Menopause: The Journal of The North American Menopause Society Vol. 22, No. 11, pp. 1256-1263 DOI: 10.1097/GME.0000000000000454 ß 2015 by The North American Menopause Society
Polymorphisms in neuropeptide genes and bone mineral density in Korean postmenopausal women Eun Hee Chun, MD,1 Hoon Kim, MD, PhD,2,3 Chang Suk Suh, MD, PhD,2,3 Jong Hak Kim, MD, PhD,1 Dong Yeon Kim, MD, PhD,1 and Jung Gu Kim, MD, PhD 2,3 Abstract Objective: The purpose of this study was to investigate the association between single nucleotide polymorphisms in neuropeptide genes and bone mineral density (BMD) in Korean postmenopausal women. Methods: Twenty polymorphisms in NMU (neuromedin U; two polymorphisms), NMU2R (NMU receptor 2; six polymorphisms), CART (cocaine- and amphetamine-regulated transcript; three polymorphisms), NPY (neuropeptide Y; four polymorphisms), NPY2R (NPY type 2 receptor; two polymorphisms), NOS1 (neuronal nitric oxide synthase; two polymorphisms), and MC4R (melanocortin 4 receptor; one polymorphism) genes were analyzed in 482 Korean postmenopausal women. BMD at the lumbar spine and femoral neck was also examined. Effects of polymorphisms on BMD were evaluated after adjusting for potential confounding factors using analysis of covariance. Odds ratios and 95% CIs for osteoporosis were estimated using x2 test or Fisher’s exact test. Results: Among the polymorphisms measured, the AG genotype of CART rs2239670 had the highest BMD at the lumbar spine. Furthermore, osteoporosis at the lumbar spine was more frequently observed in the GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism and was less frequently observed in the TT-TT genotype identified by a combined polymorphism in the NPY2R gene, compared with the other genotypes. The AA genotype of NOS1 rs1279104 polymorphism was found to have a 3.68-fold higher prevalence of osteoporosis at the femoral neck compared with the GG genotype (95% CI, 1.29-10.50; P ¼ 0.02). Conclusions: Results suggest that CART rs2239670 polymorphism may be one of the genetic factors affecting lumbar spine BMD in Korean postmenopausal women and that NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene may be useful in identifying women at risk for osteoporosis. Key Words: Bone density – Neuropeptides – Osteoporosis – Polymorphism.
B
one mass is maintained through a balance of bone remodeling: formation by osteoblasts and resorption by osteoclasts. Osteoporosis occurs as a result of a defect in bone remodeling. Osteoporosis is defined as a systemic skeletal disorder characterized by compromised Received November 20, 2014; revised and accepted January 29, 2015. From the 1Department of Anesthesiology and Pain Medicine, School of Medicine, Ewha Womans University, Seoul, Korea; 2Department of Obstetrics and Gynecology, Seoul National University College of Medicine, Seoul, Korea; and 3Biomedical Research Institute, Seoul National University Hospital, Seoul, Korea. D.Y.K. and J.G.K. contributed equally to this work as corresponding authors. Funding/support: This research was supported by the Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education, Science, and Technology (20110022334) and by a grant from the Seoul National University College of Medicine Research Fund (800-20140174). Financial disclosure/conflicts of interest: None reported. Address correspondence to: Jung Gu Kim, MD, PhD, Department of Obstetrics and Gynecology, Seoul National University College of Medicine, 28 Yeungun-dong, Chongno-gu, Seoul, Korea, E-mail: kimjg@ plaza.snu.ac.kr or Dong Yeon Kim, MD, PhD, Department of Anesthesiology and Pain Medicine, Ewha Womans University, Mokdong Hospital, 911 Mok-dong, Yangcheon-gu, Seoul 158-710, Korea, E-mail: [email protected]
1256
