crossmark

Polarity Alteration of a Calcium Site Induces a Hydrophobic Interaction Network and Enhances Cel9A Endoglucanase Thermostability Hsiu-Jung Wang,a Yu-Yuan Hsiao,a,b Yu-Pei Chen,a Tien-Yang Ma,a Ching-Ping Tsenga,b Department of Biological Science and Technologya and Institute of Molecular Medicine and Bioengineering,b National Chiao Tung University, Hsinchu, Taiwan, Republic of China

Structural calcium sites control protein thermostability and activity by stabilizing native folds and changing local conformations. Alicyclobacillus acidocaldarius survives in thermal-acidic conditions and produces an endoglucanase Cel9A (AaCel9A) which contains a calcium-binding site (Ser465 to Val470) near the catalytic cleft. By superimposing the Ca2ⴙ-free and Ca2ⴙbounded conformations of the calcium site, we found that Ca2ⴙ induces hydrophobic interactions between the calcium site and its nearby region by driving a conformational change. The hydrophobic interactions at the high-B-factor region could be enhanced further by replacing the surrounding polar residues with hydrophobic residues to affect enzyme thermostability and activity. Therefore, the calcium-binding residue Asp468 (whose side chain directly ligates Ca2ⴙ), Asp469, and Asp471 of AaCel9A were separately replaced by alanine and valine. Mutants D468A and D468V showed increased activity compared with those of the wild type with 0 mM or 10 mM Ca2ⴙ added, whereas the Asp469 or Asp471 substitution resulted in decreased activity. The D468A crystal structure revealed that mutation D468A triggered a conformational change similar to that induced by Ca2ⴙ in the wild type and developed a hydrophobic interaction network between the calcium site and the neighboring hydrophobic region (Ala113 to Ala117). Mutations D468V and D468A increased 4.5°C and 5.9°C, respectively, in melting temperature, and enzyme half-life at 75°C increased approximately 13 times. Structural comparisons between AaCel9A and other endoglucanases of the GH9 family suggested that the stability of the regions corresponding to the AaCel9A calcium site plays an important role in GH9 endoglucanase catalysis at high temperature.

C

ellulose is the most abundant natural polysaccharide and is utilized to generate bioalcohol as a sustainable alternative to fossil fuels (1). Owing to its complex structure, the efficient degradation of cellulose is essential for the production of bioalcohol. Three types of cellulases, namely, endoglucanase (EC 3.2.1.4), exoglucanase (EC 3.2.1.91), and ␤-glucosidase (EC 3.2.1.21), are required to decompose cellulose into glucose. Endoglucanases cleave internal ␤-1,4 glycosidic linkages of the polymeric cellulose and act synergistically with exoglucanases and ␤-glucosidases during cellulose hydrolysis (2, 3). The use of thermostable cellulases can reduce industrial cost by increasing the enzymatic hydrolysis rates at high temperature, thereby decreasing the enzyme dosage requirements (1). Performing cellulose hydrolysis at high temperature also can decrease microbial contamination problems. Hence, identifying thermostable forms of cellulases or developing methods to improve the thermostability would benefit cellulase application on an industrial scale. Numerous studies on the thermostability of endoglucanase modules involved in cellulose degradation have been conducted (4–6). The endoglucanase catalytic domains of glycoside hydrolase family 9 (GH9) are arranged with specific carbohydrate-binding domains and/or immunoglobulin (Ig)-like domains to ensure stability and activity (4, 7). The N-terminal ␤-sheet, which is considered critical for the hyperthermostability of GH5 (glycoside hydrolase family 5) Pyrococcus horikoshii endoglucanase, may help stabilize the core barrel catalytic structure (5). The residues responsible for the thermostability of GH8 (glycoside hydrolase family 8) Clostridium thermocellum endoglucanase CelA provide the stability of secondary structures (6). Hence, rigid packing may be the key to converting mesostable endoglucanases into thermostable ones (5, 6, 8).

1662

aem.asm.org

Structural metal sites can provide strong stability at particular regions of a protein by cross-linking the secondary structures that are most frequently occupied by Zn2⫹ or Ca2⫹ (9–12). The removal of Ca2⫹ in CbhA cellobiohydrolase from C. thermocellum causes a 20°C decrease in melting temperature (Tm), indicating the importance of Ca2⫹ in sustaining polypeptide conformation (10). The calcium sites binding to Ca2⫹ in the mannanases from Streptomyces thermolilacinus and Thermobifida fusca significantly increase the Tm by 12.5°C and 5°C, respectively (11). The binding of Ca2⫹ in S. thermolilacinus mannanase also can increase the kcat by 3.3 times. In addition, two calcium sites in a highly thermostable protease from Bacillus species could act cooperatively to provide substantial protein thermostability (12). These findings imply the critical influence of calcium-binding sites on enzyme thermostability and activity. Therefore, enhancing the interactions between the calcium sites and their surrounding environments could improve protein thermostability and activity. Alicyclobacillus is of special interest to the fruit juice canning

Received 10 October 2015 Accepted 16 December 2015 Accepted manuscript posted online 4 January 2016 Citation Wang H-J, Hsiao Y-Y, Chen Y-P, Ma T-Y, Tseng C-P. 2016. Polarity alteration of a calcium site induces a hydrophobic interaction network and enhances Cel9A endoglucanase thermostability. Appl Environ Microbiol 82:1662–1674. doi:10.1128/AEM.03326-15. Editor: R. M. Kelly, North Carolina State University Address correspondence to Ching-Ping Tseng, [email protected]. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

industry, because typical pasteurization regimens cannot inactivate its endospores (13). Alicyclobacillus acidocaldarius (ATCC 27009), a Gram-positive and thermal-acidic bacterium, first was isolated from acid hot springs in the United States (14). The species grows optimally at 60°C to 65°C and produces thermostable enzymes with the potential to cause thermophilic lignocellulose deconstruction, including ␤-1,4-endoglucanases and ␤-galactosidases (15). One of them is the GH9 endoglucanase Cel9A (AaCel9A), which is a calcium- and zinc-binding protein with an optimal catalytic activity at 70°C (14, 16). GH9 is the second largest cellulase family and consists mainly of endoglucanases (EC 3.2.1.4). The endoglucanases operate with an inversion of anomeric stereochemistry in hydrolyzing the glycosidic bonds of soluble cellulose derivatives as described in the CAZypedia database (http://www.cazypedia.org/index.php /Glycoside_Hydrolase_Family_9). The endoglucanase from Alicyclobacillus acidocaldarius is composed of a catalytic domain which folds into a typical GH9 (␣/␣)6-barrel comprising an open active-site cleft and an Ig-like domain at the N terminus (7, 17). The enzyme is most active against substrates containing ␤-1,4linked glucans, including carboxymethylcellulose, lichenan, and p-nitrophenyl (pNP)-cellooligosaccharides (16). Several crystal structures of AaCel9A under different conditions revealed three metal sites related to its thermostability or activity, which makes the enzyme a perfect model to study metal-binding structures versus enzyme stability and catalysis. AaCel9A contains two calcium sites (Ca-A site and Ca-B site) that bind to two calcium ions (Ca-A and Ca-B) and one zinc site that binds to one zinc ion (17). All of the crystal structures showed that AaCel9A was purified with endogenous Ca-A and one endogenous zinc ion, provided that AaCel9A binds these two metals tightly. The Ca-A and zinc sites are important for maintaining the structural integrity of AaCel9A (7). In comparison, the Ca-B site is regarded as a lowaffinity calcium-binding site which binds to Ca2⫹ if additional 5 mM Ca2⫹ is supplied (7, 17). The binding of Ca-B can affect the AaCel9A activity, because the calcium-binding residues are located in the same loop region as the substrate binding residues (17, 18). Ca-B adopts a heptacoordination involving one side-chain oxygen atom from Asp468, two carbonyl oxygen atoms from Ser465 and Val470, and four oxygen atoms from 636, 858, 921, and 922 water molecules (17). Here, the superimposition of two solved AaCel9A structures (PDB numbers 3GZK and 3EZ8 [7, 17]), crystallized with or without calcium pretreatment, showed a significant conformational change of the Ca-B site upon Ca2⫹ binding. The configuration of the Ca-B site is changed from a closed form into an open form when it binds to Ca2⫹. However, both forms sustain a rather unstable region in AaCel9A based on the B factors, which are determined crystallographically and are linearly related to the mean square displacement of an atom as a result of thermal motion and atomic flexibility (19). Based on structural comparison, we found that the residues of the Ca-B site could be mutated to increase the local stability by designing hydrophobic interactions. Our data revealed that a single base mutation (D468 A) induced a hydrophobic interaction network that stabilized the Ca-B site. The efficient transformation of the Ca-B site could explain the significant 13-fold increase of the AaCel9A thermostability while displaying a 40% increase in enzyme activity . Hence, the study identified a thermostable endoglucanase form as an effective example of the polarity optimization of the catalysis

