Atherosclerosis 242 (2015) 77e86
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
Plasma cholesterol-lowering activity of dietary dihydrocholesterol in hypercholesterolemia hamsters Xiaobo Wang a, Lei Guan b, Youyou Zhao b, Lin Lei a, Yuwei Liu a, Ka Ying Ma a, Lijun Wang a, Sun Wa Man a, Junkuan Wang b, Yu Huang c, Zhen-Yu Chen a, * a b c
Food & Nutritional Sciences Programme, School of Life Sciences, The Chinese University of Hong Kong, Shatin, NT, Hong Kong, China R&D, Nestle, Beijing 100022, China School of Biomedical Sciences, Chinese University of Hong Kong, Shatin, NT, Hong Kong, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 February 2015 Received in revised form 19 June 2015 Accepted 22 June 2015 Available online 27 June 2015
Objective: Cholesterol analogs have been used to treat hypercholesterolemia. The present study was to examine the effect of dihydrocholesterol (DC) on plasma total cholesterol (TC) compared with that of bsitosterol (SI) in hamsters fed a high cholesterol diet. Methods and Results: Forty-five male hamsters were randomly divided into 6 groups, fed either a noncholesterol diet (NCD) or one of five high-cholesterol diets without addition of DC and SI (HCD) or with addition of 0.2% DC (DA), 0.3% DC (DB), 0.2% SI (SA), and 0.3% SI (SB), respectively, for 6 weeks. Results showed that DC added into diet at a dose of 0.2% could reduce plasma TC by 21%, comparable to that of SI (19%). At a higher dose of 0.3%, DC reduced plasma TC by 15%, less effective than SI (32%). Both DC and SI could increase the excretion of fecal sterols, however, DC was more effective in increasing the excretion of neutral sterols but it was less effective in increasing the excretion of acidic sterols compared with SI. Results on the incorporation of sterols in micellar solutions clearly demonstrated both DC and SI could displace the cholesterol from micelles with the former being more effective than the latter. Conclusion: DC was equally effective in reducing plasma cholesterol as SI at a low dose. Plasma TClowering activity of DC was mediated by inhibiting the cholesterol absorption and increasing the fecal sterol excretion. © 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: 5a-cholestanol Cholesterol b-sitosterol Sterol
1. Introduction Coronary heart disease (CHD) is the number one killer in the world. Elevated concentrations of plasma total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) are considered as the major risk factors for CHD. One of pharmaceutical approaches to reduce plasma TC and LDL-C concentrations is to inhibit the
Abbreviations: ABCG5/8, ATP-binding cassette transporters sub-family G member 5 and 8; ACAT2, acyl-CoA: cholesterol acyltransferase 2; CYP7A1, cholesterol-7a-hydroxylase; DC, dihydrocholesterol; HDL-C, high density lipoprotein cholesterol; HMGR, 3-hydroxy-3-methylglutaryl CoA reductase; LDLR, low-density lipoprotein receptor; LXRa, Liver receptor alpha; MTP, microsomal triacylglycerol transport protein; non-HDL-C, non-high density lipoprotein cholesterol; NPC1L1, Niemann-Pick C1 like 1 protein; SI, b-sitosterol; SREBP2, sterol regulatory elementbinding protein 2; TC, total cholesterol; TG, triacylglycerols. * Corresponding author. School of life Sciences, Chinese University of Hong Kong, Hong Kong, China. E-mail address: [email protected] (Z.-Y. Chen). http://dx.doi.org/10.1016/j.atherosclerosis.2015.06.046 0021-9150/© 2015 Elsevier Ireland Ltd. All rights reserved.
cholesterol absorption in the intestine. In this regard, about 1200 mg cholesterol daily enters the lumen of the small intestine with 300 mg coming from the diet and the rest deriving from bile [1,2]. Absorption of sterols in the intestine is a function of their structures. In general, absorption of cholesterol can reach more than 50%, while that of plant sterols is less than 5% [3e5]. Plant sterols are analogs of cholesterol and have side chains different from that of cholesterol. Due to their poor absorption and structural similarity with cholesterol, plant sterols as a health supplement are very effective in reducing plasma TC and LDL-C, mediated by their strong inhibition on cholesterol absorption in the intestine [6]. It has been suggested to take 2 g plant sterols daily as a therapeutic option to lower TC and LDL-C by 6e15% in hypercholesterolemia patients [7]. Dihydrocholesterol (DC), also called 5a-cholestanol, is a cholesterol analog. DC has a same side chain as cholesterol, but it has no double bond at the D5 position in B-ring (Fig. 1). Natural DC can be produced at least by the following three routes. First,
78
X. Wang et al. / Atherosclerosis 242 (2015) 77e86 Table 1 Diet composition of non-cholesterol diet (NCD), high-cholesterol diet (HCD), and four experimental diets supplemented with 0.2% dihydrocholesterol (DA), 0.3% dihydrocholesterol (DB), 0.2% b-sitosterol (SA) and 0.3% b-sitosterol (SB), respectively.