bone strength, which predisposes a person to increased risk of fractures.1 Bone mineral density (BMD) accounts for approximately 70% of bone strength, and 70% of variance in BMD is determined by genetic factors.2 Studies of candidate genes for osteoporosis have been performed in various populations, with conflicting results.3-5 Osteoporosis is also believed to be a multigenetic disorder wherein multiple genes affect bone mass and their contributions vary with ethnicity. We have previously demonstrated that insulin-like growth factor (CA) polymorphisms,6 vitamin D receptor baTL haplotype,7 osteoprotegerin (OPG) gene 1181G>C polymorphism,8 some polymorphisms in tumor necrosis factor and its receptor genes,9 and sFRP4 c.1019G>A polymorphism10 are possible candidates for genetic factors contributing to osteoporosis in Korean women. Bone remodeling has been suggested to be regulated by peripheral hormonal factors and mechanical factors. The OPG–receptor activator of the nuclear factor kB ligand (RANKL) system has been known to play an important role in osteoclastogenesis. It has recently been found that leptin acts as a regulator of bone remodeling through the hypothalamus and via the sympathetic nerve system to osteoblasts.11 The discovery of this action of leptin suggests that bone
Menopause, Vol. 22, No. 11, 2015
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
remodeling may also be centrally regulated by the brain. Successively, many neuropeptides, such as neuropeptide Y (NPY), melanocortin 4 receptor (MC4R), neuromedin U (NMU), cocaine- and amphetamine-regulated transcript (CART), and neuronal nitric oxide synthase (NOS1), have been demonstrated to be bone-regulating neural factors.12-16 NPY acts through at least five receptors in mammals. Immunoreactivity to NPY has been identified in bones, and central treatment of NPY has been associated with a reduction in bone mass.12,13,17 It has been suggested that NPY type 2 receptor (NPY2R) signaling in the hypothalamus inhibits bone formation.12-14 Goodrich et al18 reported that NPY rs16135 and rs16123 polymorphisms are related to total hip BMD but that no study of the NPY receptor has been performed. It has been demonstrated that CART-deficient mice display a low bone mass because of an increase in bone resorption.11 CART is suggested to affect bone resorption by modulating RANKL expression in osteoblasts. Study participants with MC4R deficiency demonstrated a high bone mass with a decrease in bone resorption.19 It has been reported that CART overexpression is the only identifiable cause of high bone mass in MC4R deficiency.20 So far, only one study has demonstrated an association between the CART promoter 3608 C allele and BMD of the forearm.21 It has been shown that NMU-deficient mice present a high bone mass with an increase in bone formation.22 NMU in the hypothalamus has been suggested to affect only the negative regulation of osteoblastic proliferation.15 NMU receptor 1 is abundantly expressed in peripheral tissues, whereas NMU receptor 2 (NMU2R) is limited to the central nervous system (CNS), especially the hypothalamus.23 The association between NMU gene variants and obesity has been reported,24 but a relationship with bone mass has not been reported. Nitric oxide is well known to play an important role in the regulation of bone metabolism and is synthesized from L-arginine by three types of nitric oxide synthase (NOS): neuronal, inducible, and endothelial.14 All NOS isoforms also play an important role in the regulation of bone mass. NOS1deficient mice have been shown to display a high bone mass,25 whereas endothelial NOS knockout mice have been shown to have osteoporosis.26 Different levels of the NOS1 isoform modulate the rate of osteoclastic differentiation of murine cell clones.27 The G894T polymorphism in the endothelial NOS gene has been reported to be related to BMD in Chinese postmenopausal women,28 but no studies on the relationship between polymorphisms in the NOS1 gene and bone mass have been undertaken. The aim of the present study was to investigate the relationship of polymorphisms in NMU, NPY, and their receptors (MC4R, CART, and NOS1 genes) with bone mass in Korean postmenopausal women. METHODS Study participants A total of 570 postmenopausal women aged 48 to 65 years who attended the Menopause Clinic of Seoul National
