Molecular and Cellular Probes (1990) 4, 1 8 9 -191
Polymerase chain reaction amplification of rabies virus nucleic acids from total mouse brain RNA
A. Ermine,* D . Larzul,2 P . E . Ceccaldi, J.-L. Guesdon 2 and H . Tsiang 'Unité Rage Recherche and 'Laboratoire des sondes froides, Institut Pasteur, 25, rue du Docteur Roux, 75724 Paris, Cedex 15 France (Received 6 November 1989, Accepted 7 November 1989)
In an attempt to improve the sensitivity of the rabies genome hybridization test, PCR amplification was used following reverse transcription of rabies RNA extracted from infected brain . Presence of amplified DNA is demonstrated with either cDNA synthesized from the antigenomic primer or from antimessenger primer .
KEYWORDS: rabies virus, RNA genome, polymerase chain reaction, dot-blot hybridization .
In addition to the classical techniques for rabies virus diagnosis (immunofluorescence, mouse inoculation and tissue culture procedures),' direct detection of rabies virus RNA by dot hybridization analysis is now possible . 2 In comparison with previous techniques the dot hybridization assay is technically simple and of high specificity. Furthermore, it allows detection of rabies virus RNA in 'post mortem' tissue over 40 days old and so could prove useful for extensive, field-trial, epidemiological studies . In an attempt to improve the sensitivity of the hybridization test, 'in vitro' polymerase-chain reaction (PCR) amplification was used to increase the number of viral sequences before hybridization . PCR has previously been shown to increase the amplification yield of nucleic acid sequences by a factor of 3 X 10s 3,4 As rabies virus contains a negative strand RNA genome, prior reverse transcription of the genome into cDNA is required . Rabies virus cDNA was synthesized from rabies-infected brain RNA extracted by the following simple and rapid procedure : total cellular RNA was extracted from infected brain (1 g) with 2 ml of 50% (v/v) phenol in extraction solution (1% (w/v) NP-40, 1 % (w/v) SDS, 1 mm EDTA, 50 µg ml - ' dextran sulphate) . After centrifugation (14,000g for 30 min at 20°C) the aqueous phase was ethanol precipitated and the pellet washed twice in 70% (v/v) ethanol then dried and resuspended in 500 µ1 of sterile water . *Author to whom correspondence should be addressed . 0890-850$/90/030189+03 $03 .00/0
© 1990 Academic Press Limited 189
1 90
A. Ermine et al .
Total RNA (1 gg) was denatured (5 min at 65 ° C) and primers (antigenomic : 121-140 b, GAAGCCTGAGATTATCGTGG ; antimessenger: 428-450 b, CCATGCCTCCTGTCAGAGCCC ; obtained from published sequences"' annealed to the RNA for 30 min at 42 ° C . Following reverse transcription of the RNA (42°C for 1 h) in 50 gl of enzyme buffer, (4dNTP (500 gm each) and primer (1 lam)) and Moloney virus reverse transcriptase (2000 : Gibco), 30 cycles of PCR were performed as previously described .' Analysis of the product by agarose gel electrophoresis (Fig . 1) demonstrated the presence of amplified DNA with either cDNA synthesized from the antigenornic primer (lane b) or from antimessenger primer (lane c) . The amplified DNA fragment corresponds in size to the distance between the two primers (329 bps) and was specifically detected on Southern blots with probes complementary to the N-gene region (lane a) and not from any of the other rabies virus genome areas . The PCR procedure, for rabies virus genome amplification, is reproducible and amplified DNA fragment concentration is related to the number of PCR cycles (Fig . 2) . Moreover, the PCR-procedure is a powerful technique for determination of rabies and rabiesrelated strains and for extensive sequencing and pathogenic studies . The sensitivity and selectivity of the dot hybridization procedure following PCR could prove useful for rabies virus diagnosis, particularly during the early stages of inoculation . Furthermore, PCR also allows increased amplification of target maternal enabling high concentrations of rabies virus nucleic acids to be obtained . Moreover, the ease of purification and hybridization procedures is the first step towards the
a
b
C
Fig . 1 . Analysis of PCR products by agarose gel electrophoresis : (a) detection on Southern blots with probes complementary to the N gene region ; (b) amplified DNA with cDNA synthesized from antigenomic primer ; or (c) from antimessenger primer.