March 2016 Volume 82 Number 6

-related metal site for enhancing protein thermostability and activity. Further analysis of GH9 endoglucanase structures suggested that the regions corresponding to the AaCel9A Ca-B site effectively sustained the activity of GH9 endoglucanases at high temperatures. MATERIALS AND METHODS Bacterial strains and growth conditions. Alicyclobacillus acidocaldarius ATCC 27009 was used for cel9A gene cloning. This strain was incubated at 55°C with constant agitation in liquid medium [1.3 g/liter (NH4)2SO4, 0.37 g/liter KH2PO4, 0.25 g/liter MgSO4·7H2O, 0.07 g/liter CaCl2·2H2O, 0.02 g/liter FeCl3, 1 g/liter glucose, 1 g/liter yeast extract] Enzyme expression was conducted using pET23 vector (Novagen, Madison, WI) with Escherichia coli BL21(DE3). Gene cloning and site-directed mutagenesis were carried out in E. coli DH5␣. Gene cloning and plasmid construction. Genomic DNA of A. acidocaldarius was isolated by a genomic DNA minikit (Geneaid Biotech, Bade City, Taiwan). The primer set of the cel9A gene was designed for PCR as follows with cel9A-F (GTCGACGATTCGACATGCCGTCTCG), with an SalI restriction site (underlined sequence), and cel9A-R (CGGCCGCTAC CGCGCGCCTCGAGC), with an EagI restriction site (underlined sequence). The PCR product of the 1.6-kb cel9A gene was introduced into the plasmid pET23 through the SalI-EagI site to obtain plasmid pAaCel9A. Hence, AaCel9A expressed from pAaCel9A would include a fusion of six histidine residues at the C terminus. Site-directed mutagenesis of recombinant AaCel9A. Site-directed mutagenesis was carried out using pAaCel9A as the template and two complementary primers containing the desired mutation. The following mutagenic oligonucleotides were designed for the cel9A gene, and the mutated sites corresponding to the introduced amino acids are underlined: D468A-F, 5=-TCCGTCGCGGCTGATGTGGACCATCCCGT-3=; D468A-R, 5=-TGGTCCACATCAGCCGCGACGGACGGG-3=; D468V-F, 5=-GTCCGTCGCGGTTGATGTGGACCATC-3=; D468V-R, 5=-GATGG TCCACATCAACCGCGACGGAC-3=; D468E-F, 5=-GTCCGTCGCGGA AGATGTGGACCATC-3=; and D468E-R, 5=-GATGGTCCACATCTTCC GCGACGGAC-3=. The PCR product then was digested with DpnI and transformed into E. coli DH5␣. The mutated plasmids from the clones with ampicillin resistance were sequenced to confirm the designed mutations. Enzyme production and purification. E. coli BL21(DE3) was transformed with pAaCel9A, and a single colony with ampicillin resistance was inoculated for culturing overnight in 5 ml LB medium containing 50 ␮g ml⫺1 ampicillin. The overnight culture was transferred to 500 ml medium and grown until the optical density at 600 nm (OD600) reached 0.4 to 0.6 at 37°C. Protein overexpression was induced by 0.4 mM isopropyl ␤-Dthiogalactoside (IPTG) for 5 h at 37°C. The induced cells were harvested and suspended in 20 mM sodium phosphate buffer, 300 mM NaCl, pH 7.4, and 50 mM imidazole (washing buffer). A French press was used to disrupt the cell, and the obtained crude extract was centrifuged at 130,000 ⫻ g for 30 min at 4°C. The supernatant was subjected to His tag purification (Ni Sepharose 6 Fast Flow; GE Healthcare) followed by 10 ml washing buffer. His-tagged proteins were eluted with 7 ml elution buffer (washing buffer plus 100 mM imidazole). The elution fractions were concentrated by ultrafiltration (10,000 molecular weight cutoff [MWCO]; Millipore) before loading into a gel filtration column (filled with 134 ml Superdex 200; GE Healthcare) equilibrated with 20 mM Tris buffer, pH 7.5, and 150 mM NaCl. The eluted protein (63 kDa) was concentrated to 8 to 10 mg/ml by a 10,000-MWCO centrifugal filter (Millipore, Bedford, MA). All mutants and the wild type were expressed and purified using the same method. The protein expression and purification procedures were monitored by SDS-PAGE (10% gels) followed by Coomassie blue staining. The purified enzymes were tested for their specific activity, optimal temperature, pH profiles, and thermostability and used in X-ray crystallization.

Applied and Environmental Microbiology

aem.asm.org

1663

Wang et al.

TABLE 1 Kinetic parameters and specific activity of wild-type AaCel9A and its mutants Sp act (U mg⫺1)a with: ⫺1

⫺1

Enzyme/mutation

kcat (s )

Km (mg ml )

kcat Km

Wild type D468A D468V D468E D469A D469V D469E D471A D471V D471E

0.60 ⫾ 0.11 1.43 ⫾ 0.02 1.31 ⫾ 0.03 0.68 ⫾ 0.12 1.43 ⫾ 0.04 3.38 ⫾ 0.65 5.01 ⫾ 0.13 0.72 ⫾ 0.12 0.68 ⫾ 0.13 0.92 ⫾ 0.04

29.95 ⫾ 7.31 46.80 ⫾ 1.28 38.05 ⫾ 1.46 30.70 ⫾ 9.93 74.76 ⫾ 2.20 204.90 ⫾ 47.63 242.00 ⫾ 6.93 49.46 ⫾ 9.02 117.08 ⫾ 26.06 45.70 ⫾ 3.25

0.020 0.031 0.022 0.022 0.019 0.016 0.021 0.015 0.006 0.020

a

⫺1

⫺1 ⫺1

(ml mg

s )

0 mM CaCl2

10 mM CaCl2

137 ⫾ 4 190 ⫾ 4 153 ⫾ 4 159 ⫾ 5 59 ⫾ 4 57 ⫾ 6 85 ⫾ 7 92 ⫾ 2 49 ⫾ 1 111 ⫾ 2

192 ⫾ 3 282 ⫾ 7 234 ⫾ 4 246 ⫾ 2 74 ⫾ 2 77 ⫾ 4 114 ⫾ 1 158 ⫾ 1 68 ⫾ 2 189 ⫾ 6

One unit of activity is defined as the amount of enzymes releasing 1 ␮mol reducing equivalents per minute.

Enzyme kinetic and specific activity assays. Enzyme concentration was determined by Bio-Rad protein assay (Bio-Rad Laboratories). Enzyme activity was assayed by detecting the reducing sugars at OD540 according to the DNS (3,5-dinitro-2-hydroxybenzoic acid) method (20). The enzyme specific activity was tested in 50 mM sodium-acetate buffer, pH 5.5, with 1% carboxymethylcellulose sodium salt (CMC; low viscosity; Sigma-Aldrich) as the enzyme substrate at 60°C for 5 min. One unit of activity is defined as the amount of enzyme releasing 1 ␮mol reducing equivalents per minute. Kinetic parameters (Km and kcat) were determined with the CMC concentration varied from 0.5 to 2.5% at 60°C for 3 min using a fixed enzyme concentration (1 ␮g 200 ␮l⫺1). The activity data were fit to the Michaelis-Menten equation to determine Km and kcat by GraphPad Prism 5. Averages from triplicate experiments are displayed in Table 1. Protein crystallization. Mutant D468A (8 mg ml⫺1) first was screened under the crystallization conditions of the commercial kits (SaltRx from Hampton, the PEGs II Suite and MPD Suite from Qiagen, and the MPD II and MpdMax kits from Crystalgen) using the sitting-drop vapor diffusion method. The optimized crystallization condition was 20 mM morpholineethanesulfonic acid (MES) buffer, pH 5.0, and 45% 2-methyl-2,4-pentanediol (MPD). The crystals were obtained after 2 months at 4°C by the hanging-drop vapor diffusion method with the drops consisting of 1.5 ␮l protein solution and 1.5 ␮l reservoir solution. The obtained crystals then were flash-frozen in liquid nitrogen. Data collection and crystal structural determination. The diffraction data of mutant D468A were collected at the National Synchrotron Radiation Research Center (BL-15A1). All diffraction data were processed by HKL2000 (21), and the diffraction statistics are listed in Table 2. The phase problem was solved by the molecular replacement method using the crystal structure of wild-type AaCel9A (PDB number 3EZ8) as the search model by using the program MOLREP of CCP4 (22). The models were built by Coot (23) and refined by Phenix (24). Refinement statistics also are listed in Table 2. Thermostability test and optimal pH and temperature measurements. Enzyme half-life was determined by incubating concentrated purified enzymes (30 ␮g 100 ␮l⫺1) at 75°C from 0 to 300 min in 50 mM sodium acetate buffer, pH 5.5, containing 0 or 20 mM CaCl2. After the heat treatment, the enzyme solution was diluted 100-fold into 50 mM sodium acetate buffer, pH 5.5, containing 20 mM CaCl2. The residual endoglucanase activity was assayed at 60°C with 1% CMC substrate for 5 min. The half-life was the incubation time corresponding to 50% residual activity. Optimal temperature profiles were determined from 30°C to 90°C in 50 mM sodium acetate buffer, pH 5.5, for 10 min using 0.7 ␮g enzyme. Optimal pH profiles were determined with 50 mM buffer, pH 4.0 to 9.0 (acetate buffer, pH 4.0 to 5.5; phosphate buffer, pH 6 to 8; Tris buffer, pH 8.5 and 9.0) at 60°C for 10 min using 0.25 ␮g enzyme. Averages from triplicate experiments are displayed in Fig. 3. Differential scanning calorimetric assay. The Tm experiment was conducted by a differential scanning calorimeter (VP-DSC; MicroCal).