Fig. 1. Structures of cholesterol (A) and dihydrocholesterol (B).
unabsorbed cholesterol in the lumen of large intestine is biohydrogenated to form DC and coprostanol via the action of microbial enzymes [8]. Second, in environment, particularly in the anaerobic reducing sediments, bacteria can convert some cholesterol to DC [9]. Third, DC is synthesized in vivo via a pathway with 7 alpha-hydroxylated C27-steroids being as substrates in the liver [10]. Similar to plant sterols, DC is also poorly absorbed, having an absorption rate less than 3.3% [11]. This arouses our interest to study whether DC would possess a plasma TC - lowering activity like plant sterols. The present study was to (i) study plasma TC - lowering activity of DC compared with that of b-sitosterol (SI), the major plant sterol, in hypercholesterolemia hamsters; and (ii) examine the effects of DC on the gene expression of sterol transporters, proteins, enzymes, and receptors involved in cholesterol absorption and metabolism. These include intestinal Niemann-Pick C1 like 1 protein (NPC1L1), acyl-CoA: cholesterol acyltransferase 2 (ACAT2), microsomal triacylglycerol transport protein (MTP) and ATPbinding cassette transporters sub-family G member 5 and 8 (ABCG5/8), as well as liver sterol regulatory element-binding protein 2 (SREBP-2), 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), low-density lipoprotein receptor (LDLR), Liver receptor alpha (LXRa), and cholesterol-7a-hydroxylase (CYP7A1). 2. Methods and materials 2.1. Diets Six diets were prepared (Table 1). The non-cholesterol diet (NCD) was prepared by mixing the following ingredients: 508 g corn starch, 242 g casein, 119 g sucrose, 50 g lard, 40 g mineral mix, 20 g vitamin mix, 1 g DL-methionine. The high cholesterol control diet (HCD) was prepared by adding 0.2% cholesterol (w/w) into NCD. The other four experimental diets were prepared by adding 0.2% DC (DA), 0.3% DC (DB), 0.2% SI (SA) and 0.3% SI (SB) into the HCD diet, respectively. 2.2. Hamsters Forty-five male Golden Syrian hamsters (3 months, body weights ¼ 100e120 g) were randomly divided into six groups
Ingredients (g)
NCD
HCD
DA
DB
SA
SB
Corn starch Casein Sucrose Lard Mineral mixture AIN-76 Vitamin mixture AIN-76A Gelatin DL-methionine Cholesterol Dihydrocholesterol b-Sitosterol
508 242 119 50 40 20 20 1 0 0 0
508 242 119 50 40 20 20 1 2 0 0
508 242 119 50 40 20 20 1 2 2 0
508 242 119 50 40 20 20 1 2 3 0
508 242 119 50 40 20 20 1 2 0 2
508 242 119 50 40 20 20 1 2 0 3
(n ¼ 7 for NCD, HCD and DB, n ¼ 8 for DA, SA, and SB) and fed one of the six diets for 6 weeks. All hamsters with one per cage were housed in wire-bottomed cages at 23 C in an animal room with 12 h lightedark cycle. Diets and water were given ad libitum. All hamsters were weighed and their total fecal outputs per cage were collected weekly. After overnight fasting, 1 ml blood sample was obtained from the retro-orbital sinus and collected into a heparinized capillary tube under inhalational anesthesia of isoflurane (100%) at the beginning of week 1 and the end of week 6. Following the last blood sampling, all hamsters were sacrificed by carbon dioxide suffocation. The liver, heart, kidney, epididymal and perirenal adipose tissues were collected, washed in phosphate-buffered saline (PBS), and weighed. The first 5 cm of duodenum was discarded, and the next 30 cm of the small intestine was kept. All tissues were flash frozen in liquid nitrogen and stored at 80 C until analysis. Thoracic aorta was collected, and stored in PBS after connective tissues were cleaned off. The entire experimental procedure was approved by the Animal Experimental Ethical Committee, the Chinese University of Hong Kong (Ref No: 13/006/mis). 2.3. Analysis of plasma lipoproteins Plasma TC and total triacylglycerols (TG) were quantified using their respective commercial enzymatic kits (Infinity, Waltham, MA, USA and Stanbio Laboratories, Boerne, TX, USA.). To quantify plasma high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein and vey low-density lipoprotein cholesterol were firstly precipitated using a commercial kit containing phosphotungstic acid and magnesium chloride (Stanbio, Boerne, TX, USA). Following the centrifugation, HDL-C in the supernatant was measured as described for plasma TC. Non-HDL cholesterol (nonHDL-C) was calculated by reducing HDL-C from TC. It was found that DC in plasma could react with the enzymatic reagent with 1 mg being equivalent to that 0.137 mg of plasma cholesterol. Thus, GC analysis was performed to quantify % cholesterol (C) and % DC in plasma. Final plasma cholesterol reading was adjusted according to the following two equations: Factor (F) ¼ % C ÷ (% C þ 0.137 % DC); Adjusted TC ¼ Original TC F. 2.4. Measurement of atherosclerotic plaque The percentage area of atherosclerotic plaque in aorta was determined as previously described [12]. In brief, the thoracic aorta was cut opened vertically. The aortas were stained with saturated oil red (SigmaeAldrich, St. Louis, MO, USA) in isopropanol before scanning (Epson 1220 Perfection, Epson Co., Tokyo, Japan). The area of atherosclerotic plaque was measured with the aid of computer
