117
Molecular and Biochemical Parasitology, 48 (1991) 117 120 ((2) 1991 Elsevier Science Publishers B.V. / 0166-6851/91/$03.50 ADONIS 016668519100320S MOLBIO 01593
Short Communication
Polymorphic repeated DNA element in the genome of Schistosoma mansoni L o r e t t a D. S p o t i l a 1'2., D a v i d M . R e k o s h 1'2 a n d Philip T. L o V e r d e 1 1Department of Microbiology and 2Department of Biochemistry, State University of New York, BuJfalo, N Y, U.S.A. (Received 19 March 1991; accepted 30 April 1991)
Key words: Hypervariable DNA; D N A fingerprint; Transcription of repeated DNA
The genome of Schistosoma mansoni is comprised of about 35% repeated D N A sequences which are reiterated from 10 to 10000 times [1]. We [2] and others [3-8] have characterized some of these repeated elements. Here, we report the partial characterization of a highly polymorphic repeated element which is present on many m R N A transcripts. Genomic clones containing the repeated element were unintentionally isolated in an attempt to screen a genomic library for sequences preferentially transcribed in male worms [9,10]. The genomic inserts of three clones, chosen at random, shared several features: (1) absence of restriction sites for EcoRI, HindIII, SalI, ScaI, AluI, HaeIII, HpaII and Sau3A; (2) presence of restriction sites for RsaI and HinfI; (3) identical size of some RsaI and HinfI fragments; and (4) hybridization to a heterogeneous population of m R N A transcripts. The RsaI fragments from one genomic clone were subcloned into Correspondence address: P.T. LoVerde, Department of Microbiology, 203 Sherman Hall, SUNY, Buffalo, NY 14214, U.S.A. *Present address." Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Jefferson Medical College, Philadelphia, PA, U.S.A.
Note; Nucleotide sequence data reported in this paper have been submitted to the GenBank T M data base with the accession number M63265.
the vector p G E M B l u e (ProMega). One subclone, pGemSM3, when used as a probe on a blot of worm m R N A gave the same heterogeneous pattern observed when the parent genomic clone was used as a similar probe (Fig. 1A). The pattern of hybridization suggested that many m R N A transcripts of diverse sizes contained elements with some homology to at least a portion of the genomic fragment used as probe. In order to begin to elucidate what kind of m R N A transcript might be responsible for this observation, we next screened a S. mansoni adult worm 2gtl0 c D N A library with pGemSM3. Approximately 0.03% of the clones from the amplified adult worm c D N A library gave a positive signal. One clone was analyzed further. First, the 750-bp insert of the 2gtl0 c D N A clone was recloned into pGEMBIue and called pGemSM750. In vitro transcription from either the SP6 or the T7 promoter of the vector permitted assignment of coding strand. When the SP6 transcript was used as a probe on a Northern blot, the pattern in Fig. 1B was obtained. When the T7 transcript was used as a probe on an identical blot, there was no hybridization signal (data not shown). Sequence analysis of the insert of pGemSM750 confirmed the coding strand assignment in that the poly(A) tract was located proximal to the SP6 promoter (Fig. 2). Sequence analysis of the c D N A insert revealed several other features. (1) There was
ll8
A
9o"
B
9d
C E
9
I
I
I\\X'l,XXX\l~x \\\',l\\\\'l~\\\'-,l /
N
/
\
/
\
/
9.5--
\
/
7.5--
\
/
\
/
\
/ 4.4--
\
,/
4.4i
\
/
\
/
', 2.4-
\
/
\
/
N \
CCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTAT~GTCTATAST
1.4-i I
CLOSED READING FRAME I OPEN READING FRAME REPEAT REGION POLY-A TAIL
0.3Fig. 1. Autoradiograms of hybridization to S. mansoni m R N A by (A) genomic subclone pGemSM3; (B) SP6 in vitro transcript of pGemSM750; (C) oligonucleotide synthesized to a portion of the repeated element in the clone pGemSM750 (underlined in Fig. 2). Total R N A was extracted from adult worms (3) and poly(A)" R N A isolated [15]. The R N A was denatured with glyoxal, electrophoresed through 1.4% agarose gels containing glyoxal and then transferred to nitrocellulose filters. Hybridization for A and B was at 4 2 C in 50% formamide, and washing was done at 55'C with 0.1 x SSC. Hybridization in C was at 47~C [14], and the final wash was at 47°C in 6 x SSC. The probes were labeled by standard procedures: p G e m S M 3 by random priming [15], pGemSM750 by in vitro transcription (protocol supplied by manufacturer, BRL), and the oligonucleotide by T4 polynucleotide kinase [15]. Size markers are the R N A ladder (BRL).