1664

aem.asm.org

Enzymes were placed into ultrapure distilled water by a 10 K centrifugal filter and adjusted to 1 mg ml⫺1. The eluent from the centrifugal filter was used as the reference sample to determine the baseline in the Tm assay. The samples were degassed before loading into the reference and sample cells of VP-DSC. The scanning temperatures were set from 20°C to 90°C at a scan rate of 1°C min⫺1 to measure the Tm of the enzymes with or without the addition of 20 mM CaCl2. However, the enzymes showed significant precipitation at 20 mM CaCl2, which caused the uneven baselines of melting curves. Therefore, the enzyme unfolding curves of the enzymes with the calcium addition were not shown. Analysis of metal binding. The Ca/Zn molar ratio of enzymes was estimated by inductively coupled plasma mass spectrometry (ICP-MS;

TABLE 2 Data collection and refinement statistics of AaCel9A D468A (5E2J) Parameter for AaCel9A D468A

Datad

Metal ions (no. per molecule)

1 Zn2⫹ and 1 Ca2⫹

Data collection Space group Cell dimensions a, b, c (Å) ␣, ␤, ␥ (°) Resolution range (Å) Rsyma I/␴I Completeness (%) Redundancy Refinement Resolution range (Å) No. reflections (work/test)b Rwork/Rfreec RMSD Bond length (Å) Bond angle (°) Ramachandran blot statistics (%) Favored region Allowed region Outlier region

P212121 55.421, 144.374, 158.704 90.0, 90.0, 90.0 30.0–2.1 (2.18–2.10) 0.050 (0.407) 26.96 (2.02) 97.0 (94.0) 3.3 (2.6)

2.1–19.96 73,040/5,675 20.21/23.74 0.002 0.708

96.87 3.03 0.09

Rsym ⫽ ⌺hkl ⌺i |Ii(hkl) ⫺ ⬍I(hkl)⬎|/⌺hkl ⌺iIi(hkl), where ⌺hkl denotes the sum over all reflections and ⌺i is the sum over all equivalent and symmetry-related reflections. b All reflections (working reflections)/reflections used in the Rfree test. c Rwork ⫽ ⌺|Fobs ⫺ Fcalc|/⌺Fobs. Rfree ⫽ Rwork for 5% of the data that were not included during crystallographic refinement. d Values in parentheses are for the outer resolution shell. a

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

PerkinElmer, Waltham, MA). Enzymes were concentrated to 1 mg in 250 ␮l ultrapure distilled water by a 10 K centrifugal filter, and the eluent was employed as the control sample. One milliliter of 10% HNO3 was mixed into the samples before the assay. The assay was performed in triplicate and carried out in the instrumentation center at Tsing Hua University, Hsinchu, Taiwan. Protein structure accession number. The atomic coordinates for the crystal structure of AaCel9A D468A are available in the Research Collaboratory for Structural Bioinformatics Protein Data Bank (http://www.rcsb .org/pdb/home/home.do) under PDB number 5E2J.

RESULTS

Structure and sequence comparison of AaCel9A. Two calcium sites of AaCel9A, the low-affinity Ca-B binding site close to ⫹1 substrate binding residues and the high-affinity Ca-A binding site (7, 17), are shown in Fig. 1A. Previous studies suggested that the binding of Ca-B could enhance enzymatic activity, whereas the binding of Ca-A ensures the structural integrity (17). However, AaCel9A can be purified with endogenous Ca-A but not with Ca-B, and the Ca-B site binds to Ca2⫹ under high Ca2⫹ concentration (5 mM) (7, 17). Hence, the 20% increase in the AaCel9A thermostability caused by an additional 10 mM CaCl2 (16) suggested that the Ca-B site binding to Ca2⫹ can enhance the thermostability of AaCel9A in addition to its activity. Comparing the conformations of the Ca-B site showed that Ca2⫹ triggers the Ca-B site in the closed form to undergo a significant conformation transition (Val466 to His472) into the open form (Fig. 1B). The side chain of Val470 in the two forms of the Ca-B site points in almost opposite directions. The binding of Ca2⫹ expands the Ca-B site and reorients the Val470 side chain from facing Val466 to turn to Pro115 and Trp116 of a nearby hydrophobic region (Ala113 to Ala117). Moreover, the charged side chain of Asp468, which directly ligates Ca2⫹, is reoriented to the nearby hydrophobic region when Ca2⫹ is detached. Although metal chelation of proteins can create a more rigid structure and provide local stability (9–12, 25), the Ca-B site remains a relatively unstable region of AaCel9A, as it binds to Ca2⫹ based on the relatively high B factors (Fig. 1A). The B factors of the Ca-B site are the following (using C␣ atoms only): Asp468, 36.1; Asp469, 36.39; Val470, 35.48; Asp471 (3GZK without the binding of Ca-B), 32.98; Asp468, 52.03; Asp469, 68.08; Val470, 51.27; and Asp471 (3EZ8 with the binding of Ca-B), 73.04. The B factors of Ca-B site residues all are higher than the average B factors of Aa Cel9A residues, which are 21.62 and 27.54 for 3GZK and 3EZ8, respectively. However, based on the structural comparisons shown in Fig. 1B, the stability of the Ca-B site could be further improved to elevate the enzyme thermostability. The replacements of Asp468 or its neighboring residues with hydrophobic residues could stabilize the Ca-B region by enhancing the hydrophobic interactions between the Ca-B site and the Ala113-to-Ala117 region. Hence, the three charge residues on the Ca-B site, namely, Asp468, Asp469, and Asp471, each were replaced by alanine and valine separately. Each of the three residues also was mutated to the other negatively charged amino acid, glutamate, as the control sample during the enzyme assays. A total of nine mutants (D468A, D468V, D468E, D469A, D469V, D469E, D471A, D471V, and D471E) were constructed. Sequence alignment of AaCel9A and other GH9 endoglucanases showed that Asp468, Asp469, and Asp471 residues are not strictly conserved (Fig. 1C). However, based on the structure and sequence comparison (Fig. 1A and C), the de-