PCR amplification of rabies virus nucleic acids
5 RV
10 RV
15 C
RV
20 C
RV
25
1
C
191
RV
C
Fig. 2. Amplified DNA fragment detection after 5, 10, 15, 20, 25, 30 PCR cycles . RV: Rabies virus; C : control .
automation of rabies virus diagnosis . Additional studies should be performed to determine the sensitivity and specificity of this system for the detection of rabies virus in clinical specimens . ACKNOWLEDGEMENTS We are grateful to Brian Lockhart for help and advice during preparation of the manuscript . This work was partially supported by the Fondation pour la Recherche Médicale .
REFERENCES 1 . Webster, W. A . & Casey, G . A . (1988) . Diagnosis of Rabies Infection . In Rabies . (Campbell, J. B . & Chariton, K . M ., eds) pp . 201-22. Boston/ Dordrecht/London : Kluwer Academic Publishers . 2 . Ermine, A ., Tordo, N . & Tsiang, H . (1988) . A rapid diagnosis of the rabies infection through a dot hybridization assay . Molecular and Cellular Probes 2, 75-82 . 3 . Saiki, R. K ., Scharf, S . & Falooma, F . (1985) . Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4 . 4 . Larzul, D ., Guigue, F ., Sninsky, J . J ., Mack, D . H ., Brechot, C . & Guesdon, J .-L . (1988) . Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification . Journal of Virological Methods 20, 227-37 . 5 . Tordo, N ., Poch, O., Ermine, A . & Keith, G. (1986) . Primary structure of leader RNA and nucleoprotein genes of the rabies genome : segmented homology with VSV . Nucleic Acid Research 14 .6, 2671-83 . 6 . Poch, O ., Tordo, N . & Keith, G . (1988) . Sequence of the 3386 3' nucleotides of the genome of the AVO1 strain rabies virus : structural similarities in the protein regions involved in transcription . Biochimie 70, 1019-25 . 7 . Larzul, D ., Chevrier, D . & Guesdon, J .-L . (1989) . A non-radioactive diagnostic test for the detection of HBV DNA sequences in serum at the single molecule level . Molecular and Cellular Probes 3, 45-57 . 8. Ermine, A ., Tsiang, H ., Tordo, N . & Sureau, P . (1989) . Rabies diagnosis with 32P probes on filtered dot blots . (Turano, A., Balows, A . & Tilton, R . C ., eds), In Rapid Methods and Automation in Microbiology and immunology pp . 513-20 . Brescia: Brixia Academic Press .
Polymerase chain reaction amplification of rabies virus nucleic acids from total mouse brain RNA
A. Ermine,* D . Larzul,2 P . E . Ceccaldi, J.-L. Guesdon 2 and H . Tsiang 'Unité Rage Recherche and 'Laboratoire des sondes froides, Institut Pasteur, 25, rue du Docteur Roux, 75724 Paris, Cedex 15 France (Received 6 November 1989, Accepted 7 November 1989)
In an attempt to improve the sensitivity of the rabies genome hybridization test, PCR amplification was used following reverse transcription of rabies RNA extracted from infected brain . Presence of amplified DNA is demonstrated with either cDNA synthesized from the antigenomic primer or from antimessenger primer .
KEYWORDS: rabies virus, RNA genome, polymerase chain reaction, dot-blot hybridization .
In addition to the classical techniques for rabies virus diagnosis (immunofluorescence, mouse inoculation and tissue culture procedures),' direct detection of rabies virus RNA by dot hybridization analysis is now possible . 2 In comparison with previous techniques the dot hybridization assay is technically simple and of high specificity. Furthermore, it allows detection of rabies virus RNA in 'post mortem' tissue over 40 days old and so could prove useful for extensive, field-trial, epidemiological studies . In an attempt to improve the sensitivity of the hybridization test, 'in vitro' polymerase-chain reaction (PCR) amplification was used to increase the number of viral sequences before hybridization . PCR has previously been shown to increase the amplification yield of nucleic acid sequences by a factor of 3 X 10s 3,4 As rabies virus contains a negative strand RNA genome, prior reverse transcription of the genome into cDNA is required . Rabies virus cDNA was synthesized from rabies-infected brain RNA extracted by the following simple and rapid procedure : total cellular RNA was extracted from infected brain (1 g) with 2 ml of 50% (v/v) phenol in extraction solution (1% (w/v) NP-40, 1 % (w/v) SDS, 1 mm EDTA, 50 µg ml - ' dextran sulphate) . After centrifugation (14,000g for 30 min at 20°C) the aqueous phase was ethanol precipitated and the pellet washed twice in 70% (v/v) ethanol then dried and resuspended in 500 µ1 of sterile water . *Author to whom correspondence should be addressed . 0890-850$/90/030189+03 $03 .00/0