University Hospital for bone mass examination were initially recruited for this study. These women had been without spontaneous menses for at least 1 year. Women who had undergone surgical menopause or with current hepatic disease, renal disease, or diabetes mellitus were excluded. All women who had taken postmenopausal hormone therapy or calcium (which are known to affect BMD) for at least 3 months before the study were also excluded. Furthermore, former users of bisphosphonates or calcitonin were excluded from this study. All participants signed a written informed consent form, and the Institutional Review Board of Seoul National University Hospital approved the study protocol. Finally, a total of 482 women were enrolled in the study. Measurement of BMD and body mass index BMD for the lumbar spine (L2-L4) and femoral neck was measured (g/cm2) by a Lunar DPX-L dual-energy radiography absorptiometer (Lunar Radiation Corp, Madison, WI). Study participants were classified into groups (normal or osteoporotic) based on World Health Organization criteria.29 T scores were based on the mean (SD) BMD in young adult Korean women. The in vivo coefficient of variation was 1.4% for the lumbar spine and 2.1% for the femoral neck. Body mass index (BMI) was calculated by dividing body weight (kg) by the square of body height (m2). Measurements of bone turnover markers Blood samples were collected from all participants in the morning after a 12-hour fasting, in accordance with Declaration of Helsinki guidelines. Serum bone alkaline phosphatase levels were measured using an immunoassay kit (Metra Biosystems Inc, Mountain View, CA). The minimal detection limit was 0.7 U/L, and the interassay and intra-assay coefficients of variation for bone alkaline phosphatase were 5.2% and 3.9%, respectively. Serum osteocalcin was measured using a competitive radioimmunoassay kit (Cis Bio International, Saclay, France); the minimal detection limit was 0.4 ng/mL, and the intra-assay and interassay coefficients of variation for osteocalcin were 5.2% and 3.8%, respectively. Serum carboxyterminal telopeptide of type I collagen was measured using a serum CrossLaps One Step enzyme-linked immunosorbent assay kit (Osteometer Biotech, Herlev, Denmark). The minimal detection limit was 94 pM/L, and the intra-assay and interassay coefficients of variation for carboxy-terminal telopeptide of type I collagen were 5.4% and 5.0%, respectively. Measurements of serum soluble RANKL and OPG Serum soluble RANKL (sRANKL) was measured using an enzyme immunoassay kit (Biomedica Gruppe, Wien, Austria). The minimal detection limit was 1.6 pg/mL, and the interassay and intra-assay coefficients of variation for sRANKL were 7.2% and 3.9%, respectively. Serum OPG was measured using an enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN). The minimal detection limit was 0.06 ng/ mL, and the interassay and intra-assay coefficients of variation for OPG were 7.0% and 5.9%, respectively. Menopause, Vol. 22, No. 11, 2015
1257
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 1. Polymerase chain reaction primers for single nucleotide polymorphisms in NMU, NMU2R, CART, MC4R, NPY, NPY2R, and NOS1 genes Gene
Single Nucleotide Polymorphism Database ID
Base (amino acid) alteration
Primer
NMU
rs12108463
c.444C>A (P148L)
rs3828555
c.53C>A (A18G)
NMU2R
rs14958535
c.893G>C (S298T)
CART
rs1895245 rs61735377 rs4958532 rs4958531 rs1363422 rs2239670
c.945C>A (P315L) c.1126G>A (G376L) c.1148C>T (P383L) c.1162A>G (M388V) c.1183A>G (A395T) 224G>A
F: CCCTGAATAAAAAATATCCTCGACTTTGAC R: GTAATGCCCTCATTTTCTCTTCTAGGA VIC: AAGGGACTTTGGAATTC FAM: AAAGGGACTTTGTAATTC F: AGCAGCAGCAGCAGCAG R: CGAGATGCTGCGAACAGAGA VIC: ACGCCGCGGCCAC FAM: ACGCCTCGGCCAC F: ACATGGACXGAGGTTGAACACA R: TGACCGACTCTTCTTCAGCTTTG VIC: AGGAGTGGAGTGAATC FAM: AGGAGTGGACTGAATC F: TGGGATGTTCCTCTCTGAAGTT R: CCTTCATGCCGGTCACTTA
3608C>T
MC4R
rs4703647 rs4703648 rs2229616
c.307G>A (V193I)
rs3037354 rs17149106 rs16147 rs16123
883TG (ins/del) 602G>T 485T>C A>G
rs2880415
c.936T>C (I312I)
rs6887715
c.1084C>T
rs41279104
84G>A
rs9658356
276C>T
NPY
NPY2R
NOS1
F: CCCGAGCCCTGGACATCTACT R: CCGGACCCACACGCACTCT F: CATGTGCCACCACTTCTGAC R: TGGCAAAACCCCATCTCTAC F: GTGATTGTGGCAATAGCCAA R: TCTGTACTGTTTAATAGGGTGTTG F: CAACAGGTTTAACGCGATGAGCA R: AGAGATAGGAGCAGCCCAGACGAT F: CTAAAGTAAGCCCATGCAAGTAGGT R: TGGGATGATTATCTTTTCATACAACATGGG VIC: TTGAAGGAGGAAGCTAATA FAM: TTGAAGGAGGAAGTTTAATA F: CCTTTCTGTAGTTGCTGTTCATCCA R: CCTGGACCTGAAGGAGTACAAAC VIC: CATGGCGATAATGTG FAM: CATGGCGATGATGTG F: AGCAGGATCTGAACTCGCTTTAC R: GCGCTGGTGCTCCTCTAG VIC: TGTGCTCCAAACGAGAAG FAM: TGTGCTCCAAACAAGAAG F: AGGCCGAGCCGACTGG R: CCCCTGCCCAAGGCTT VIC: CAGAGCCGCCTCCCA FAM: CAGAGCCACCTCCCA F: TTGCCGACAAGGGCAACCCA R: ACTTCAGTGGCTGAGGGACTG
F, forward; R, reverse; FAM, fluorescent amidite matrix-labeled oligonucleotide.