March 2016 Volume 82 Number 6

signed mutations at positions Asp468, Asp469, and Asp471 that are close to the substrate binding residues His461 and Arg463 could affect the AaCel9A activity by changing the stability of the Ca-B region. The catalytic activity and kinetics of the nine mutants first were examined to understand whether the mutants could maintain the wild-type catalytic performance before measuring their thermostability. Enzyme kinetics and activity of wild type and mutants. The purified wild type and mutants were demonstrated by SDS-PAGE to be single protein subunits with approximate molecular masses of 63 kDa (data not shown). Their specific activity and kinetic properties are shown in Table 1. As can be seen, introducing alanine or valine to Asp468 led to higher specific activity for mutants D468A and D468V than for the wild type. Mutant D468A exhibited the highest specific activity among all enzymes, showing a 40% increase compared with that of the wild type. However, the replacements of Asp469 and Asp471 with alanine or valine resulted in a significant decrease in their specific activity. No mutations caused significant changes in kcat Km⫺1, except for D471V, which showed a significant increase in Km, resulting in a 3-fold reduction of kcat Km⫺1. Mutants D468A and D468V showed a 2- to 3-fold increase in kcat and a Km similar to that of the wild type, whereas mutant D468E retained kcat and Km similar to those of the wild type. Introducing valine or glutamate at Asp469 significantly increased both kcat and Km. The specific activity of all mutants and the wild type with the addition of 10 mM CaCl2 also was determined. All mutants and the wild type showed increased specific activity because of the addition of calcium. At 10 mM CaCl2, D468A and D468V also showed higher specific activity than the wild type and the Asp469 and Asp471 mutants. D468A also showed the highest specific activity among all mutants, with a 45% increase in specific activity compared with that of the wild type. Noticeably, D468A without additional 10 mM Ca2⫹ already showed specific activity similar to that of the wild type with additional 10 mM Ca2⫹. These findings showed that the replacement of Asp468 with the hydrophobic amino acid alanine or valine improved the AaCel9A activity. Crystallographic analysis of D468A structure. To observe the replacements of Ca2⫹-binding residues with hydrophobic amino acids reflected in the Ca-B region, we attempted to build the D468A structure by X-ray crystallization. The statistics for the crystallographic data and refinement are summarized in Table 2. PDB code 5E2J was given to the D468A structure, which diffracted to a 2.1-Å resolution. The crystal is orthorhombic and belongs to the space group P212121, with the following unit-cell dimensions: a ⫽ 55.42 Å, b ⫽ 144.37 Å, and c ⫽ 158.70 Å. One asymmetric unit of the D468A crystal contained two molecules that were identical in the primary sequence. The overall structures of the two molecules were almost identical, with root mean square deviations (RMSD) of 0.42 (involving 529 residues), as calculated using Swiss-PdbViewer. Chain B of 5E2J was used to demonstrate the properties of the D468A structure in Fig. 2 (also see Fig. 4). One zinc site and one calcium site (Ca-A site) in the D468A crystal structure tightly bound to Zn2⫹ and Ca2⫹, respectively, which also were found in the previous solved crystal structures of wild-type AaCel9A (7, 17). Furthermore, the mutated Ca-B site of the D46 8A structure was not occupied by Ca2⫹, as was found in wild-type 3GZK. The interactions between the mutated Ca-B site (Val466 to His472) carrying mutation D468A and its surrounding secondary structures are illustrated on the left in Fig. 2A. As can be seen, the

Applied and Environmental Microbiology

aem.asm.org

1665

Wang et al.

FIG 1 Structural alignment of AaCel9A and sequence alignment with GH9 endoglucanases. (A) Ca-B site in AaCel9A is adjacent to two substrate-binding residues of substrate-binding subsite ⫹1, His416 and Arg463 (colored salmon). Catalytic residues Asp143, Asp146, and Glu515 are colored cyan. AaCel9A structures, with and without the binding of Ca-B (PDB numbers 3EZ8 and 3GZK), are shown in B-factor putty mode in PyMOL, which is a molecular visualization program that displays three-dimensional structures of protein or small molecules. B factors of the C␣ atoms are used to represent B factors of amino acid residues. The highest B-factor position in each structure is colored red, and the lowest B-factor position is colored dark blue, as indicated by the B-factor scale bar. The thickness of the protein backbone also is proportional to the B factors of C␣ atoms. Ca-A in the B-factor structures of 3EZ8 and 3GZK is not labeled. Zn2⫹ bound by the zinc site of AaCel9A is not labeled in all structures. (B) Superimposition of two AaCel9A structures (3EZ8 and 3GZK) presents the structural variation of the Ca-B site (Val466 to His472) upon Ca-B binding. (C) Sequence alignment (pfam00759) of AaCel9A with other GH9 endoglucanases was

1666

aem.asm.org

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

guanidino hydrogen atom of Arg227 interacted with the carbonyl oxygen atom of Ala467 and the side-chain oxygen atom of Asp469. The carbonyl oxygen atom of Asp469 interacted with its own carboxyl hydrogen atom. In addition, the D468A structure showed the hydrophobic interactions among Ala468, Va470 side chains, and the neighboring hydrophobic region (Ala113 to Ala117). Conformational variations induced by D468A mutation. The overall structural comparisons of the D468A (5E2J) mutant to the wild types (3EZ8 and 3GZK) are shown on the right in Fig. 2A. The three structures showed similar overall conformations, and only 3EZ8 exhibited the binding of Ca-B. Interestingly, the conformation of the mutated Ca-B site carrying mutation D468A without binding to Ca2⫹ was similar to that of the wild-type Ca-B site binding to Ca2⫹ (3EZ8). The structural comparison between wild-type 3GZK and mutant D468A, both without the binding of Ca-B, showed that mutation D468A generated a significant conformational variation of the Ca-B site similar to that induced by Ca-B binding in wild-type 3EZ8. Mutant D468A (5E2J) and wild-type 3EZ8 both showed that the Val470 side chain was directed to the neighboring hydrophobic region, whereas that in the wild type 3GZK showed no hydrophobic contacts between the Val470 side chain and the Ala113-to-Ala117 region (Fig. 2B). The mutated Ca-B site and its neighboring hydrophobic region (Ala113 to Ala117) were closer in the D468A structure than those in wild-type 3EZ8. C␣-C␣ distances from Ala/Asp468 to Pro115 and Trp116 in the D468A structure (6.5 and 6.0 Å) and wild-type 3EZ8 (8.8 and 7.7 Å) are shown on the right in Fig. 2B. Moreover, a turn of the Val470 side chain was observed in mutant D468A compared to its orientation in wild-type 3EZ8. The flexibility of the Ca-B site and the neighboring hydrophobic region (Ala113 to Ala117) in the D468A structure was different from that in wild-type structures based on the B factors (Fig. 2C). The wild-type Ca-B site in the open form showed that the Val470 residue facing the hydrophobic region exhibited a lower B factor than those of the adjacent residues Asp469 and Asp471 which was not seen in wild-type 3GZK, suggesting that the hydrophobic interactions between Val470 and the hydrophobic region bring local stability. Moreover, the D468A structure showed that Ala468 of the Ca-B site and Pro115 and Trp116 of the hydrophobic region were particularly stabilized compared with those in 3GZK and 3EZ8. These findings, along with the structural variation shown in Fig. 2B, suggested that the hydrophobic interactions between the mutated Ca-B site and the hydrophobic region were further strengthened in the D468A structure. Thermostability and optimal pH of Asp468 mutants. To determine whether the hydrophobic interactions formed by mutation D468A or D468V would affect AaCel9A thermostability, the half-lives of wild-type AaCel9A and the Asp468 mutants (D468A, D468V, and D468E) were determined (Fig. 3A). The half-lives at 75°C of D468V and D468A were determined as approximately 240 min, whereas the half-lives of the wild type and D468E mutant

were retained for only 18 and 25 min. The half-lives of D468V and D468A were approximately 13 times longer than that of the wild type. In addition, the half-lives of the wild type and D468E mutant with an additional 20 mM CaCl2 reached 80 min, which was 4.5fold and 3-fold longer, respectively, than those without the calcium addition (Fig. 3A). The half-life increase caused by the calcium addition also was found with D468A and D468V. We noticed that the half-lives of D468A and D468V without the calcium addition were approximately three times higher than that of the wild type with the calcium addition. At 20 mM CaCl2, D468A and D468V were able to retain 60% residual activity after 300 min of incubation, whereas the wild type and D468E mutant each already approached the same residual activity by around 40 min of incubation. The Tm determined by DSC of D468A and D468V was 81.8°C and 80.4°C, respectively, whereas the Tm of the wild type and D468E mutant were 75.9°C and 78.2°C, respectively (Fig. 3B). D468A and D468V exhibited a 5.9°C and 4.5°C increase in Tm, respectively. Hence, the Tm results were in agreement with the half-life determination that the substitution of valine or alanine for Asp468 increased AaCel9A thermostability. The optimal temperature and pH profiles of all Asp468 mutants were compared with those of the wild type (Fig. 3C and D, respectively). The optimal temperatures for the wild type and all Asp468 mutants was 70°C (Fig. 3C). However, D468V and D468A were able to retain higher residual activity at 80°C (around 95%) and 90°C (around 60%) than the wild type and D468E mutant (70% and 85% at 80°C and 45% and 45% at 90°C). The optimal pH for all Asp468 mutants and the wild type during the CMC hydrolysis ranged between pH 5 and 5.5, except for that of D468A, which was shifted to pH 6.0 (Fig. 3D). The activity of all Asp468 mutants and the wild type were almost undetectable at pH 4.0 and 9.0. DISCUSSION

Structural calcium sites can promote increases in the stability and changes in the conformation of proteins (10–12, 26). Ca-B coordination of AaCel9A is different from the types of Ca2⫹ coordination, which are heavily involved in structural integrity by metal cross-linking segments remote from the primary amino acid sequence through metal-mediated polar interactions (e.g., Ca-A coordination) (11, 12, 25, 27). The Ca-B site is enclosed by five residues which are continuous in the primary sequence (Ser465 to Val470), and the coordination is formed by three of the five residues (Ser465, Asp468, and Val470) (17). Therefore, the polar interactions involved in the Ca-B coordination may not provide strong local stability directly. Furthermore, the Ca-B site bound to Ca2⫹ retained a relatively high B-factor region, corresponding to pronounced degrees of thermal motion and, thus, flexibility in AaCel9A (Fig. 1A). The mutations at relatively high B-factor residues, which are considered to have pronounced flexibility and are targeted for stabilization, have been used in a strategy to obtain thermostable proteins (28–30).

generated by searching AaCel9A primary sequence in the conserved domain database (CDD) from NCBI. CtCelD is the endoglucanase CelD from Clostridium thermocellum (UniProtKB number P0C2S4), PfCelA is the endoglucanase CelA from Pseudomonas fluorescens subsp. cellulosa (P10476), PsCelA is the endoglucanase CelA from Pseudomonas sp. strain YD-15 (Q9Z3X7), CfCenC is the endoglucanase CenC of Cellulomonas fimi (P14090), SrCel1 is the cellulase Cel1 from Streptomyces reticuli (Q05156), and FsEGC is the endoglucanase EGC from Fibrobacter succinogenes BL2 (Q59442). Ca2⫹ binding residues of the Ca-B site and substrate-binding residues are marked with triangles. Glu515, one of the AaCel9A catalytic residues, is indicated with a star. Residues Asp468, Asp469, and Asp471, which are used for designing site-directed mutagenesis in this study, are colored yellow.