X. Wang et al. / Atherosclerosis 242 (2015) 77e86
image analyzing program Sigma Scan Pro 5.0 (SPSS, Chicago, USA). 2.5. Determination of cholesterol and its derivatives in the liver Cholesterol in the liver was determined according to the method routinely used in this laboratory [12,13]. In brief, total lipids were extracted in chloroformemethanol (2:1, v/v) with addition of 0.5 mg of 5a-cholestane being as an internal standard. Total lipid extracts were then saponified in 5 ml of 1 M NaOH in 90% ethanol at 90 C for 1 h, and the non-saponified substances were extracted into cyclohexane, followed by converting cholesterol to its TMSether derivative by TMS in pyridine (1:2, v/v, SigmaeAldrich, St. Louis, MO, USA) for GC analysis. The analysis of cholesterol TMSether derivative was performed on a fused silica capillary column (SAC™-5, 30 m 0.25 mm, i. d.; Supelco, Bellefonte, USA) in a Shimadzu GC-14B equipped with a flame ionization detector. Cholesterol in the liver samples was calculated according to the amount of 5a-cholestane added. 2.6. Determination of fecal neutral and acidic sterols Neutral and acidic sterols in the feces were quantified according to a method as we previously described [14,15]. In brief, total fecal sample from each hamster was freeze-dried, ground and thoroughly mixed. 5a-Cholestane (0.5 mg) was added into 300 mg fecal samples as an internal standard for quantification of total neutral sterols. The samples were saponified in 9 ml of 1 M NaOH in 90% ethanol containing 0.6 mg hyodeoxycholic acid, which was an internal standard for quantification of total acidic sterols. The total neutral sterols were extracted into 8 ml cyclohexane and then converted to their corresponding TMS-ether derivatives at 60 C for GC analysis. The remaining aqueous layer was saved for the analysis of acidic sterols. To the aqueous phase, 1 ml of 10 M NaOH was added and heated at 120 C for 3 h. After the sample was cooled down to room temperature, 1 ml distilled water and 3 ml of 25% HCl were added followed by extraction with 7 ml of diethyl ether twice. The diethyl ether phase was then pooled and dried under a gentle stream of nitrogen gas, followed by adding 2 ml methanol, 2 ml dimethoxypropane and 40 ml of 37% HCl. After standing overnight at room temperature, the solvents were dried down and the acidic sterols were converted to their TMS-ether derivatives before GC analysis. 2.7. Western blotting of liver SREBP-2, LXRa, LDLR, HMGR, and CYP7A1 Primary antibodies of LXRa, CYP7A1, SREBP2, b-actin (200 mg/ml each) and all secondary antibodies (400 mg/ml each) were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA). Primary antibodies of LDLR and HMGR (1 mg/ml each) were purchased from
79
Merck Millipore (Billerica, MA, USA). Each antibody was diluted as follow: LXRa, 1:500; CYP7A1, 1:200, SREBP-2, 1:400; HMGR, 1:750, LDLR, 1:750; b-actin, 1:1000; anti-goat, 1:3000; anti-rabbit, 1:6000; anti-mouse, 1:2000. The frozen liver samples were homogenized in a buffer containing 20 mM TriseHCl (pH 7.5), 2 mM MgCl2, 0.2 M sucrose and Complete® protease inhibitor cocktail (Roche, Mannheim, Germany). The extract was centrifuged for 15 min at 4 C, the supernatant was collected and the resultant protein was considered as the total protein. A portion of the total protein was then centrifuged at 35,000 rpm for 1 h at 4 C. The pellet was saved, re-suspended in the homogenizing buffer, and the resultant protein was considered as total membrane protein. The protein concentration was determined using a protein concentration assay kit according to the manufacturer's instructions (Bio-Rad, Hercules, CA, USA). For the measurement of LXRa, CYP7A1, SREBP-2, HMGR and LDLR, 80 mg of membrane protein was size-fractionated on a 7% SDS-PAGE gel at 100 V for 1.5 h. The proteins were then transferred onto a PVDF membrane (Hybond-P, Amersham, Wauwatosa, WI, USA). The membrane was incubated for 1 h in blocking solution (3% non-fat milk in TBST) and then overnight in the same solution containing the primary antibody of each target protein. The membrane was then washed in TBST and incubated for 1 h at 4 C with the corresponding second antibody. The membrane was developed with ECL enhanced chemiluminescence agent (Amersham, Wauwatosa, WI, USA) and subjected to autoradiography on SuperRX medical X-ray film (Fuji, Tokyo, Japan). Densitometry was quantified using the BioRad Quantity One® (Bio-Rad, Hercules, CA, USA). Data on protein abundance were normalized with b-actin. 