Determination of polymorphisms in neuropeptide genes Genomic DNA was extracted from peripheral blood leukocytes using a QIAamp DNA blood kit (QIAGEN, Valencia, CA). As shown in Table 1, 20 polymorphisms (nonsynonymous polymorphisms or disease-associated polymorphisms) in neuropeptide genes were selected based on previous reports and on the Single Nucleotide Polymorphism Database registered by the National Center for Biotechnology Information.18,21,30-32 NMU2R rs1895245, NMU2R rs1735377, NMU2R rs4958532, NMU2R rs4958531, NMU2R rs1363422, CART rs4703647, CART rs4703648, NPY rs3037354, NPY rs17149106, and NPY rs16147 polymorphisms These polymorphisms were analyzed by direct sequencing. Briefly, polymorphic regions of genes were amplified by polymerase chain reaction (PCR) using specific primers, as shown in Table 1. Sequences for PCR products were
1258
Menopause, Vol. 22, No. 11, 2015
determined by cycle sequencing using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA). CART rs2239670, MC4R rs2229616, and NOS1 rs9658386 polymorphisms These polymorphisms were measured by PCR restriction enzyme fragment length polymorphism analysis. PCR was performed using the specific primers shown in Table 1. The restriction enzymes used for analyses were AvaII for CART rs2239670 polymorphism, HincII for MC4R rs2229616 polymorphism, and NcoI for NOS1 rs9658356 polymorphism. NMU rs12108463, NMU rs3828555, NMU2R rs14958535, NPY 16123, NPY2R rs28804315, NPY2R rs6887715, and NPY2R rs41279104 polymorphisms These polymorphisms were determined using TaqMan allelic discrimination assay, as described previously. 10 ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
Polymorphic regions were amplified by PCR with specific primers, as shown in Table 1. For quality control, 20 samples measured by TaqMan assay were also analyzed by direct sequencing. Statistical analyses Data are expressed as mean (SE). All statistical analyses were performed using Statistical Package for Social Science version 21.0 (SPSS Inc, Chicago, IL). Fisher’s exact test or x2 test was used to evaluate deviations from the Hardy-Weinberg equilibrium in genotypes and allele frequencies for each polymorphism. Linkage disequilibria between different polymorphisms were also assessed by x2 test. Haplotype analysis was performed using the single nucleotide polymorphisms analyzer 1.2A (Istech, Koyang City, Korea). Differences in anthropometric characteristics between genotypes in neuropeptide genes were tested using Student’s t test or one-way analysis of variance followed by least significant difference post hoc test. Effects of single and combined genotypes on BMD and serum levels of OPG, sRANKL, or bone turnover markers were evaluated after adjusting for potential confounding factors such as age, time since menopause, and BMI, using analysis of covariance. Odds ratios (ORs) and 95% CIs for osteoporosis were estimated using x2 test or Fisher’s exact test. The level of significance was set at P < 0.05. After Bonferroni correction in multiple testing, P < 0.025 was considered significant. RESULTS Single polymorphism NMU rs12108463, NMU2R rs1735377, and NMU2R rs1363422 polymorphisms were not observed. NMU2R rs1895245 polymorphism was in complete linkage with NMU2R rs4958532 and NMU2R rs4958531 polymorphisms. The allelic and genotypic frequencies of