no single continuous open reading frame (ORF). The longest O R F was 71 amino acids long (Fig. 2), and it did not significantly resemble any sequence in the GenBank data base. (2) A consensus poly(A) addition site was not located 5' to the poly(A) tail. (3) There were 5 complete copies of a 62-bp direct repeat located 5' to the poly(A) tail. A portion of the first copy of the repeat was included in the ORF. (4) The 62-bp repeat was composed of a tandemly repeated subsequence with the consensus motif of 5'-CCTT(T/A)TAGT-3'. To determine if the repeat was responsible for the complex m R N A hybridization pattern, we synthesized an oligonucleotide which was the reverse complement of the first 19 nucleotides (underlined in Fig. 2). This was then used
Fig. 2. Diagram of the insert of pGemSM750. The cloning site was EcoRI (E in figure). The SP6 in vitro transcription promoter of the vector is located to the right of the insert and the T7 promoter is located to the left. One copy of the nucleotide sequence of the 62 bp repeat is shown in the sense orientation; an oligonucleotide in the anti-sense orientation was synthesized (underlined). The entire D N A sequence of the pGemSM750 insert is available from the GenBank data base under accession number M63265.
as a probe on a Northern blot (Fig. I C) and did account for much of the signal seen with the previous 2 probes (Fig. 1A, 1B). The oligonucleotide was then used as a probe on a blot of D N A isolated from male and female worms and digested with RsaI. Approximately 15 bands ranging in size from less than 0.5 kb to 4 kb were observed. There were some minor differences in the size of the DNA fragments obtained from each sex (data not shown). To test whether this could be due to population heterogeneity, we examined DNA from adult worms which had matured from cercariae that were the products of monomiracidial infections (Fig. 3A). Lanes 1-5 each have DNA digested with RsaI from one isogenic population of adult worms. There were 6-9 major bands ranging in size from less than 0.5 kb to more than 4 kb; some bands were shared by more than one population, others were distinct. The DNA from the cercariae which gave rise to the adults whose DNA was analyzed in Fig. 3A was similarly analyzed (Fig. 3B). Although the electrophor-
ll9
B
A
1
2
3
4
5
1 2 3
6
4
4.0--
3.0N
2.0- i 1.6-
2.0 1.6 1.0
a
0.5-
4.0 3.0
u
ID
0.5 A
•
ii
I~i~i
Fig. 3. Autoradiograms of hybridization of the labeled oligonucleotide (underlined in Fig. 2) to D N A from (A) adult worms and (B) cercariae. Lanes 1 5 contain D N A from individual populations which were the result of monomiracidial infections. Lane 6 (A) contains a mixture of D N A from the adults in lanes 1 5. D N A was extracted (2), digested with Rsal and electrophoresed at 20 V for 16 h (A) or 50 V for 5 h (B). After staining the D N A was transferred to Zetabind (Cuno, Inc.) and hybridized as in Fig. 1.