2.8. Real time PCR of hepatic SREBP-2, LDLR, HMGR, LXRa, CYP7A1 and small intestinal NPC1L1, ACAT2, MTP, ABCG5, ABCG8 mRNA Total mRNA levels in hepatic SREBP-2, LDLR, HMGR and CYP7A1 were quantified as previously described [15]. In brief, total RNA was extracted and converted to complementary DNA (cDNA) using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Reverse transcription was carried out in a thermocycler (Gene Amp ® PCR system 9700, Applied Biosystems), with a program set as initiation for 10 min at 25 C, followed by incubation at 50 C for 90 min and at 85 C for additional 5 min. The cDNA synthesized was stored at 20 C. Total small intestinal mRNA was similarly extracted and converted to its cDNA. Real-time PCR analysis was carried out on a Fast Real-time PCR System 7500 (Applied Biosystems) for both the hepatic and small intestinal genes. Primers and TaqMan® probes were applied in real-time PCR analysis of the liver GAPDH, CYP7A1, HMGR, LDLR, and SREBP (Table 2) in hamsters, whereas for the small intestinal NPC1L1, ABCG5, ABCG8, ACAT2, MTP and cyclophillin, SYBR green was used as a fluorophore. The reaction mixture was subjected to thermal cycling under the following conditions: heating up to 95 C in 20 s,
Table 2 Quantitative real-time PCR primers. Gene
Forward primer 50 30
Reverse primer 50 30
GAPDH CYP7A1 HMGR LDLR SREBP2 Cyclophilin NPC1L1 ACAT2 ABCG5 ABCG8 MTP
GAACATCATCCCTGCATCCA GGTAGTGTGCTGTTGTATATGGGTTA CGAAGGGTTTGCAGTGATAAAGGA GCCGGGACTGGTCAGATG GGACTTGGTCATGGGAACAGATG CATCCTAAAGCATACAGGTCCTG CCTGACCTTTATAGAACTCACCACAGA CCGAGATGCTTCGATTTGGA TGATTGGCAGCTATAATTTTGGG TGCTGGCCATCATAGGGAG GTCAGGAAGCTGTGTCAGAATG
CCAGTGAGCTTCCCGTTCA ACAGCCCAGGTATGGAATCAAC GCCATAGTCACATGAAGCTTCTGTA ACAGCCACCATTGTTGTCCA TGTAATCAATGGCCTTCCTCAGAAC TCCATGGCTTCCACAATGTT GGGCCAAAATGCTCGTCAT GTGCGGTAGTAGTTGGAGAAGGA GTTGGGCTGCGATGGAAA TCCTGATTTCATCTTGCCACC CTCCTTTTTCTCTGGCTTTTCA
80
X. Wang et al. / Atherosclerosis 242 (2015) 77e86
followed by 40 cycles at 95 C for 3 s and 60 C for 30 s. Data were analyzed using the Sequence Detection Software version 1.3.1.21 (Applied Biosystems, Foster City, CA, USA). Gene expressions were calculated according to the comparative Threshold cycle (CT) method.
ultracentrifuged at 100,000 g for 1 h at 37 C. The bottom precipitate was discarded. The amount of cholesterol, DC and SI in the upper clear micellar phase was extracted and measured using the GC method described in Section 2.5. 2.10. Statistics
2.9. Effect of DC and SI on incorporation of cholesterol into micelles in vitro The basal micellar solution was prepared by mixing taurocholate acid (5 mM), oleic acid (0.39 mM) and monoolein (0.11 mM) into 15 mM sodium phosphate buffer (pH ¼ 7.4) containing 132 mM NaCl according to the method described by Pat et al. [16]. To evaluate the effects of DC or SI on incorporation of cholesterol in micelles, four micellar solutions were prepared by mixing 0.25e5.0 mM sterols into basal micellar solutions: CL, micellar solution 1 containing 0.25 mM cholesterol; CH, micellar solution 2 containing 0.50 mM cholesterol; CD, micellar solution 3 containing 0.25 mM cholesterol and 0.25 mM DC; CS micellar solution 4 containing 0.25 mM cholesterol and 0.25 mM SI. CL served as a control solution under the condition of same concentration of cholesterol (0.25 mM), while CH was a control solution under the condition of same concentration of total sterols (0.5 mM). The four micellar solutions were sonicated at 37 C for 30 min and then
Data were expressed as mean ± standard deviation (SD). The two-way analysis of variance (ANOVA), with sterol types (DC and SI) and doses (0.2 and 0.3%) being as two variables, were conducted to statistically detect the significant differences among the five groups of HCD, DA, DB, SA and SB. Following the ANOVA, post hoc LSD test was carried out to detect the significant differences between the two groups using the Statistical program (IBM SPSS 19.0, Chicago, USA). Significance was defined as p value less than 0.05. 3. Result 3.1. Food intake, body and organ weights No differences in food intake, initial and final body weights were observed among the six groups (Table 3). When organs were expressed as a percentage of total body weight, no significant difference in relative weights of heart, testis and perirenal fat pad was
Table 3 Changes in food intake, body and relative organ weights in hamsters fed the non-cholesterol diet (NCD), high-cholesterol diet (HCD), and one of the four high-cholesterol diets supplemented with 0.2% dihydrocholesterol (DA), 0.3% dihydrocholesterol (DB), 0.2% b-sitosterol (SA) and 0.3% b-sitosterol (SB), repectively. NCD
HCD
DA
DB
SA
SB
p value (dose)
Daily food intake (g/ 10.99 ± 0.77 10.55 ± 0.57 9.79 ± 0.67 10.30 ± 1.02 10.71 ± 1.20 10.56 ± 0.79 0.645 hamster) Body weight (g) Initial 107.71 ± 7.57 108.14 ± 9.27 101.25 ± 5.80 104.00 ± 8.23 103.88 ± 5.00 104.38 ± 6.61 0.278 Final 116.43 ± 7.76 120.43 ± 11.93 115.38 ± 9.02 115.43 ± 7.0 118.43 ± 13.74 112.00 ± 8.05 0.692 Relative organ weight (% body weight) Liver 3.88 ± 0.66 bc 5.36 ± 0.28 a 4.30 ± 0.28 b 4.63 ± 0.28 b 4.36 ± 0.7 b 4.20 ± 0.48 b