CART, MC4R, NPY, NPY2R, and NOS1 polymorphisms did not deviate from the Hardy-Weinberg equilibrium. NMU rs3828555, NMU2R rs14958535, and NMU2R rs1895245 polymorphisms were in Hardy-Weinberg equilibrium After adjustment for confounding factors such as age, BMI, and time since menopause, no significant differences in BMD at the lumbar spine or femoral neck were observed according to the polymorphisms measured in neuropeptide genes, with the exception of CART rs2239670 polymorphism (Table 2). The AG genotype of CART rs2239670 polymorphism had the highest lumbar spine BMD among genotypes, but this trend was not observed for femoral neck BMD. As shown in Table 3, NPY rs17149106, NPY rs16123, and NOS1 rs1279104 polymorphisms among polymorphisms in neuropeptide genes were related to the occurrence of osteoporosis. Osteoporosis at the lumbar spine was more frequently observed in women with the GG genotype of NPY rs17149106 polymorphism (OR, 3.78; 95% CI, 1.3710.45) and in women with the CC genotype of NPY rs16123 polymorphism (OR, 2.38; 95% CI, 1.22-4.63) compared with the corresponding genotypes, respectively. As for NOS1
rs1279104 polymorphism, the AA genotype was found to have a higher rate of osteoporosis (OR, 3.68; 95% CI, 1.2910.50) at the femoral neck compared with the GG genotype. Adjusted serum levels of bone turnover markers, OPG, sRANKL, or sRANKL 1,000/OPG ratios were not associated with the polymorphisms measured in neuropeptide genes (data not shown). Combined polymorphism Linkage disequilibrium analysis showed a significant association between the rs2880415 and rs6887715 polymorphisms in the NPY2R gene and between the rs41279104, and rs9658356 polymorphism in the NOS1 gene. Among haplotype alleles identified by combining polymorphisms in the NPY2R gene, the TT haplotype allele was the most common (50.4%). Osteoporosis at the lumbar spine and/or femoral neck was less frequently observed (OR, 0.59; 95% CI, 0.350.99) in the TT-TT genotype than in the non–TT-TT genotype (Table 4). The most common haplotype allele produced by combining polymorphisms in the NOS1 gene was GC allele. The genotype that did not carry the GC allele was found to have a 3.69-fold (95% CI, 1.12-12.16) higher rate of osteoporosis at the femoral neck (not at the lumbar spine) compared with the GC-GC genotype (data not shown). No significant associations between these NPY2R and NOS1 haplotype genotypes and adjusted serum levels of bone turnover markers, OPG, sRANKL, or sRANKL 1,000/OPG ratios were noted. DISCUSSION Genes controlling bone mass have yet to be identified. Recent evidence indicates that the CNS may contribute to the maintenance of bone mass through several neuropeptides.12-16 In the present study, several polymorphisms in neuropeptides candidate genes such as NPY, NMU, NPY2R, NMU2R, CART, MC4R, and NOS1 gene for bone mass were analyzed in genetically homogenous Korean postmenopausal women, and some polymorphisms in NPY, its receptor, and NOS1 genes were found to be associated with osteoporosis. Three isoforms of NOS play an important role in bone cells. Endothelial NOS seems to be a positive regulator of osteoblastic activity based on osteoporosis phenotype in endothelial NOS knockout mice.26 Inducible NOS acts as a mediator of cytokine effects in bone. It has been reported that NOS1 knockout mice have increased bone