esis conditions were different, the banding pattern from each cercariae population matched the pattern from its respective adult population in terms of the size and number of bands and the relative intensities of the hybridization signals. (There was insufficient D N A from the cercariae in lane 4, Fig. 3B, to detect a signal.) The miracidia from which these infections were begun were from the N M R I strain of S. mansoni, a highly inbred laboratory strain originally isolated from Puerto Rico [11]. The high degree of polymorphism among individuals therefore suggested that these sequence elements undergo rearrangement frequently, perhaps in the germ line. There are hypervariable regions in the human genome that occur at many loci and are made up of tandemly repeated elements sharing a common core sequence [12,13]. The pattern of restriction fragments observed with a hypervariable repeat serves as a ' D N A fingerprint' of the individual from whom the
D N A was isolated [12,13]. The extent of the polymorphism observed with the S. mansoni repeat suggests that it could be used to identify individual worms or subpopulations of worms. There are two areas of investigation which might be pursued to determine the significance of the repeat studied here. First, additional c D N A clones could be analyzed to determine whether the repeat occurs on a particular subclass of related mRNAs. Second, in situ hybridization of the cloned repeat to S. mansoni chromosomes could be analyzed to determine if the repeat is located at a particular subchromosomal region such as the centromere or the telomere.
Acknowledgements The research reported herein was supported in part by grant R22AI18867 and a N R S A (AI07161) to LDS. This study was conducted as part of the Center for Applied Molecular
120
Biology and Immunology of the State University of New York at Buffalo. References 1 Simpson, A.J.G., Sher, A. and McCutchan, T.F. (1982) The genome of Schistosoma mansoni: isolation of DNA, its size, bases and repetitive sequences. Mol. Biochem. Parasitol. 6, 125-137. 2 Spotila, L.D., Hirai, H., Rekosh, D.M. and LoVerde, P.T. (1989) A retroposon-like short repetitive DNA element in the genome of the human blood fluke, Schistosoma mansoni. Chromosoma 97, 421-428. 3 van Keulen, H., LoVerde, P.T., Bobek, L.A. and Rekosh, D.M. (1985) Organization of the ribosomal RNA genes in Schistosoma mansoni. Mol. Biochem. Parasitol. 15, 215-230. 4 McCutchan, T.F., Simpson, A.J.G., Mullins, J.A., Sher, A., Nash, T.E., Lewis, F. and Richards, C. (1984) Differentiation of schistosomes by species, strain and sex by using cloned DNA markers. Proc. Natl. Acad. Sci. USA 81,889-893. 5 Walker, T.K., Rollinson, D. and Simpson, A.J.G. (1989) A DNA probe from Schistosoma mansoni allows rapid determination of the sex of larval parasites. Mol. Biochem. Parasitol. 33, 93 100. 6 Webster, P., Mansour, T.E. and Bieber, D. (1989) Isolation of a female-specific highly repeated Schistosoma mansoni DNA probe and its use in an assay of cercarial sex. Mol. Biochem. Parasitol. 36, 217 222. 7 Hamburger, J., Turetski, T., Kapeller, I. and Deresiewicz, R. (1991) Highly repeated short DNA sequences in the genome of Schistosoma mansoni recognized by a
species-specific probe. Mol. Biochem. Parasitol. 44, 73 80. 8 Nara, T., lwamura, Y., Tanaka, M., lrie, Y. and Yasuraoka, K. (1990) Dynamic changes of DNA sequences in Schistosoma mansoni in the course of development. Parasitology 100, 241 245. 9 Mangiarotti, G., Chung, S., Zuker, C. and Lodish, H.F. (1981) Selection and analysis of cloned developmentally-regulated Dictyostelium discoideum genes by hybridization-competition. Nucleic Acids Res. 9, 947 963. 10 Love, J.D. and Minton, K.W. (1985) Screening of a 2 library for differentially expressed genes using in vitro transcripts. Anal. Biochem. 150, 429-441. 11 Fletcher, M., LoVerde, P.T. and Woodruff, D.S. (1981) Genetic variation in Schistosoma rnansoni: enzyme polymorphisms in populations from Africa, Southwest Asia, South America and the West Indies. Am. J. Trop. Med. Hyg. 30, 406M21. 12 Jeffreys, A.J., Wilson, V. and Thein, S.L. (1985) Hypervariable 'minisatellite' regions in human DNA. Nature 314, 67 73. 13 Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E. and White, R. (1987) Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235, 1616-1622. 14 Schafer, R., Boltz, E., Becker, A., Bartels, F. and Epplen, J.T. (1986) The expression of the evolutionarily conserved GATA/GACA repeats in mouse tissues. Chromosoma 93,496-501. 15 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Molecular and Biochemical Parasitology, 48 (1991) 117 120 ((2) 1991 Elsevier Science Publishers B.V. / 0166-6851/91/$03.50 ADONIS 016668519100320S MOLBIO 01593