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
Plasma cholesterol-lowering activity of dietary dihydrocholesterol in hypercholesterolemia hamsters Xiaobo Wang a, Lei Guan b, Youyou Zhao b, Lin Lei a, Yuwei Liu a, Ka Ying Ma a, Lijun Wang a, Sun Wa Man a, Junkuan Wang b, Yu Huang c, Zhen-Yu Chen a, * a b c
Food & Nutritional Sciences Programme, School of Life Sciences, The Chinese University of Hong Kong, Shatin, NT, Hong Kong, China R&D, Nestle, Beijing 100022, China School of Biomedical Sciences, Chinese University of Hong Kong, Shatin, NT, Hong Kong, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 February 2015 Received in revised form 19 June 2015 Accepted 22 June 2015 Available online 27 June 2015
Objective: Cholesterol analogs have been used to treat hypercholesterolemia. The present study was to examine the effect of dihydrocholesterol (DC) on plasma total cholesterol (TC) compared with that of bsitosterol (SI) in hamsters fed a high cholesterol diet. Methods and Results: Forty-five male hamsters were randomly divided into 6 groups, fed either a noncholesterol diet (NCD) or one of five high-cholesterol diets without addition of DC and SI (HCD) or with addition of 0.2% DC (DA), 0.3% DC (DB), 0.2% SI (SA), and 0.3% SI (SB), respectively, for 6 weeks. Results showed that DC added into diet at a dose of 0.2% could reduce plasma TC by 21%, comparable to that of SI (19%). At a higher dose of 0.3%, DC reduced plasma TC by 15%, less effective than SI (32%). Both DC and SI could increase the excretion of fecal sterols, however, DC was more effective in increasing the excretion of neutral sterols but it was less effective in increasing the excretion of acidic sterols compared with SI. Results on the incorporation of sterols in micellar solutions clearly demonstrated both DC and SI could displace the cholesterol from micelles with the former being more effective than the latter. Conclusion: DC was equally effective in reducing plasma cholesterol as SI at a low dose. Plasma TClowering activity of DC was mediated by inhibiting the cholesterol absorption and increasing the fecal sterol excretion. © 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: 5a-cholestanol Cholesterol b-sitosterol Sterol
1. Introduction Coronary heart disease (CHD) is the number one killer in the world. Elevated concentrations of plasma total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) are considered as the major risk factors for CHD. One of pharmaceutical approaches to reduce plasma TC and LDL-C concentrations is to inhibit the
Abbreviations: ABCG5/8, ATP-binding cassette transporters sub-family G member 5 and 8; ACAT2, acyl-CoA: cholesterol acyltransferase 2; CYP7A1, cholesterol-7a-hydroxylase; DC, dihydrocholesterol; HDL-C, high density lipoprotein cholesterol; HMGR, 3-hydroxy-3-methylglutaryl CoA reductase; LDLR, low-density lipoprotein receptor; LXRa, Liver receptor alpha; MTP, microsomal triacylglycerol transport protein; non-HDL-C, non-high density lipoprotein cholesterol; NPC1L1, Niemann-Pick C1 like 1 protein; SI, b-sitosterol; SREBP2, sterol regulatory elementbinding protein 2; TC, total cholesterol; TG, triacylglycerols. * Corresponding author. School of life Sciences, Chinese University of Hong Kong, Hong Kong, China. E-mail address: [email protected] (Z.-Y. Chen). http://dx.doi.org/10.1016/j.atherosclerosis.2015.06.046 0021-9150/© 2015 Elsevier Ireland Ltd. All rights reserved.
cholesterol absorption in the intestine. In this regard, about 1200 mg cholesterol daily enters the lumen of the small intestine with 300 mg coming from the diet and the rest deriving from bile [1,2]. Absorption of sterols in the intestine is a function of their structures. In general, absorption of cholesterol can reach more than 50%, while that of plant sterols is less than 5% [3e5]. Plant sterols are analogs of cholesterol and have side chains different from that of cholesterol. Due to their poor absorption and structural similarity with cholesterol, plant sterols as a health supplement are very effective in reducing plasma TC and LDL-C, mediated by their strong inhibition on cholesterol absorption in the intestine [6]. It has been suggested to take 2 g plant sterols daily as a therapeutic option to lower TC and LDL-C by 6e15% in hypercholesterolemia patients [7]. Dihydrocholesterol (DC), also called 5a-cholestanol, is a cholesterol analog. DC has a same side chain as cholesterol, but it has no double bond at the D5 position in B-ring (Fig. 1). Natural DC can be produced at least by the following three routes. First,
78
X. Wang et al. / Atherosclerosis 242 (2015) 77e86 Table 1 Diet composition of non-cholesterol diet (NCD), high-cholesterol diet (HCD), and four experimental diets supplemented with 0.2% dihydrocholesterol (DA), 0.3% dihydrocholesterol (DB), 0.2% b-sitosterol (SA) and 0.3% b-sitosterol (SB), respectively.