mass and reduced bone remodeling.25 The NOS1 isoform is expressed at very low levels in bone cells, and it has been hypothesized that the action of NOS1 on bone remodeling may be mediated by neurogenic relay. The endothelial NOS gene is located at 7q36.1, inducible NOS is located at 17q11.2, and NOS1 is located at 12q24.22. Cho et al33 and Taylor et al34 reported a relationship between endothelial NOS gene polymorphism and osteoporosis in Chinese postmenopausal women, in contrast with white women in whom there was no association. To our knowledge, this is the first study to show an association between NOS1 84G>A (rs1279104) polymorphism and Menopause, Vol. 22, No. 11, 2015
1259
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 2. Demographic data and BMD in relation to NMU, NMU2R, MC4R, NPY, NPY2R, NOS1, and CART genotypes in postmenopausal women BMD (g/cm2) Polymorphism NMU rs3828555 c.53C>A NMU2R rs14958535 c.893G>C rs1895245 c.945C>A MC4R rs2229616 c.307G>A NPY rs3037354 883TG (ins/del) rs17149106 602G>T rs16147 485T>C rs16123 A>G
NPY2R rs2880415 936T>C rs6887715 1084C>T NOS1 rs41279104 84G>A rs9658356 276C>T CART rs2239670 224G>A
Genotype
Age (y)
TSM (y)
BMI (kg/m2)
CC (n ¼ 208) AC (n ¼ 207) AA (n ¼ 64) P
56.7 (0.5) 57.7 (0.5) 57.6 (0.8) 0.50
8.3 (0.5) 10.0 (0.6) 8.8 (0.8) 0.11
24.1 (0.2) 24.2 (0.2) 24.5 (0.3) 0.66
0.999 (0.011) 0.993 (0.011) 1.038 (0.020) 0.15
0.821 (0.009) 0.818 (0.009) 0.834 (0.016) 0.69
GG (n ¼ 445) GC (n ¼ 34) P CC (n ¼ 432) CA (n ¼ 37) P
57.4 (0.3) 57.3 (1.1) 0.95 57.5 (0.3) 56.7 (1.1) 0.52
9.2 (0.4) 8.8 (1.0) 0.79 9.1 (0.4) 9.3 (1.1) 0.90
24.2 (0.1) 24.3 (0.5) 0.90 24.2 (0.1) 24.5 (0.5) 0.53
1.004 (0.008) 0.974 (0.028) 0.32 1.003 (0.008) 0.998 (0.026) 0.86
0.823 (0.006) 0.806 (0.023) 0.47 0.823 (0.006) 0.810 (0.021) 0.58
AG (n ¼ 17) GG (n ¼ 458) P
58.4 (1.8) 57.4 (0.3) 0.54
11.8 (2.1) 9.1 (0.3) 0.14
24.3 (0.8) 24.2 (0.1) 0.88
1.012 (0.040) 1.000 (0.008) 0.77
0.812 (0.032) 0.821 (0.006) 0.78
ins/ins (n ¼ 275) ins/del (n ¼ 161) del/del (n ¼ 43) P GG (n ¼ 463) Non-GG (n ¼ 16) P TT (n ¼ 49) TC (n ¼ 192) CC (n ¼ 238) P CC (n ¼ 49) CT (n ¼ 207) TT (n ¼ 189) P CC (n ¼ 49) Non-CC (n ¼ 396) P
57.1 (0.4)a 58.7 (0.5)a 57.6 (0.3) 0.03 57.6 (0.3) 57.8 (1.7) 0.59 57.6 (0.9) 58.1 (0.4) 57.5 (0.4) 0.59 58.7 (1.1) 57.2 (0.4) 58.1 (0.5) 0.22 58.7 (1.1) 57.6 (0.3) 0.29
9.1 (0.4) 10.3 (0.6) 8.5 (0.9) 0.15 9.3 (0.3) 10.5 (2.0) 0.51 8.9 (0.9) 9.7 (0.5) 9.3 (0.5) 0.80 10.7 (1.1) 8.9 (0.5) 9.7 (0.6) 0.26 10.7 (1.1) 9.3 (0.4) 0.23
24.2 (0.2) 24.2 (0.2) 24.2 (0.4) 0.99 24.1 (0.1) 25.9 (0.6) 0.01 24.0 (0.4) 24.4 (0.2) 24.0 (0.2) 0.38 23.4 (0.4) 24.5 (0.2) 24.1 (0.2) 0.05 23.4 (0.4) 24.3 (0.1) 0.05
0.987 (0.010) 1.012 (0.012) 0.965 (0.025) 0.13 0.998 (0.007) 0.920 (0.040) 0.06 0.976 (0.023) 1.002 (0.011) 0.991 (0.010) 0.56 0.964 (0.024) 0.997 (0.012) 0.998 (0.012) 0.42 0.964 (0.024) 0.998 (0.008) 0.19
0.820 (0.008) 0.822 (0.010) 0.807 (0.020) 0.80 0.823 (0.006) 0.768 (0.032) 0.09 0.800 (0.018) 0.815 (0.009) 0.828 (0.008) 0.31 0.818 (0.020) 0.824 (0.009) 0.820 (0.010) 0.94 0.818 (0.020) 0.822 (0.007) 0.84
TT (n ¼ 282) TC (n ¼ 173) CC (n ¼ 19) P CC (n ¼ 89) CT (n ¼ 249) TT (n ¼ 136) P
57.8 (0.4) 57.3 (0.5) 57.3 (1.1) 0.64 57.4 (0.7) 57.6 (0.4) 57.8 (0.5) 0.91
9.3 (0.4) 9.5 (0.6) 8.6 (1.4) 0.88 9.2 (0.6) 9.3 (0.5) 9.4 (0.6) 0.97
24.3 (0.2) 24.1 (0.2) 24.0 (0.6) 0.73 24.0 (0.3) 24.2 (0.2) 24.3 (0.2) 0.67