Short Communication
Polymorphic repeated DNA element in the genome of Schistosoma mansoni L o r e t t a D. S p o t i l a 1'2., D a v i d M . R e k o s h 1'2 a n d Philip T. L o V e r d e 1 1Department of Microbiology and 2Department of Biochemistry, State University of New York, BuJfalo, N Y, U.S.A. (Received 19 March 1991; accepted 30 April 1991)
Key words: Hypervariable DNA; D N A fingerprint; Transcription of repeated DNA
The genome of Schistosoma mansoni is comprised of about 35% repeated D N A sequences which are reiterated from 10 to 10000 times [1]. We [2] and others [3-8] have characterized some of these repeated elements. Here, we report the partial characterization of a highly polymorphic repeated element which is present on many m R N A transcripts. Genomic clones containing the repeated element were unintentionally isolated in an attempt to screen a genomic library for sequences preferentially transcribed in male worms [9,10]. The genomic inserts of three clones, chosen at random, shared several features: (1) absence of restriction sites for EcoRI, HindIII, SalI, ScaI, AluI, HaeIII, HpaII and Sau3A; (2) presence of restriction sites for RsaI and HinfI; (3) identical size of some RsaI and HinfI fragments; and (4) hybridization to a heterogeneous population of m R N A transcripts. The RsaI fragments from one genomic clone were subcloned into Correspondence address: P.T. LoVerde, Department of Microbiology, 203 Sherman Hall, SUNY, Buffalo, NY 14214, U.S.A. *Present address." Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Jefferson Medical College, Philadelphia, PA, U.S.A.
Note; Nucleotide sequence data reported in this paper have been submitted to the GenBank T M data base with the accession number M63265.
the vector p G E M B l u e (ProMega). One subclone, pGemSM3, when used as a probe on a blot of worm m R N A gave the same heterogeneous pattern observed when the parent genomic clone was used as a similar probe (Fig. 1A). The pattern of hybridization suggested that many m R N A transcripts of diverse sizes contained elements with some homology to at least a portion of the genomic fragment used as probe. In order to begin to elucidate what kind of m R N A transcript might be responsible for this observation, we next screened a S. mansoni adult worm 2gtl0 c D N A library with pGemSM3. Approximately 0.03% of the clones from the amplified adult worm c D N A library gave a positive signal. One clone was analyzed further. First, the 750-bp insert of the 2gtl0 c D N A clone was recloned into pGEMBIue and called pGemSM750. In vitro transcription from either the SP6 or the T7 promoter of the vector permitted assignment of coding strand. When the SP6 transcript was used as a probe on a Northern blot, the pattern in Fig. 1B was obtained. When the T7 transcript was used as a probe on an identical blot, there was no hybridization signal (data not shown). Sequence analysis of the insert of pGemSM750 confirmed the coding strand assignment in that the poly(A) tract was located proximal to the SP6 promoter (Fig. 2). Sequence analysis of the c D N A insert revealed several other features. (1) There was
ll8
A
9o"
B
9d
C E
9
I
I
I\\X'l,XXX\l~x \\\',l\\\\'l~\\\'-,l /
N
/
\
/
\
/
9.5--
\
/
7.5--
\
/
\
/
\
/ 4.4--
\
,/
4.4i
\
/
\
/
', 2.4-
\
/
\
/
N \
CCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTAT~GTCTATAST
1.4-i I
CLOSED READING FRAME I OPEN READING FRAME REPEAT REGION POLY-A TAIL
0.3Fig. 1. Autoradiograms of hybridization to S. mansoni m R N A by (A) genomic subclone pGemSM3; (B) SP6 in vitro transcript of pGemSM750; (C) oligonucleotide synthesized to a portion of the repeated element in the clone pGemSM750 (underlined in Fig. 2). Total R N A was extracted from adult worms (3) and poly(A)" R N A isolated [15]. The R N A was denatured with glyoxal, electrophoresed through 1.4% agarose gels containing glyoxal and then transferred to nitrocellulose filters. Hybridization for A and B was at 4 2 C in 50% formamide, and washing was done at 55'C with 0.1 x SSC. Hybridization in C was at 47~C [14], and the final wash was at 47°C in 6 x SSC. The probes were labeled by standard procedures: p G e m S M 3 by random priming [15], pGemSM750 by in vitro transcription (protocol supplied by manufacturer, BRL), and the oligonucleotide by T4 polynucleotide kinase [15]. Size markers are the R N A ladder (BRL).