Fig. 1. Structures of cholesterol (A) and dihydrocholesterol (B).
unabsorbed cholesterol in the lumen of large intestine is biohydrogenated to form DC and coprostanol via the action of microbial enzymes [8]. Second, in environment, particularly in the anaerobic reducing sediments, bacteria can convert some cholesterol to DC [9]. Third, DC is synthesized in vivo via a pathway with 7 alpha-hydroxylated C27-steroids being as substrates in the liver [10]. Similar to plant sterols, DC is also poorly absorbed, having an absorption rate less than 3.3% [11]. This arouses our interest to study whether DC would possess a plasma TC - lowering activity like plant sterols. The present study was to (i) study plasma TC - lowering activity of DC compared with that of b-sitosterol (SI), the major plant sterol, in hypercholesterolemia hamsters; and (ii) examine the effects of DC on the gene expression of sterol transporters, proteins, enzymes, and receptors involved in cholesterol absorption and metabolism. These include intestinal Niemann-Pick C1 like 1 protein (NPC1L1), acyl-CoA: cholesterol acyltransferase 2 (ACAT2), microsomal triacylglycerol transport protein (MTP) and ATPbinding cassette transporters sub-family G member 5 and 8 (ABCG5/8), as well as liver sterol regulatory element-binding protein 2 (SREBP-2), 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), low-density lipoprotein receptor (LDLR), Liver receptor alpha (LXRa), and cholesterol-7a-hydroxylase (CYP7A1). 2. Methods and materials 2.1. Diets Six diets were prepared (Table 1). The non-cholesterol diet (NCD) was prepared by mixing the following ingredients: 508 g corn starch, 242 g casein, 119 g sucrose, 50 g lard, 40 g mineral mix, 20 g vitamin mix, 1 g DL-methionine. The high cholesterol control diet (HCD) was prepared by adding 0.2% cholesterol (w/w) into NCD. The other four experimental diets were prepared by adding 0.2% DC (DA), 0.3% DC (DB), 0.2% SI (SA) and 0.3% SI (SB) into the HCD diet, respectively. 2.2. Hamsters Forty-five male Golden Syrian hamsters (3 months, body weights ¼ 100e120 g) were randomly divided into six groups
Ingredients (g)
NCD
HCD
DA
DB
SA
SB
Corn starch Casein Sucrose Lard Mineral mixture AIN-76 Vitamin mixture AIN-76A Gelatin DL-methionine Cholesterol Dihydrocholesterol b-Sitosterol
508 242 119 50 40 20 20 1 0 0 0
508 242 119 50 40 20 20 1 2 0 0
508 242 119 50 40 20 20 1 2 2 0
508 242 119 50 40 20 20 1 2 3 0
508 242 119 50 40 20 20 1 2 0 2
508 242 119 50 40 20 20 1 2 0 3
(n ¼ 7 for NCD, HCD and DB, n ¼ 8 for DA, SA, and SB) and fed one of the six diets for 6 weeks. All hamsters with one per cage were housed in wire-bottomed cages at 23 C in an animal room with 12 h lightedark cycle. Diets and water were given ad libitum. All hamsters were weighed and their total fecal outputs per cage were collected weekly. After overnight fasting, 1 ml blood sample was obtained from the retro-orbital sinus and collected into a heparinized capillary tube under inhalational anesthesia of isoflurane (100%) at the beginning of week 1 and the end of week 6. Following the last blood sampling, all hamsters were sacrificed by carbon dioxide suffocation. The liver, heart, kidney, epididymal and perirenal adipose tissues were collected, washed in phosphate-buffered saline (PBS), and weighed. The first 5 cm of duodenum was discarded, and the next 30 cm of the small intestine was kept. All tissues were flash frozen in liquid nitrogen and stored at 80 C until analysis. Thoracic aorta was collected, and stored in PBS after connective tissues were cleaned off. The entire experimental procedure was approved by the Animal Experimental Ethical Committee, the Chinese University of Hong Kong (Ref No: 13/006/mis). 2.3. Analysis of plasma lipoproteins Plasma TC and total triacylglycerols (TG) were quantified using their respective commercial enzymatic kits (Infinity, Waltham, MA, USA and Stanbio Laboratories, Boerne, TX, USA.). To quantify plasma high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein and vey low-density lipoprotein cholesterol were firstly precipitated using a commercial kit containing phosphotungstic acid and magnesium chloride (Stanbio, Boerne, TX, USA). Following the centrifugation, HDL-C in the supernatant was measured as described for plasma TC. Non-HDL cholesterol (nonHDL-C) was calculated by reducing HDL-C from TC. It was found that DC in plasma could react with the enzymatic reagent with 1 mg being equivalent to that 0.137 mg of plasma cholesterol. Thus, GC analysis was performed to quantify % cholesterol (C) and % DC in plasma. Final plasma cholesterol reading was adjusted according to the following two equations: Factor (F) ¼ % C ÷ (% C þ 0.137 % DC); Adjusted TC ¼ Original TC F. 2.4. Measurement of atherosclerotic plaque The percentage area of atherosclerotic plaque in aorta was determined as previously described [12]. In brief, the thoracic aorta was cut opened vertically. The aortas were stained with saturated oil red (SigmaeAldrich, St. Louis, MO, USA) in isopropanol before scanning (Epson 1220 Perfection, Epson Co., Tokyo, Japan). The area of atherosclerotic plaque was measured with the aid of computer