0.996 (0.009) 0.997 (0.012) 1.046 (0.035) 0.40 1.022 (0.016) 0.989 (0.010) 0.987 (0.013) 0.17
0.818 (0.007) 0.819 (0.010) 0.860 (0.028) 0.35 0.836 (0.013) 0.814 (0.008) 0.815 (0.011) 0.28
GG (n ¼ 220) GA (n ¼ 222) AA (n ¼ 32) P CC (n ¼ 305) CT (n ¼ 145) TT (n ¼ 24) P
57.9 (0.4) 57.8 (0.4) 56.5 (1.1) 0.48 57.7 (0.4) 57.2 (0.5) 57.7 (1.5) 0.67
9.3 (0.4) 9.6 (0.5) 9.1 (1.3) 0.87 9.5 (0.4) 9.1 (0.7) 8.5 (1.5) 0.73
24.1 (0.2) 24.2 (0.2) 24.2 (0.4) 0.92 24.1 (0.2) 24.2 (0.2) 24.5 (0.5) 0.81
1.000 (0.010) 0.995 (0.010) 0.956 (0.028) 0.34 0.993 (0.009) 1.005 (0.013) 1.033 (0.032) 0.41
0.819 (0.008) 0.820 (0.008) 0.803 (0.022) 0.77 0.819 (0.007) 0.816 (0.011) 0.844 (0.025) 0.58
GG (n ¼ 245) AG (n ¼ 202) AA (n ¼ 35) P
57.1 (0.4) 57.9 (0.5) 58.2 (0.8) 0.33
8.5 (0.4) 9.9 (0.5) 10.0 (1.1) 0.08
24.2 (0.2) 24.3 (0.2) 23.8 (0.4) 0.58
0.986 (0.010)a 1.027 (0.011)a,b 0.958 (0.025)b 0.004
0.813 (0.008) 0.833 (0.008) 0.797 (0.020) 0.11
LS
FN
Data are presented as mean (SE). P values were determined using analysis of variance or t test. P values for BMD were determined using analysis of covariance adjusted for age, time since menopause, and BMI. BMD, bone mineral density; TSM, time since menopause; BMI, body mass index; LS, lumbar spine; FN, femoral neck. a P < 0.01. b P < 0.05.
1260
Menopause, Vol. 22, No. 11, 2015
ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD TABLE 3. Odds ratios for osteoporosis in relation to NPY, NPY2R, NOS1, and CART polymorphism genotypes in postmenopausal women Odds ratio (95% CI) [no. cases] Polymorphism NPY rs17149106 602G>T rs16123 A>G
NPY2R rs2880415 936T>C rs6887715 1084C>T NOS1 rs41279104 84G>A
CART rs2239670 224G>A
Genotype
LS
FN
LS and/or FN
GG (n ¼ 463) Non-GG (n ¼ 16) P CC (n ¼ 49) CT (n ¼ 207) TT (n ¼ 189) P CC (n ¼ 49) Non-CC (n ¼ 396) P
1 [75] 4.02 (1.45-11.14) [7] 0.01a 2.09 (1.02-4.26) [15] (P ¼ 0.04)b 0.77 (0.45-1.33) [29] 1 [33] 0.02 2.38 (1.22-4.63) [15] 1 [62] 0.01
1 [26] 2.40 (0.52-11.13) [2] 0.24a 0.24 (0.03-1.88) [1] 0.65 (0.29-1.46) [11] 1 [15] 0.25 0.30 (0.04-2.23) [1] 1 [26] 0.34a
1 [79] 3.78 (1.37-10.45) [7] 0.01a 1.94 (0.95-3.95) [15] 0.78 (0.46-1.32) [31] 1 [35] 0.04 2.21 (1.14-4.27) [15] 1 [66] 0.02
TT (n ¼ 282) TC (n ¼ 173) CC (n ¼ 19) P CC (n ¼ 89) CT (n ¼ 249) TT (n ¼ 136) P
1.09 (0.31-3.91) [48] 0.99 (0.27-3.62) [27] 1 [3] 0.92 1 [15] 0.86 (0.45-1.66) [37] 1.17 (0.58-2.35) [26] 0.56
1.01 (0.13-8.06) [15] 1.58 (0.20-12.82) [14] 1 [1] 0.49 1 [7] 0.97 (0.51-1.86) [17] 0.54 (0.18-1.67) [6] 0.52
1.18 (0.33-4.18) [51] 1.07 (0.29-3.92) [29] 1 [3] 0.92 1 [15] 0.97 (0.51-1.86) [41] 1.22 (0.61-2.45) [27] 0.69
GG (n ¼ 220) GA (n ¼ 222) AA (n ¼ 32) P Non-AA (n ¼ 442) AA (n ¼ 32) P
1 [32] 1.33 (0.80-2.21) [41] 1.65 (0.66-4.12) [7]a 0.40 1 [73] 1.42 (0.59-3.40) [7] 0.43
1 [13] 0.91 (0.41-2.04) [12] 3.68 (1.29-10.50) [6] (P ¼ 0.02)b 0.02 1 [25] 3.85 (1.45-10.21) [6] 0.01a
1 [34] 1.31 (0.80-2.16) [43] 1.82 (0.76-4.40) [8] 0.31 1 [77] 1.58 (0.68-3.65) [8] 0.28
GG (n ¼ 245) AG (n ¼ 202) AA (n ¼ 35) P
1 [45] 0.69 (0.41-1.15) [27] 1.11 (0.46-2.70) [7] 0.30
1 [16] 0.59 (0.25-1.41) [8] 1.34 (0.37-4.86) [3] 0.37
1 [46] 0.76 (0.46-1.25) [30] 1.08 (0.45-2.63) [7] 0.50
P values were determined using x2 test. LS, lumbar spine; FN, femoral neck. a P values were determined using Fisher’s exact test. b P < 0.025 was considered significant after Bonferroni correction.
