processing, expression of IL-1β at m-RNA level was measured by real-time RT-PCR and at protein levels by Western blotting. For assessing the processing of proIL-1β into mature IL-1β, caspase-1 activity was also evaluated by a fluorimetric assay. A significant induction in IL-1β mRNA (~6.5 fold) was observed after Ox-LDL treatment (Fig. 3A). A significant reduction (~ 3 fold) in IL-1β mRNA was observed in cells that were pretreated with IRAK1/4 inhibitor and subsequently stimulated with Ox-LDL (Fig. 3A). Ox-LDL stimulation also induced reactive oxygen species (ROS) generation (~1.9 fold) in THP-1 cells and this was reduced by DPI (~ 1.4 fold) and NAC (~ 1.8 fold, Fig. 3B). Induction in proIL-1β (~2.5 fold) and IL-1β (~3.6 fold) protein expression was observed after Ox-LDL stimulation and this was significantly attenuated in the presence of DPI (~ 2 and 1.8 fold respectively), NAC (1.7 and 1.5 ~ fold respectively) and IRAK1/4 inhibitor (~1.9 and 1.8 fold respectively, Fig. 3C). Caspase-1 activity was increased (~ 1.5 fold) upon Ox-LDL stimulation (Fig. 3D). Pretreatment of DPI and NAC
15
Downloaded from www.jlr.org by guest, on November 20, 2014
and IRAK4 specific siRNA significantly inhibited Ox-LDL induced secretory IL-1β while no change
significantly reduced (~1.5 and 1.6 fold respectively) Ox-LDL induced caspase-1 activation (Fig. 3D). However, no change in caspase-1 activity was observed in IRAK1/4 inhibitor pretreated cells that were stimulated with Ox-LDL (Fig. 3D). Involvement of JNK1-AP-1 Axis in Ox-LDL induced IL-1β production Since downstream signaling of IRAK involves JNK pathway (40), we performed phospho-JNK blotting in THP-1 lysates obtained after Ox-LDL stimulation for different time points. An initial activation of JNK 1(~ 2-4 fold) at 15 and 30 min of Ox-LDL treatment was observed which subsided at later time points (Fig. 4A). Interestingly, specific activation of JNK1 was observed but there was no significant
signaling of JNK involves AP-1 induced gene transcription, we therefore evaluated nuclear AP-1 DNA binding activity by using Trans AM TM AP-1-c-Jun ELISA kit (Fig. 4B). Ox-LDL induces time dependent activation of AP-1 (~2-3 folds) from 15 min-24 h. Maximum induction was observed at 30 min (~3 folds) of Ox-LDL stimulation which decreases subsequently (Fig. 4B). Pretreatment with JNK and AP-1 inhibitors significantly reduced secreted IL-1β indicating the positive role of JNK-AP-1 axis in Ox-LDL induced IL-1β production (Fig. 4C). PKCδ mediates Ox-LDL induced IRAK1 activation and IL-1β production Previous reports suggest crucial role of PKC in IL-1β production from monocytes (18). To evaluate the role of various PKC isoforms in secretory IL-1β production, experiments were carried out in the presence of different class of PKC inhibitors (Fig. 5A). Ox-LDL induced IL-1β production was measured in the presence of general (Ro-31-8220) and classical (G06976) PKC inhibitors. The Ro-318220 and Go-6976 significantly reduced Ox-LDL induced secretory IL-1β production (Fig. 5A). More importantly PKCδ specific inhibitor Rottlerin also significantly reduced Ox-LDL induced IL-1β production (Fig. 5A). Previous studies had also suggested a role of PKCδ in IL-1β production from
16
Downloaded from www.jlr.org by guest, on November 20, 2014
increase in JNK2 phosphorylation after Ox-LDL treatment (Fig. 4A). Since further downstream
monocytes (18). On expected lines we did see a time dependent activation of PKCδ after Ox-LDL treatment (Fig. 5B). PKCδ activation was observed starting from 15 min up to 72 h and activation was maximum (~5fold) at 12 h, confirming that Ox-LDL treatment activates PKCδ (Fig. 5B). PKCδ specific siRNA significantly inhibited Ox-LDL induced IL-1β production (Fig. 5C). To test whether PKC and specific isoform δ feeds into the IRAK pathway, IRAK1 kinase assay was performed in THP-1 lysates obtained after Ox-LDL, Ro-31-8220, Go-6976 and Rottlerin treatment (Fig. 5D). We observed inhibition in Ox-LDL induced IRAK1 activity in Ro-31-8220 and Rottlerin pretreated THP-1 monocytic cells thus indicating a role of PKCδ in Ox-LDL induced IRAK1 activation (Fig. 5D). Since