no single continuous open reading frame (ORF). The longest O R F was 71 amino acids long (Fig. 2), and it did not significantly resemble any sequence in the GenBank data base. (2) A consensus poly(A) addition site was not located 5' to the poly(A) tail. (3) There were 5 complete copies of a 62-bp direct repeat located 5' to the poly(A) tail. A portion of the first copy of the repeat was included in the ORF. (4) The 62-bp repeat was composed of a tandemly repeated subsequence with the consensus motif of 5'-CCTT(T/A)TAGT-3'. To determine if the repeat was responsible for the complex m R N A hybridization pattern, we synthesized an oligonucleotide which was the reverse complement of the first 19 nucleotides (underlined in Fig. 2). This was then used
Fig. 2. Diagram of the insert of pGemSM750. The cloning site was EcoRI (E in figure). The SP6 in vitro transcription promoter of the vector is located to the right of the insert and the T7 promoter is located to the left. One copy of the nucleotide sequence of the 62 bp repeat is shown in the sense orientation; an oligonucleotide in the anti-sense orientation was synthesized (underlined). The entire D N A sequence of the pGemSM750 insert is available from the GenBank data base under accession number M63265.
as a probe on a Northern blot (Fig. I C) and did account for much of the signal seen with the previous 2 probes (Fig. 1A, 1B). The oligonucleotide was then used as a probe on a blot of D N A isolated from male and female worms and digested with RsaI. Approximately 15 bands ranging in size from less than 0.5 kb to 4 kb were observed. There were some minor differences in the size of the DNA fragments obtained from each sex (data not shown). To test whether this could be due to population heterogeneity, we examined DNA from adult worms which had matured from cercariae that were the products of monomiracidial infections (Fig. 3A). Lanes 1-5 each have DNA digested with RsaI from one isogenic population of adult worms. There were 6-9 major bands ranging in size from less than 0.5 kb to more than 4 kb; some bands were shared by more than one population, others were distinct. The DNA from the cercariae which gave rise to the adults whose DNA was analyzed in Fig. 3A was similarly analyzed (Fig. 3B). Although the electrophor-
ll9
B
A
1
2
3
4
5
1 2 3
6
4
4.0--
3.0N
2.0- i 1.6-
2.0 1.6 1.0
a
0.5-
4.0 3.0
u
ID
0.5 A
•
ii
I~i~i
Fig. 3. Autoradiograms of hybridization of the labeled oligonucleotide (underlined in Fig. 2) to D N A from (A) adult worms and (B) cercariae. Lanes 1 5 contain D N A from individual populations which were the result of monomiracidial infections. Lane 6 (A) contains a mixture of D N A from the adults in lanes 1 5. D N A was extracted (2), digested with Rsal and electrophoresed at 20 V for 16 h (A) or 50 V for 5 h (B). After staining the D N A was transferred to Zetabind (Cuno, Inc.) and hybridized as in Fig. 1.