March 2016 Volume 82 Number 6

Applied and Environmental Microbiology

aem.asm.org

1667

Wang et al.

FIG 2 Structural transformations induced by D468A mutation. The structures of the wild type (PDB numbers 3EZ8 and 3GZK) and the D468A mutant (PDB number 5E2J) were drawn by PyMOL and labeled with different colors. (A) Superimposition of wild-type 3EZ8 and 3GZK with 5E2J is shown on the right. RMSD values of 5E2J and 3GZK (0.54) as well as 5E2J and 3EZ8 (0.45), involving 528 residues, were calculated by Swiss-PdbViewer. The structure of the Ca-B site carrying mutation D468A in 5E2J is magnified on the left. Polar contacts between the mutated Ca-B site (Val466 to His472) and its surrounding secondary structures are highlighted with yellow dashed lines. Ala468, Val470, and the Ala113-to-2Ala117 region, involved in hydrophobic interactions, were labeled in surface mode using PyMOL. (B) Structural changes of Ca-B site and Ala113-to-Ala117 region among 3EZ8, 3GZK, and 5E2J are indicated with arrows. Arrows beside Ala468, Pro115, Trp116, and Val470 residues indicate the shift of the C␣ atoms and the turn of the Val470 side chain in 5E2J. 3GZK is presented as semitransparent, meaning no hydrophobic contacts between these residues exist. C␣-C␣ distances from Asp468/Ala468 and Val470 to Pro115 and Trp116 in 3EZ8 and 5E2J, respectively, are indicated separately on the right. (C) Structures of Ca-B sites and its neighboring hydrophobic regions (Ala113 to Ala117) in 3GZK, 3EZ8, and 5E2J are presented in B-factor putty mode in PyMOL using B factors of C␣ atoms only. The C␣ atom with the highest B factor in each structure is shown in red and the C␣ atom with the lowest B factor is shown in dark blue, as indicated by the B-factor scale bar. Val470, Asp/Ala468, Pro115, and Trp116 are labeled with residue side chains.

1668

aem.asm.org

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

FIG 3 Thermostability and optimal pH of wild type and Asp468 mutants. (A) Half-life curves at 75°C of D468A, D468V, and D468E mutants and wild-type AaCel9A with or without 20 mM CaCl2 are shown. The numbers labeled beside the curves indicate the corresponding half-lives (min). (B) Unfolding curves of mutants D468A, D468V, and D468E and wild-type AaCel9A were generated by DSC. (C) Temperature profiles of D468A, D468V, and D468E mutants and wild-type AaCel9A were determined from 30°C to 90°C. The highest activity, occurring at 70°C for each enzyme, is treated as 100% relative activity. (D) pH profiles of D468A, D468V, and D468E and wild-type AaCel9A were determined at pH 4.0 to 9.0. The highest activity for each enzyme is treated as 100% relative activity.

Comparing the conformations of wild-type Ca-B site in the closed and open forms revealed that the hydrophobic interactions between the Ca-B site and its nearby hydrophobic region, which are indirectly activated by Ca2⫹, could be further enhanced by replacing three polar residues with hydrophobic residues around the Asp468 region so as to increase the local stability (Fig. 1B). Mutants D468A and D468V exhibited higher activity than those of the wild type and mutant D468E with or without additional 10 mM Ca2⫹ (Table 1). The Asp469 and Asp471 mutations all resulted in decreased activity. The D468A crystal structure revealed the formation of a hydrophobic interaction network through a conformational change that significantly stabilized the Ca-B region (Fig. 2), which is near the active-site cleft (Fig. 1A and C). The D468A or D468V mutation efficiently increased the AaCel9A halflife 13 times at 75°C (Fig. 3A) compared to that of other singlebase mutations that have been reported to enhance the thermostability of endoglucanases (31–34). Endoglucanases have been designed to improve thermostability through such methods as error-prone PCR and the introduction of glycine or proline onto the enzyme surface. However, rationally designing endoglucanase thermostability without compromising the activity remains a challenge. The single mutation D468A or D468V being able to achieve a significant thermostability increase, accompanied by increased activity, suggested that the Asp468 calcium-binding residue is in a decisive position for AaCel9A integrity.

March 2016 Volume 82 Number 6

C. thermocellum endoglucanase CelD of GH9 (CtCelD; PDB number 1CLC [35]) has a structure similar to that of AaCel9A (3EZ8), with an RMSD of 2.46 (458 C␣ atoms involved) calculated using Swiss-PdbViewer. The corresponding Ca-B site of CtCelD bound to Ca2⫹ displays a 1.8-fold decrease in Km upon increasing the Ca2⫹ concentration from 0.005 mM to 0.1 mM (18, 36). Mutation D468A of AaCel9A caused a conformational change similar to that upon Ca2⫹ binding in the wild-type structure, and the increased activity of mutants D468A and D468V was caused by the increased kcat (Table 1). The D468A crystal structure showed that the increased activity could have resulted from the newly created hydrophobic interactions delicately driven by mutation D468A, which is close to the substrate binding residues His413 and Arg416 (Fig. 1A and C). Structure comparison showed that Ca-B induces the side chain of Val470 to turn to its nearby hydrophobic region (Ala113 to Ala117) on the other side in the wild-type structure (Fig. 1B). The significant conformation change suggested that the binding of Ca-B evoked the hydrophobic contacts between the Ca-B site and the neighboring hydrophobic region in wild-type AaCel9A. The D468A crystal structure showed that Ala468 further participated in the hydrophobic contacts (Fig. 2A). Notably, the mutated Ca-B site carrying the mutation D468A was not in contact with Ca2⫹; in spite of this, the mutated Ca-B site sustained an open form instead of a closed one (Fig. 2B). Hence, the D468A mutation could in-

Applied and Environmental Microbiology

aem.asm.org

1669

Wang et al.