reasonable to conclude that both classical PKC (PKCα and β) and non-classical PKC (PKCδ) activation contributes to Ox-LDL induced IL-1β production. However since IRAK1 activity is inhibited only by Ro-31-8220 and Rottlerin and not by Go-6976, it can be concluded that IRAK1 mainly mediates PKCδ induced IL-1 β production. This was further confirmed since a significant decrease in Ox-LDL induced IRAK1 phosphorylation was observed with PKCδ specific siRNA (Fig. 5E). PKCδ-IRAK1 axis activates JNK1-AP-1 pathway during Ox-LDL induced IL-1β production Although we did observe activation of PKCδ -IRAK1 and JNK-AP-1 axis during Ox-LDL induced IL1β production, experiments were performed to test whether PKCδ-IRAK pathway feeds into the JNKAP-1 axis during Ox-LDL induced IL-1β production. Ox-LDL induced JNK-AP-1 axis activation was evaluated in the presence of Rottlerin and IRAK1/4 inhibitor. JNK activation was monitored at 15 min of Ox-LDL stimulation after pretreatment of Rottlerin, IRAK1/4 inhibitor (Fig. 6A) and PKCδ siRNA (Fig. 6B). Significant inhibition in JNK phosphorylation was observed in presence of these inhibitors and PKCδ siRNA thus indicating that PKCδ-IRAK1 axis feeds into JNK pathway. Since AP-1 inhibition by Tanshinone IIa also inhibits Ox-LDL induced IL-1β production, we determined the AP-1 level at 30 min
17
Downloaded from www.jlr.org by guest, on November 20, 2014
Rottlerin also significantly attenuated Ox-LDL induced secretory IL-1β production (Fig. 5A), it is quite
of Ox-LDL stimulation in Rottlerin, IRAK1/4 INH, JNK INH II and PKCδ siRNA pretreated THP1 cells (Fig. 6C). Significant inhibition in Ox-LDL induced AP-1 activity by these inhibitors and PKCδ siRNA indicates that PKCδ induced IL-1β production involves PKCδ-IRAK1-JNK-AP-1 axis. In primary human monocytes also Ox-LDL induced time dependent PKCδ phosphorylation (Fig. 6D). A trend of increase in PKCδ phosphorylation was observed from as early as 5min of Ox-LDL treatment and a significant increase was observed from 15min of treatment. The increase in PKCδ phosphorylation was sustained till the last point of analysis. Ox-LDL significantly enhanced IL-1β production in primary human monocytes while LDL had no significant effect (Fig. 6E). Rottlerin (Fig. 6E) and PKCδ siRNA
(Fig. 6E and 6F respectively). Role of CD36, TLR in Ox-LDL induced IL-1β production To explore the involvement of CD36 and TLRs in Ox-LDL induced IL-1β production, THP-1 cells were pretreated with TLR6, 4, 2 and CD36 siRNA and subsequently stimulated with Ox-LDL. TLR6, 4, 2 and CD36 specific siRNA significantly reduced respective protein expression (~1.4, 1.5, 1.3 and 1.5 fold, Fig. S2A-D). Moreover, treatment with TLR6, 4, 2 and CD36 siRNA significantly prevented Ox-LDL induced PKCδ phosphorylation (~1.5, 1.5, 1.7 and 1.3 fold respectively, Fig. 7A), IRAK1 activation (~1.6, 1.5, 1.3 and 1.3 fold respectively, Fig. 7B) and IL-1β production (~1.4, 1.2, 1.3 and 1.3 fold respectively) in THP-1 cells (Fig. 7C). Further, we explored the role of CD36 and TLRs in Ox-LDL induced PKCδ, IRAK1 activation and IL1β production in THP-1 monocyte derived macrophages. Ox-LDL enhanced PKCδ (~3.3 fold, Fig. S3A), IRAK1 (~2.8 fold, Fig. S3B) phosphorylation and IL-1β (~14 fold, Fig. S3C) production in THP1 macrophages (Fig. S3).
18
Downloaded from www.jlr.org by guest, on November 20, 2014
(Fig. 6F) pretreatment significantly attenuated Ox-LDL induced IL-1β production in these cells as well
Treatment with TLR6, 4, 2, CD36 and PKCδ siRNA significantly reduced respective protein expression (~1.3, 1.3, 1.3, 2 and 1.8 fold Fig. S4A-E) and Ox-LDL induced PKCδ phosphorylation (~2.8, 1.7, 1.7 and 1.7 fold respectively, Fig. S5A), IRAK1 activation (~1.6, 1.6, 2, 2 and 1.3 fold respectively, Fig. S5B) and IL-1β production (~1.4, 1.3, 1.3, 1.6 and 1.3 fold respectively, Fig. S5C) in THP-1 macrophages. Interestingly PKCδ siRNA significantly reduced Ox-LDL induced CD36 up-regulation, indicating a positive feedback of the kinase on the receptor (Fig. S5D). Elevated Ox-LDL and IL-1β in SIRS patients
Patient demographic characteristics including heart rate, mean arterial pressure and disease severity scores (SOFA and APACHE II) are listed in Table 1. A significant increase in the circulating Ox-LDL (p