esis conditions were different, the banding pattern from each cercariae population matched the pattern from its respective adult population in terms of the size and number of bands and the relative intensities of the hybridization signals. (There was insufficient D N A from the cercariae in lane 4, Fig. 3B, to detect a signal.) The miracidia from which these infections were begun were from the N M R I strain of S. mansoni, a highly inbred laboratory strain originally isolated from Puerto Rico [11]. The high degree of polymorphism among individuals therefore suggested that these sequence elements undergo rearrangement frequently, perhaps in the germ line. There are hypervariable regions in the human genome that occur at many loci and are made up of tandemly repeated elements sharing a common core sequence [12,13]. The pattern of restriction fragments observed with a hypervariable repeat serves as a ' D N A fingerprint' of the individual from whom the
D N A was isolated [12,13]. The extent of the polymorphism observed with the S. mansoni repeat suggests that it could be used to identify individual worms or subpopulations of worms. There are two areas of investigation which might be pursued to determine the significance of the repeat studied here. First, additional c D N A clones could be analyzed to determine whether the repeat occurs on a particular subclass of related mRNAs. Second, in situ hybridization of the cloned repeat to S. mansoni chromosomes could be analyzed to determine if the repeat is located at a particular subchromosomal region such as the centromere or the telomere.
Acknowledgements The research reported herein was supported in part by grant R22AI18867 and a N R S A (AI07161) to LDS. This study was conducted as part of the Center for Applied Molecular
120
Biology and Immunology of the State University of New York at Buffalo. References 1 Simpson, A.J.G., Sher, A. and McCutchan, T.F. (1982) The genome of Schistosoma mansoni: isolation of DNA, its size, bases and repetitive sequences. Mol. Biochem. Parasitol. 6, 125-137. 2 Spotila, L.D., Hirai, H., Rekosh, D.M. and LoVerde, P.T. (1989) A retroposon-like short repetitive DNA element in the genome of the human blood fluke, Schistosoma mansoni. Chromosoma 97, 421-428. 3 van Keulen, H., LoVerde, P.T., Bobek, L.A. and Rekosh, D.M. (1985) Organization of the ribosomal RNA genes in Schistosoma mansoni. Mol. Biochem. Parasitol. 15, 215-230. 4 McCutchan, T.F., Simpson, A.J.G., Mullins, J.A., Sher, A., Nash, T.E., Lewis, F. and Richards, C. (1984) Differentiation of schistosomes by species, strain and sex by using cloned DNA markers. Proc. Natl. Acad. Sci. USA 81,889-893. 5 Walker, T.K., Rollinson, D. and Simpson, A.J.G. (1989) A DNA probe from Schistosoma mansoni allows rapid determination of the sex of larval parasites. Mol. Biochem. Parasitol. 33, 93 100. 6 Webster, P., Mansour, T.E. and Bieber, D. (1989) Isolation of a female-specific highly repeated Schistosoma mansoni DNA probe and its use in an assay of cercarial sex. Mol. Biochem. Parasitol. 36, 217 222. 7 Hamburger, J., Turetski, T., Kapeller, I. and Deresiewicz, R. (1991) Highly repeated short DNA sequences in the genome of Schistosoma mansoni recognized by a
species-specific probe. Mol. Biochem. Parasitol. 44, 73 80. 8 Nara, T., lwamura, Y., Tanaka, M., lrie, Y. and Yasuraoka, K. (1990) Dynamic changes of DNA sequences in Schistosoma mansoni in the course of development. Parasitology 100, 241 245. 9 Mangiarotti, G., Chung, S., Zuker, C. and Lodish, H.F. (1981) Selection and analysis of cloned developmentally-regulated Dictyostelium discoideum genes by hybridization-competition. Nucleic Acids Res. 9, 947 963. 10 Love, J.D. and Minton, K.W. (1985) Screening of a 2 library for differentially expressed genes using in vitro transcripts. Anal. Biochem. 150, 429-441. 11 Fletcher, M., LoVerde, P.T. and Woodruff, D.S. (1981) Genetic variation in Schistosoma rnansoni: enzyme polymorphisms in populations from Africa, Southwest Asia, South America and the West Indies. Am. J. Trop. Med. Hyg. 30, 406M21. 12 Jeffreys, A.J., Wilson, V. and Thein, S.L. (1985) Hypervariable 'minisatellite' regions in human DNA. Nature 314, 67 73. 13 Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E. and White, R. (1987) Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235, 1616-1622. 14 Schafer, R., Boltz, E., Becker, A., Bartels, F. and Epplen, J.T. (1986) The expression of the evolutionarily conserved GATA/GACA repeats in mouse tissues. Chromosoma 93,496-501. 15 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