duce a conformation rearrangement of the Ca-B site similar to that of the wild-type Ca-B site upon Ca2⫹ binding. Ala468 and Val470 on the Ca-B site had sufficient hydrophobic strength to flip the calcium-binding loop to interact with the nearby hydrophobic region without the aid of Ca-B binding. The shortened distance between the Ca-B site and the hydrophobic region, along with the reduced B-factors of the Ca-B site in the D468A structure (Fig. 2B and C), demonstrates that the hydrophobic interaction between the two regions is stronger than that in wild-type 3EZ8. The hydrophobic strength was consistent with the half-life measured at 75°C (Fig. 3A), with the half-life of the wild type or D468E without 20 mM Ca2⫹ being less than that of the wild type or D46 8E with 20 mM Ca2⫹, which was less than that of D468A or D468V without 20 mM Ca2⫹. The wild type and D468E mutant showed three and four times longer half-lives, respectively, because of the addition of 20 mM Ca2⫹. The increase of wild-type thermostability in the presence of additional Ca2⫹ is consistent with the findings of Pereira et al. (17). Furthermore, the half-life of mutant D468A or D468V without additional 20 mM Ca2⫹ was approximately three times longer than that of the wild type or the D468E mutant with 20 mM Ca2⫹. The Tm measurements and temperature profiles also confirmed that mutant D468A or D468 V is more thermostable than the wild type and mutant D468E (Fig. 3B and C). Interestingly, the increased half-life at 75°C of mutants D468A and D468V was obtained with an additional 20 mM Ca2⫹ (Fig. 3A). The results suggested that the Ca-B site, which carried the mutation of the calcium-binding residue Asp468 to alanine or valine, still was able to bind Ca2⫹. The binding of Ca2⫹ could further reinforce the hydrophobic interactions arising from mutation D468A or D468V by supporting the configuration of the Ca-B site in the open form. To demonstrate the ability of the mutated Ca-B site to accommodate Ca2⫹, the Ca2⫹-binding conformation of the Ca-B site carrying mutation D468A was simulated as shown in Fig. 4A. The hexacoordination of the mutated Ca-B site was performed by the two carbonyl oxygen atoms of Val470 and Ser465 and four oxygen atoms from four water molecules. The coordinates of the four water molecules were duplicated from those of the 3EZ8 structure. To further investigate mutation D468A or D468V in Ca-B binding, the Ca/Zn molar ratios of the purified enzymes (mutants D468A, D468V, and D46 8E and the wild type) were measured by ICP-MS as shown in Fig. 4B. Theoretically, if all three metal sites of AaCel9A are fully occupied, one AaCel9A molecule would contain two calcium ions and one zinc ion, giving a Ca/Zn molar ratio of 2:1. The experimental value of the wild-type Ca/Zn molar ratio was 1.7:1, which was higher than the 1.5:1 ratio for D468A, 1.3:1 ratio for D468V, and 1.4:1 ratio for D468E (Fig. 4B). The results showed that the charge replacement of Asp468, whose side chain directly ligates Ca2⫹, caused the decrease of AaCel9A calcium content. The Ca/Zn molar ratio of wild-type AaCel9A of less than two is consistent with a previous study that found that the Ca-B site is a low-affinity Ca2⫹ binding site compared to the Ca-A site that binds tightly to Ca2⫹ in an endogenous manner (17). In addition, the Ca/Zn molar ratio of mutant D468A or D468V of between one and two supported the simulation results from Fig. 4A that the mutated Ca-B site still can bind Ca2⫹. Hence, the residual calcium -binding ability of the mutated Ca-B site may explain the finding that the enzyme thermostability of mutants D468A and D468V further increased when additional Ca2⫹ was supplied (Fig. 3A).

1670

aem.asm.org

FIG 4 Simulation of Ca2⫹ binding to Ca-B site carrying mutation D468A. (A) Ca-B site of the wild type (PDB number 3EZ8) was aligned with the mutated Ca-B site of the D468A structure (PDB number 5E2J). The Ca-B site is shown in cartoon-loop style, and the Ala113-to-Ala117 region is shown in surface mode in PyMOL. Ca-B coordination in 5E2J was simulated by carbonyl groups of Val465, Ser470, and four water molecules. Ca2⫹ and four water molecules in the simulation share the same coordinates as those in 3EZ8, and the simulated polar contacts are colored blue. A polar contact between the Asp468 side chain and Ca2⫹ in 3EZ8, which is interrupted by mutation D468A, is indicated by a green arrow. (B) Ca/Zn molar ratios of wild-type AaCel9A and mutants D46 8A, D468V, and D468E measured by ICP-MS are compared.

This phenomenon also was found with wild-type enzyme. In addition, the longer side chain of glutamate than aspartate could affect Ca-B binding and explain the lower Ca/Zn molar ratio of mutant D468E than the wild type. According to the sequence alignment of the similar GH9 structures AaCel9A (3EZ8) and CtCelD (1CLC), Asp523 of CtCelD was aligned to Asp468 of AaCel9A (Fig. 1C). In comparison, mutation D523A caused no significant effect on CtCelD thermostability (1 8). Although AaCel9A and CtCelD shared a similar configuration with the Ca-B site bound to Ca2⫹, we found some structural differences in the vicinity of the Ca-B site. Hydrophobic residues (Ala113 to Ala117; AGPWA) in AaCel9A form a turn toward the neighboring Ca-B site, whereas the hydrophobic turn is replaced with a more hydrophilic ␤-sheet (Asn164 to Ser169; NGIHYS) in CtCelD. Hence, mutation D468A or D468V in AaCel9A can produce an additive effect of hydrophobic interactions in an environment with high-density hydrophobic residues, which may significantly increase the rigidity around the Ca-B site; however, no such result was observed from mutation D523A of CtCelD. The formation of the hydrophobic interaction network near the catalytic site in mutant D468A or D468V could simply raise the enthalpy of the folded/active state (37). The single mutation A35V of GH12 endoglucanase

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

FIG 5 Structural comparison of GH9 endoglucanases. (A) Structural alignment of AaCel9A (PDB number 3EZ8) with other GH9 endoglucanases collected from the CAZy database, shown in cartoon-loop style using PyMOL. The Ca-B site of 3EZ8 and the corresponding regions in other GH9 endoglucanases, which are composed of continuous sequences (Arg458 to Val478 in 3EZ8), are magnified in the box on the right. Only 1CLC and 3EZ8 bind to Ca2⫹ at these regions. Ca2⫹ is not shown for clarity of demonstration. Residue numbers used to identify sequence ranges correspond to those in 3EZ8. The substrate-binding residues in 3EZ8, His461, and Arg463 and the corresponding residues in other GH9 endoglucanases are labeled with residue side chains. (B) Regions (labeled in squares) corresponding to the 3EZ8 Ca-B site in 4DOD, 2YIK, and 3WC3, which are presented in B-factor putty mode in PyMOL using B-factors of C␣ atoms only, are indicated. Enzyme optimal temperature is indicated beside each PDB code. The C␣ atom with the highest B factor in each structure is in red, and that with the lowest B factor is in dark blue, as indicated by the B-factor scale bar. The thickness of the protein backbone also is proportional to the B factors of C␣ atoms.

from Trichoderma reesei offers another example that significantly imparts protein thermostability (8°C in Tm) as a result of rigid network interactions (8). The improvement of protein compactness by optimizing the packing of protein structures is the significant characteristic of thermostable proteins (38). The thermal resistance of various enzymes depends on the various molecular interactions needed to achieve the rigid structure (5, 6, 8, 39). Hydrophobic and electrostatic interactions are the two key factors that allow superslow protein unfolding for hyperthermal proteins to function at ex-

March 2016 Volume 82 Number 6

treme temperatures (37). The Ca-B chelation of AaCel9A, which contributed to enzyme thermostability, could originate primarily from the Ca2⫹-induced hydrophobic interactions rather than directly from the polar interactions involved in Ca2⫹ coordination. The hydrophobic interactions induced by Ca-B in wild-type AaCel9A, which connects two secondary structures that are distant from each other in the primary sequence, likely are responsible for the increased thermostability. Mutation D468A or D468V simply enhances the interactions between the two secondary structures. Alternatively, mutant D468A or D468V exhibited an

Applied and Environmental Microbiology

aem.asm.org

1671

Wang et al.

example of metal-induced stability that is efficiently transformed into hydrophobic stability during protein evolution. The transformation is consistent with the findings of Rocha et al. (40), who reported that a hydrophobic core replacing the structural metal binding site enhances the thermostability of a zinc-deficient ferredoxin isoform. Both studies suggest that the locations of metal sites play significant roles in determining protein thermostability; therefore, the optimization of the interactions between protein metal sites and the surrounding structures toward the local stability may be an efficient strategy to improve protein thermostability. The inactivation of enzymes under high alkaline conditions is caused by the instability of the hydrophilic structure on the molecular surface (41, 42). Hence, increasing the hydrophobic interactions can adjust the alkalinity tolerance of proteins. The observed shift in optimal pH in mutant D468A is consistent with this theory (Fig. 3D). The single-base mutation D468A or D468V efficiently stabilized the Ca-B site and significantly enhanced AaCel9A thermostability (Fig. 2C and 3A to C). The increased stability of the Ca-B site at the corner region of the open active-site cleft could help preserve the integrity of the catalytic structure, thereby sustaining AaCel9A catalysis at high temperature (Fig. 1A and C). The Ca-B site immediately connects the loop containing the substrate-binding residues His461 and Arg463. Previous studies suggested that Ca-B binding can increase substrate-binding affinity, because the coordination residues Ile465, Asp468, and Val470 are located in the same loop region as the substrate-binding residues His461 and Arg463 (17, 18). These two substrate-binding residues belong to glycosyl-binding subsite ⫹1 and are strictly conserved in GH9 enzymes (7). Structure alignments of GH9 endoglucanases showed that the corresponding regions of the AaCel9A Ca-B site in other GH9 endoglucanases, located at the corner of their activesite clefts, also are adjacent to the substrate-binding residues of subsite ⫹1 in the primary sequence (Fig. 5A). Hence, the stability of the corresponding regions could influence the catalysis of GH9 endoglucanases by rigidifying the substrate-binding residues at the corner of their active-site clefts. Among the 10 GH9 endoglucanase structures in Fig. 5A, three monomeric endoglucanases (3WC3, 4DOD, and 2YIK) (Fig. 5B) with known optimal temperatures (43–45) exhibit very similar structures (RMSD of 4DOD and 3WC3, 1.52; RMSD of 4DOD and 2YIK, 1.99). These crystal structures display their catalytic domains without connecting to any accessory domains (i.e., binding domain or Ig-like domain). In addition, the regions corresponding to the AaCel9A Ca-B site in the three structures are not occupied by metal ions. 4DOD is the GH9 domain of Caldicellulosiruptor bescii CelA, which can operate optimally at 85°C (46). In contrast, the cold-adapted endoglucanase from Eisenia fetida (3WC3) has optimal activity at 40°C (43, 44). In addition, the optimal temperature of CelT from Clostridium thermocellum (2YIK) is 70°C (45), which is the same as that of AaCel9A. The regions corresponding to the AaCel9A Ca-B site in 3WC3, 4DOD, and 2YIK show a significant difference in flexibility based on their B factors (Fig. 5B). The peripheral region of the substrate-binding subsite ⫹1 in the hyperthermostable structure (4DOD) is a relatively lower B-factor region than that in 2YIK or 3WC3. In addition, the B-factor analysis of the Ca-B sites in wild -type AaCel9A and mutant D468A corresponding to their enzyme thermostability is consistent with the above-described findings (Fig. 2C and 3A to C). Hence, the stability of these corresponding