X. Wang et al. / Atherosclerosis 242 (2015) 77e86
image analyzing program Sigma Scan Pro 5.0 (SPSS, Chicago, USA). 2.5. Determination of cholesterol and its derivatives in the liver Cholesterol in the liver was determined according to the method routinely used in this laboratory [12,13]. In brief, total lipids were extracted in chloroformemethanol (2:1, v/v) with addition of 0.5 mg of 5a-cholestane being as an internal standard. Total lipid extracts were then saponified in 5 ml of 1 M NaOH in 90% ethanol at 90 C for 1 h, and the non-saponified substances were extracted into cyclohexane, followed by converting cholesterol to its TMSether derivative by TMS in pyridine (1:2, v/v, SigmaeAldrich, St. Louis, MO, USA) for GC analysis. The analysis of cholesterol TMSether derivative was performed on a fused silica capillary column (SAC™-5, 30 m 0.25 mm, i. d.; Supelco, Bellefonte, USA) in a Shimadzu GC-14B equipped with a flame ionization detector. Cholesterol in the liver samples was calculated according to the amount of 5a-cholestane added. 2.6. Determination of fecal neutral and acidic sterols Neutral and acidic sterols in the feces were quantified according to a method as we previously described [14,15]. In brief, total fecal sample from each hamster was freeze-dried, ground and thoroughly mixed. 5a-Cholestane (0.5 mg) was added into 300 mg fecal samples as an internal standard for quantification of total neutral sterols. The samples were saponified in 9 ml of 1 M NaOH in 90% ethanol containing 0.6 mg hyodeoxycholic acid, which was an internal standard for quantification of total acidic sterols. The total neutral sterols were extracted into 8 ml cyclohexane and then converted to their corresponding TMS-ether derivatives at 60 C for GC analysis. The remaining aqueous layer was saved for the analysis of acidic sterols. To the aqueous phase, 1 ml of 10 M NaOH was added and heated at 120 C for 3 h. After the sample was cooled down to room temperature, 1 ml distilled water and 3 ml of 25% HCl were added followed by extraction with 7 ml of diethyl ether twice. The diethyl ether phase was then pooled and dried under a gentle stream of nitrogen gas, followed by adding 2 ml methanol, 2 ml dimethoxypropane and 40 ml of 37% HCl. After standing overnight at room temperature, the solvents were dried down and the acidic sterols were converted to their TMS-ether derivatives before GC analysis. 2.7. Western blotting of liver SREBP-2, LXRa, LDLR, HMGR, and CYP7A1 Primary antibodies of LXRa, CYP7A1, SREBP2, b-actin (200 mg/ml each) and all secondary antibodies (400 mg/ml each) were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA). Primary antibodies of LDLR and HMGR (1 mg/ml each) were purchased from
79
Merck Millipore (Billerica, MA, USA). Each antibody was diluted as follow: LXRa, 1:500; CYP7A1, 1:200, SREBP-2, 1:400; HMGR, 1:750, LDLR, 1:750; b-actin, 1:1000; anti-goat, 1:3000; anti-rabbit, 1:6000; anti-mouse, 1:2000. The frozen liver samples were homogenized in a buffer containing 20 mM TriseHCl (pH 7.5), 2 mM MgCl2, 0.2 M sucrose and Complete® protease inhibitor cocktail (Roche, Mannheim, Germany). The extract was centrifuged for 15 min at 4 C, the supernatant was collected and the resultant protein was considered as the total protein. A portion of the total protein was then centrifuged at 35,000 rpm for 1 h at 4 C. The pellet was saved, re-suspended in the homogenizing buffer, and the resultant protein was considered as total membrane protein. The protein concentration was determined using a protein concentration assay kit according to the manufacturer's instructions (Bio-Rad, Hercules, CA, USA). For the measurement of LXRa, CYP7A1, SREBP-2, HMGR and LDLR, 80 mg of membrane protein was size-fractionated on a 7% SDS-PAGE gel at 100 V for 1.5 h. The proteins were then transferred onto a PVDF membrane (Hybond-P, Amersham, Wauwatosa, WI, USA). The membrane was incubated for 1 h in blocking solution (3% non-fat milk in TBST) and then overnight in the same solution containing the primary antibody of each target protein. The membrane was then washed in TBST and incubated for 1 h at 4 C with the corresponding second antibody. The membrane was developed with ECL enhanced chemiluminescence agent (Amersham, Wauwatosa, WI, USA) and subjected to autoradiography on SuperRX medical X-ray film (Fuji, Tokyo, Japan). Densitometry was quantified using the BioRad Quantity One® (Bio-Rad, Hercules, CA, USA). Data on protein abundance were normalized with b-actin. 