© 1990 Academic Press Limited 189
1 90
A. Ermine et al .
Total RNA (1 gg) was denatured (5 min at 65 ° C) and primers (antigenomic : 121-140 b, GAAGCCTGAGATTATCGTGG ; antimessenger: 428-450 b, CCATGCCTCCTGTCAGAGCCC ; obtained from published sequences"' annealed to the RNA for 30 min at 42 ° C . Following reverse transcription of the RNA (42°C for 1 h) in 50 gl of enzyme buffer, (4dNTP (500 gm each) and primer (1 lam)) and Moloney virus reverse transcriptase (2000 : Gibco), 30 cycles of PCR were performed as previously described .' Analysis of the product by agarose gel electrophoresis (Fig . 1) demonstrated the presence of amplified DNA with either cDNA synthesized from the antigenornic primer (lane b) or from antimessenger primer (lane c) . The amplified DNA fragment corresponds in size to the distance between the two primers (329 bps) and was specifically detected on Southern blots with probes complementary to the N-gene region (lane a) and not from any of the other rabies virus genome areas . The PCR procedure, for rabies virus genome amplification, is reproducible and amplified DNA fragment concentration is related to the number of PCR cycles (Fig . 2) . Moreover, the PCR-procedure is a powerful technique for determination of rabies and rabiesrelated strains and for extensive sequencing and pathogenic studies . The sensitivity and selectivity of the dot hybridization procedure following PCR could prove useful for rabies virus diagnosis, particularly during the early stages of inoculation . Furthermore, PCR also allows increased amplification of target maternal enabling high concentrations of rabies virus nucleic acids to be obtained . Moreover, the ease of purification and hybridization procedures is the first step towards the
a
b
C
Fig . 1 . Analysis of PCR products by agarose gel electrophoresis : (a) detection on Southern blots with probes complementary to the N gene region ; (b) amplified DNA with cDNA synthesized from antigenomic primer ; or (c) from antimessenger primer.
PCR amplification of rabies virus nucleic acids
5 RV
10 RV
15 C
RV
20 C
RV
25
1
C
191
RV
C
Fig. 2. Amplified DNA fragment detection after 5, 10, 15, 20, 25, 30 PCR cycles . RV: Rabies virus; C : control .
automation of rabies virus diagnosis . Additional studies should be performed to determine the sensitivity and specificity of this system for the detection of rabies virus in clinical specimens . ACKNOWLEDGEMENTS We are grateful to Brian Lockhart for help and advice during preparation of the manuscript . This work was partially supported by the Fondation pour la Recherche Médicale .
REFERENCES 1 . Webster, W. A . & Casey, G . A . (1988) . Diagnosis of Rabies Infection . In Rabies . (Campbell, J. B . & Chariton, K . M ., eds) pp . 201-22. Boston/ Dordrecht/London : Kluwer Academic Publishers . 2 . Ermine, A ., Tordo, N . & Tsiang, H . (1988) . A rapid diagnosis of the rabies infection through a dot hybridization assay . Molecular and Cellular Probes 2, 75-82 . 3 . Saiki, R. K ., Scharf, S . & Falooma, F . (1985) . Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4 . 4 . Larzul, D ., Guigue, F ., Sninsky, J . J ., Mack, D . H ., Brechot, C . & Guesdon, J .-L . (1988) . Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification . Journal of Virological Methods 20, 227-37 . 5 . Tordo, N ., Poch, O., Ermine, A . & Keith, G. (1986) . Primary structure of leader RNA and nucleoprotein genes of the rabies genome : segmented homology with VSV . Nucleic Acid Research 14 .6, 2671-83 . 6 . Poch, O ., Tordo, N . & Keith, G . (1988) . Sequence of the 3386 3' nucleotides of the genome of the AVO1 strain rabies virus : structural similarities in the protein regions involved in transcription . Biochimie 70, 1019-25 . 7 . Larzul, D ., Chevrier, D . & Guesdon, J .-L . (1989) . A non-radioactive diagnostic test for the detection of HBV DNA sequences in serum at the single molecule level . Molecular and Cellular Probes 3, 45-57 . 8. Ermine, A ., Tsiang, H ., Tordo, N . & Sureau, P . (1989) . Rabies diagnosis with 32P probes on filtered dot blots . (Turano, A., Balows, A . & Tilton, R . C ., eds), In Rapid Methods and Automation in Microbiology and immunology pp . 513-20 . Brescia: Brixia Academic Press .