1672

aem.asm.org

regions, which are adjacent to the substrate-binding residues of glycoside subsite ⫹1, could significantly support the catalysis of GH9 endoglucanases at high temperature by sustaining the catalytic structures. The significant increases in AaCel9A thermostability accompanied by the enhanced specific activity of mutants D468A and D468V favor high-temperature cellulose hydrolysis to achieve a higher conversion rate and reduce the enzyme cost of cellulosic alcohol production (1, 15). The thermostable enzymes that catalyzed optimally under acid conditions (Fig. 3D) are preferable for lignocellulosic biomass hydrolysis after acid pretreatment (15). However, the increased thermostability and specific activity of mutants D468A and D468V come at costs. Increased Km (1.6-fold and 1.3-fold) (Table 1) means that the mutants are less specific for the enzyme substrate, and more substrate must be present to sustain maximal activity. Therefore, the introduced mutations may be of biotechnological interest but potentially are a disadvantage to A. acidocaldarius, which sees a much lower ␤-glucan concentration in the environment. In conclusion, the structure-based design of a catalysis-related calcium site showed that the single-base replacements of the calcium-binding residue with hydrophobic amino acid D468A or D468V led to the significant enhancement of AaCel9A thermostability accompanied by increased activity. Based on the D468A crystal structure, mutation D468A drove a conformational change of the Ca-B site similar to that induced by Ca-B binding in the wild-type structure and induced a rigid hydrophobic interaction network. This phenomenon may explain the significant increase in enzyme thermostability. The thermostable form of mutant D468A offers an interesting example of polarity adjustment of a metal site toward protein thermostability and activity from the structural point of view. The study also showed that the enhancement of the interactions between protein metal sites and the surrounding structures could be an efficient strategy to improve protein thermostability because of the critical locations of metal sites in affecting protein rigidity. Moreover, the structural analysis of GH9 endoglucanases suggested that the stabilization of the regions corresponding to the AaCel9A Ca-B site effectively benefit enzyme catalysis at high temperature, which in turn can help build thermoactive GH9 endoglucanases. ACKNOWLEDGMENTS X-ray data collection was carried out in part at the National Synchrotron Radiation Research Center (BL-15A1). The Synchrotron Radiation Protein Crystallography Facility is supported by the National Core Facility Program for Biotechnology. The VP-DSC used to measure Tm was supported by grant NSC-98-2321-B-009-002 from Ministry of Science and Technology, Taiwan (MOST).

FUNDING INFORMATION Ministry of Science and Technology, Taiwan (MOST) provided funding to Ching-Ping Tseng under grant number NSC-98-2321-B-009-002. The VP-DSC used to measure Tm was supported by grant NSC-98-2321B-009-002 from the Ministry of Science and Technology, Taiwan (MOST).

REFERENCES 1. Bhalla A, Bansal N, Kumar S, Bischoff KM, Sani RK. 2013. Improved lignocellulose conversion to biofuels with thermophilic bacteria and thermostable enzymes. Bioresour Technol 128:751–759. http://dx.doi.org/10 .1016/j.biortech.2012.10.145.

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6

Thermostability Design on a Cel9A Calcium Site

2. Dashtban M, Maki M, Leung KT, Mao C, Qin W. 2010. Cellulase activities in biomass conversion: measurement methods and comparison. Crit Rev Biotechnol 30:302–309. http://dx.doi.org/10.3109/07388551 .2010.490938. 3. Yennamalli RM, Rader AJ, Kenny AJ, Wolt JD, Sen TZ. 2013. Endoglucanases: insights into thermostability for biofuel applications. Biotechnol Biofuels 6:136. http://dx.doi.org/10.1186/1754-6834-6-136. 4. Mingardon F, Bagert JD, Maisonnier C, Trudeau DL, Arnold FH. 2011. Comparison of family 9 cellulases from mesophilic and thermophilic bacteria. Appl Environ Microbiol 77:1436 –1442. http://dx.doi.org/10.1128 /AEM.01802-10. 5. Yang TC, Legault S, Kayiranga EA, Kumaran J, Ishikawa K, Sung WL. 2012. The N-terminal beta-sheet of the hyperthermophilic endoglucanase from Pyrococcus horikoshii is critical for thermostability. Appl Environ Microbiol 78:3059 –3067. http://dx.doi.org/10.1128/AEM.07576-11. 6. Yi ZL, Wu ZL. 2010. Mutations from a family-shuffling-library reveal amino acid residues responsible for the thermostability of endoglucanase CelA from Clostridium thermocellum. Biotechnol Lett 32:1869 –1875. http: //dx.doi.org/10.1007/s10529-010-0363-0. 7. Eckert K, Vigouroux A, Lo Leggio L, Morera S. 2009. Crystal structures of A. acidocaldarius endoglucanase Cel9A in complex with cellooligosaccharides: strong ⫺1 and ⫺2 subsites mimic cellobiohydrolase activity. J Mol Biol 394:61–70. http://dx.doi.org/10.1016/j.jmb.2009.08.060. 8. Rader AJ, Yennamalli RM, Harter AK, Sen TZ. 2012. A rigid network of long-range contacts increases thermostability in a mutant endoglucanase. J Biomol Struct Dyn 30:628 – 637. http://dx.doi.org/10.1080/07391102 .2012.689696. 9. Choi WC, Kim MH, Ro HS, Ryu SR, Oh TK, Lee JK. 2005. Zinc in lipase L1 from Geobacillus stearothermophilus L1 and structural implications on thermal stability. FEBS Lett 579:3461–3466. http://dx.doi.org/10.1016/j .febslet.2005.05.016. 10. Kataeva IA, Uversky VN, Ljungdahl LG. 2003. Calcium and domain interactions contribute to the thermostability of domains of the multimodular cellobiohydrolase, CbhA, a subunit of the Clostridium thermocellum cellulosome. Biochem J 372:151–161. http://dx.doi.org/10.1042 /bj20021621. 11. Kumagai Y, Kawakami K, Mukaihara T, Kimura M, Hatanaka T. 2012. The structural analysis and the role of calcium binding site for thermal stability in mannanase. Biochimie 94:2783–2790. http://dx.doi.org/10 .1016/j.biochi.2012.09.012. 12. Smith CA, Toogood HS, Baker HM, Daniel RM, Baker EN. 1999. Calcium-mediated thermostability in the subtilisin superfamily: the crystal structure of Bacillus Ak.1 protease at 1.8 Å resolution. J Mol Biol 294: 1027–1040. http://dx.doi.org/10.1006/jmbi.1999.3291. 13. McKnight IC, Eiroa MN, Sant’Ana AS, Massaguer PR. 2010. Alicyclobacillus acidoterrestris in pasteurized exotic Brazilian fruit juices: isolation, genotypic characterization and heat resistance. Food Microbiol 27:1016 – 1022. http://dx.doi.org/10.1016/j.fm.2010.06.010. 14. Darland G, Brock TD. 1971. Bacillus acidocaldarius sp. nov., an acidophilic thermophilic spore-forming bacterium. J Gen Microbiol 67:9 –15. http://dx.doi.org/10.1099/00221287-67-1-9. 15. Blumer-Schuette SE, Brown SD, Sander KB, Bayer EA, Kataeva I, Zurawski JV, Conway JM, Adams MW, Kelly RM. 2014. Thermophilic lignocellulose deconstruction. FEMS Microbiol Rev 38:393– 448. http: //dx.doi.org/10.1111/1574-6976.12044. 16. Eckert K, Zielinski F, Lo Leggio L, Schneider E. 2002. Gene cloning, sequencing, and characterization of a family 9 endoglucanase (CelA) with an unusual pattern of activity from the thermoacidophile Alicyclobacillus acidocaldarius ATCC 27009. Appl Microbiol Biotechnol 60:428 – 436. http://dx.doi.org/10.1007/s00253-002-1131-4. 17. Pereira JH, Sapra R, Volponi JV, Kozina CL, Simmons B, Adams PD. 2009. Structure of endoglucanase Cel9A from the thermoacidophilic Alicyclobacillus acidocaldarius. Acta Crystallogr D Biol Crystallogr 65:744 – 750. http://dx.doi.org/10.1107/S0907444909012773. 18. Chauvaux S, Souchon H, Alzari PM, Chariot P, Beguin P. 1995. Structural and functional analysis of the metal-binding sites of Clostridium thermocellum endoglucanase CelD. J Biol Chem 270:9757–9762. http://dx .doi.org/10.1074/jbc.270.17.9757. 19. Parthasarathy S, Murthy MR. 2000. Protein thermal stability: insights from atomic displacement parameters (B values). Protein Eng 13:9 –13. http://dx.doi.org/10.1093/protein/13.1.9. 20. Smogyi M. 1952. Notes on sugar determination. J Biol Chem 195:19 –23. 21. Otwinowski Z, Minor W. 1997. Processing of X-ray diffraction data