2.8. Real time PCR of hepatic SREBP-2, LDLR, HMGR, LXRa, CYP7A1 and small intestinal NPC1L1, ACAT2, MTP, ABCG5, ABCG8 mRNA Total mRNA levels in hepatic SREBP-2, LDLR, HMGR and CYP7A1 were quantified as previously described [15]. In brief, total RNA was extracted and converted to complementary DNA (cDNA) using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Reverse transcription was carried out in a thermocycler (Gene Amp ® PCR system 9700, Applied Biosystems), with a program set as initiation for 10 min at 25 C, followed by incubation at 50 C for 90 min and at 85 C for additional 5 min. The cDNA synthesized was stored at 20 C. Total small intestinal mRNA was similarly extracted and converted to its cDNA. Real-time PCR analysis was carried out on a Fast Real-time PCR System 7500 (Applied Biosystems) for both the hepatic and small intestinal genes. Primers and TaqMan® probes were applied in real-time PCR analysis of the liver GAPDH, CYP7A1, HMGR, LDLR, and SREBP (Table 2) in hamsters, whereas for the small intestinal NPC1L1, ABCG5, ABCG8, ACAT2, MTP and cyclophillin, SYBR green was used as a fluorophore. The reaction mixture was subjected to thermal cycling under the following conditions: heating up to 95 C in 20 s,
Table 2 Quantitative real-time PCR primers. Gene
Forward primer 50 30
Reverse primer 50 30
GAPDH CYP7A1 HMGR LDLR SREBP2 Cyclophilin NPC1L1 ACAT2 ABCG5 ABCG8 MTP
GAACATCATCCCTGCATCCA GGTAGTGTGCTGTTGTATATGGGTTA CGAAGGGTTTGCAGTGATAAAGGA GCCGGGACTGGTCAGATG GGACTTGGTCATGGGAACAGATG CATCCTAAAGCATACAGGTCCTG CCTGACCTTTATAGAACTCACCACAGA CCGAGATGCTTCGATTTGGA TGATTGGCAGCTATAATTTTGGG TGCTGGCCATCATAGGGAG GTCAGGAAGCTGTGTCAGAATG
CCAGTGAGCTTCCCGTTCA ACAGCCCAGGTATGGAATCAAC GCCATAGTCACATGAAGCTTCTGTA ACAGCCACCATTGTTGTCCA TGTAATCAATGGCCTTCCTCAGAAC TCCATGGCTTCCACAATGTT GGGCCAAAATGCTCGTCAT GTGCGGTAGTAGTTGGAGAAGGA GTTGGGCTGCGATGGAAA TCCTGATTTCATCTTGCCACC CTCCTTTTTCTCTGGCTTTTCA
80
X. Wang et al. / Atherosclerosis 242 (2015) 77e86
followed by 40 cycles at 95 C for 3 s and 60 C for 30 s. Data were analyzed using the Sequence Detection Software version 1.3.1.21 (Applied Biosystems, Foster City, CA, USA). Gene expressions were calculated according to the comparative Threshold cycle (CT) method.
ultracentrifuged at 100,000 g for 1 h at 37 C. The bottom precipitate was discarded. The amount of cholesterol, DC and SI in the upper clear micellar phase was extracted and measured using the GC method described in Section 2.5. 2.10. Statistics
2.9. Effect of DC and SI on incorporation of cholesterol into micelles in vitro The basal micellar solution was prepared by mixing taurocholate acid (5 mM), oleic acid (0.39 mM) and monoolein (0.11 mM) into 15 mM sodium phosphate buffer (pH ¼ 7.4) containing 132 mM NaCl according to the method described by Pat et al. [16]. To evaluate the effects of DC or SI on incorporation of cholesterol in micelles, four micellar solutions were prepared by mixing 0.25e5.0 mM sterols into basal micellar solutions: CL, micellar solution 1 containing 0.25 mM cholesterol; CH, micellar solution 2 containing 0.50 mM cholesterol; CD, micellar solution 3 containing 0.25 mM cholesterol and 0.25 mM DC; CS micellar solution 4 containing 0.25 mM cholesterol and 0.25 mM SI. CL served as a control solution under the condition of same concentration of cholesterol (0.25 mM), while CH was a control solution under the condition of same concentration of total sterols (0.5 mM). The four micellar solutions were sonicated at 37 C for 30 min and then
Data were expressed as mean ± standard deviation (SD). The two-way analysis of variance (ANOVA), with sterol types (DC and SI) and doses (0.2 and 0.3%) being as two variables, were conducted to statistically detect the significant differences among the five groups of HCD, DA, DB, SA and SB. Following the ANOVA, post hoc LSD test was carried out to detect the significant differences between the two groups using the Statistical program (IBM SPSS 19.0, Chicago, USA). Significance was defined as p value less than 0.05. 3. Result 3.1. Food intake, body and organ weights No differences in food intake, initial and final body weights were observed among the six groups (Table 3). When organs were expressed as a percentage of total body weight, no significant difference in relative weights of heart, testis and perirenal fat pad was
Table 3 Changes in food intake, body and relative organ weights in hamsters fed the non-cholesterol diet (NCD), high-cholesterol diet (HCD), and one of the four high-cholesterol diets supplemented with 0.2% dihydrocholesterol (DA), 0.3% dihydrocholesterol (DB), 0.2% b-sitosterol (SA) and 0.3% b-sitosterol (SB), repectively. NCD
HCD
DA
DB
SA
SB
p value (dose)
Daily food intake (g/ 10.99 ± 0.77 10.55 ± 0.57 9.79 ± 0.67 10.30 ± 1.02 10.71 ± 1.20 10.56 ± 0.79 0.645 hamster) Body weight (g) Initial 107.71 ± 7.57 108.14 ± 9.27 101.25 ± 5.80 104.00 ± 8.23 103.88 ± 5.00 104.38 ± 6.61 0.278 Final 116.43 ± 7.76 120.43 ± 11.93 115.38 ± 9.02 115.43 ± 7.0 118.43 ± 13.74 112.00 ± 8.05 0.692 Relative organ weight (% body weight) Liver 3.88 ± 0.66 bc 5.36 ± 0.28 a 4.30 ± 0.28 b 4.63 ± 0.28 b 4.36 ± 0.7 b 4.20 ± 0.48 b