March 2016 Volume 82 Number 6

22. 23. 24.

25.

26. 27.

28.

29.

30.

31.

32.

33.

34.

35. 36. 37.

38.

39. 40.

collected in oscillation mode. Macromol Crystallogr A 276:307–326. http: //dx.doi.org/10.1016/S0076-6879(97)76066-X. Potterton E, Briggs P, Turkenburg M, Dodson E. 2003. A graphical user interface to the CCP4 program suite. Acta Crystallogr D Biol Crystallogr 59:1131–1137. http://dx.doi.org/10.1107/S0907444903008126. Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60:2126 –2132. http://dx.doi .org/10.1107/S0907444904019158. Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH. 2010. PHENIX: a comprehensive Pythonbased system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66:213–221. http://dx.doi.org/10.1107/S0907444 909052925. Kobayashi M, Hondoh H, Mori H, Saburi W, Okuyama M, Kimura A. 2011. Calcium ion-dependent increase in thermostability of dextran glucosidase from Streptococcus mutans. Biosci Biotechnol Biochem 75:1557– 1563. http://dx.doi.org/10.1271/bbb.110256. Yang W, Lee HW, Hellinga H, Yang JJ. 2002. Structural analysis, identification, and design of calcium-binding sites in proteins. Proteins 47: 344 –356. http://dx.doi.org/10.1002/prot.10093. Ha NC, Oh BC, Shin S, Kim HJ, Oh TK, Kim YO, Choi KY, Oh BH. 2000. Crystal structures of a novel, thermostable phytase in partially and fully calcium-loaded states. Nat Struct Biol 7:147–153. http://dx.doi.org /10.1038/72421. Zhang JH, Lin Y, Sun YF, Ye YR, Zheng SP, Han SY. 2012. Highthroughput screening of B factor saturation mutated Rhizomucor miehei lipase thermostability based on synthetic reaction. Enzyme Microb Technol 50:325–330. http://dx.doi.org/10.1016/j.enzmictec.2012.03.002. Lee CW, Wang HJ, Hwang JK, Tseng CP. 2014. Protein thermal stability enhancement by designing salt bridges: a combined computational and experimental study. PLoS One 9:e112751. http://dx.doi.org/10.1371 /journal.pone.0112751. Reetz MT, Carballeira JD, Vogel A. 2006. Iterative saturation mutagenesis on the basis of B factors as a strategy for increasing protein thermostability. Angew Chem Int Ed Engl 45:7745–7751. http://dx.doi.org/10 .1002/anie.200602795. Liu W, Zhang XZ, Zhang Z, Zhang YH. 2010. Engineering of Clostridium phytofermentans endoglucanase Cel5A for improved thermostability. Appl Environ Microbiol 76:4914 – 4917. http://dx.doi.org/10.1128/AEM .00958-10. Yi ZL, Pei XQ, Wu ZL. 2011. Introduction of glycine and proline residues onto protein surface increases the thermostability of endoglucanase CelA from Clostridium thermocellum. Bioresour Technol 102:3636 –3638. http: //dx.doi.org/10.1016/j.biortech.2010.11.043. Anbar M, Lamed R, Bayer EA. 2010. Thermostability enhancement of Clostridium thermocellum cellulosomal endoglucanase Cel8A by a single glycine substitution. Chemcatchem 2:997–1003. http://dx.doi.org/10 .1002/cctc.201000112. Anbar M, Gul O, Lamed R, Sezerman UO, Bayer EA. 2012. Improved thermostability of Clostridium thermocellum endoglucanase Cel8A by using consensus-guided mutagenesis. Appl Environ Microbiol 78:3458 – 3464. http://dx.doi.org/10.1128/AEM.07985-11. Juy MAA, Alzari PM, Poljak RJ, Claeyssens M, Béguin P, Aubert JP. 1992. Three-dimensional structure of a thermostable bacterial cellulase. Nature 357:89 –91. http://dx.doi.org/10.1038/357089a0. Chauvaux S, Beguin P, Aubert JP. 1992. Site-directed mutagenesis of essential carboxylic residues in Clostridium thermocellum endoglucanase CelD. J Biol Chem 267:4472– 4478. Luke KA, Higgins CL, Wittung-Stafshede P. 2007. Thermodynamic stability and folding of proteins from hyperthermophilic organisms. FEBS J 274:4023– 4033. http://dx.doi.org/10.1111/j.1742-4658.2007 .05955.x. Robinson-Rechavi M, Alibes A, Godzik A. 2006. Contribution of electrostatic interactions, compactness and quaternary structure to protein thermostability: lessons from structural genomics of Thermotoga maritima. J Mol Biol 356:547–557. http://dx.doi.org/10.1016/j.jmb.2005.11 .065. Vieille C, Zeikus GJ. 2001. Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 65:1– 43. http://dx.doi.org/10.1128/MMBR.65.1.1-43.2001. Rocha R, Leal SS, Teixeira VH, Regalla M, Huber H, Baptista AM,

Applied and Environmental Microbiology

aem.asm.org

1673

Wang et al.

Soares CM, Gomes CM. 2006. Natural domain design: enhanced thermal stability of a zinc-lacking ferredoxin isoform shows that a hydrophobic core efficiently replaces the structural metal site. Biochemistry 45:10376 – 10384. http://dx.doi.org/10.1021/bi0610698. 41. Maeda H, Mizutani O, Yamagata Y, Ichishima E, Nakajima T. 2001. Alkaline-resistance model of subtilisin ALP I, a novel alkaline subtilisin. J Biochem 129:675– 682. http://dx.doi.org/10.1093/oxfordjournals.jbchem .a002906. 42. Oguchi Y, Maeda H, Abe K, Nakajima T, Uchida T, Yamagata Y. 2006. Hydrophobic interactions between the secondary structures on the molecular surface reinforce the alkaline stability of serine protease. Biotechnol Lett 28:1383– 1391. http://dx.doi.org/10.1007/s10529-006-9100-0. 43. Arimori T, Ito A, Nakazawa M, Ueda M, Tamada T. 2013. Crystal structure of endo-1,4-beta-glucanase from Eisenia fetida. J Synchrotron Radiat 20:884 – 889. http://dx.doi.org/10.1107/S0909049513021110.

1674

aem.asm.org

44. Lochner A, Giannone RJ, Rodriguez M, Jr, Shah MB, Mielenz JR, Keller M, Antranikian G, Graham DE, Hettich RL. 2011. Use of label-free quantitative proteomics to distinguish the secreted cellulolytic systems of Caldicellulosiruptor bescii and Caldicellulosiruptor obsidiansis. Appl Environ Microbiol 77:4042– 4054. http://dx.doi.org/10 .1128/AEM.02811-10. 45. Kesavulu MM, Tsai JY, Lee HL, Liang PH, Hsiao CD. 2012. Structure of the catalytic domain of the Clostridium thermocellum cellulase CelT. Acta Crystallogr D Biol Crystallogr 68:310 –320. http://dx.doi.org/10.1107 /S0907444912001990. 46. Brunecky R, Alahuhta M, Xu Q, Donohoe BS, Crowley MF, Kataeva IA, Yang SJ, Resch MG, Adams MW, Lunin VV, Himmel ME, Bomble YJ. 2013. Revealing nature’s cellulase diversity: the digestion mechanism of Caldicellulosiruptor bescii CelA. Science 342:1513–1516. http://dx.doi.org /10.1126/science.1244273.

Applied and Environmental Microbiology

March 2016 Volume 82 Number 6