osteoporosis. Osteoporosis at the femoral neck was observed 3.68 times more frequently in the AA genotype of this polymorphism than in the GG genotype. NPY is a neurotransmitter that is widely distributed in the CNS and peripheral nervous system. Recently, it has been reported that NPY is expressed by osteocytes and inhibits osteoblastic activity.35 Central NPY acts through NPY2R to centrally regulate bone mass. NPY2R signaling inhibits bone formation via hypothalamic relay, and NPY2R knockout mice show increased bone mass.12-14 NPY is located on 7p15.1, whereas NPY2R is located on 4q32.1. Only a few genetic studies focusing on the NPY gene and bone have been reported. Heikkinen et al36 reported that a leucine-to-proline polymorphism is related to a decrease in femoral neck BMD among Finnish postmenopausal women not on hormone treatment; however, this polymorphism is not present in Korean women.37 Goodrich et al18 found an association between NPY rs16123 and rs16135 polymorphisms and total hip BMD in men of African ancestry. In the present study, NPY rs17149106 and rs16123 polymorphisms have been shown to be related to osteoporosis at the lumbar spine. Osteoporosis was found to be more frequent in
the non-GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism compared with the corresponding genotypes. This result is not accordant with that of Goodrich et al,18 who reported a higher total hip BMD in the CC genotype of NPY rs16123 polymorphism. Although a genomewide association study has not documented this association of NPY polymorphism in Asians,38 the present finding, in conjunction with the finding of NOS1 polymorphism, may support central regulation of bone mass. In addition, measurement of these polymorphisms may be useful in identifying women at risk for osteoporosis. The present study is the first study to report an association between osteoporosis and NPY2R. In this study, single genotype analysis of NPY2R rs2880415 and rs6887715 polymorphisms did not show a relationship with osteoporosis; however, when these polymorphisms were combined, the non–TT-TT genotype of the combined polymorphism was found to have a lower rate of osteoporosis at the lumbar spine than the TT-TT genotype. Haplotype analysis seems to supply more information than does single genotype analysis. This combined polymorphism may play a role in protecting against osteoporosis. Menopause, Vol. 22, No. 11, 2015
1261
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 4. Demographic data, BMD, OR for osteoporosis, and serum levels of bone markers in relation to haplotype genotypes of combined polymorphisms (rs2880415 and rs6887715) in the NPY gene in postmenopausal women NPY2R haplotype genotype TT-TT Demographic data and BMD, mean (SE)a n Age, y TSM, y BMI, kg/m2 BMD, g/cm2 Lumbar spine Femoral neck Osteoporosis, OR (95% CI) [no. cases] Lumbar spine Femoral neck Lumbar spine or femoral neck Serum bone markers, mean (SE)a n BAP, U/L CTX, pM/L OST, ng/mL OPG, ng/mL sRANKL, pg/mL sRANKL 1,000/OPG
TT-others
Others-others
Non–TT-TT
P
Pa
104 58.0 (0.6) 9.9 (0.7) 24.4 (0.3)
269 57.6 (0.4) 9.2 (0.5) 24.2 (0.2)
100 57.2 (0.7) 9.1 (0.6) 24.0 (0.3)
369 57.5 (0.3) 9.2 (0.4) 24.2 (0.1)
0.62 0.65 0.57
0.45 0.36 0.41
0.984 (0.016) 0.814 (0.012)
0.993 (0.010) 0.814 (0.008)
1.024 (0.016) 0.843 (0.012)
1.002 (0.008) 0.822 (0.007)
0.16 0.11
0.33 0.57
0.09 0.76 0.13
0.04 0.47 0.049
0.97 0.66 0.55 0.85 0.44 0.23
0.93 0.37 0.28 0.77 0.97 0.20
1 [24] 1 [5] 1 [25] 63 17.2 (1.0) 1,729.4 (198.4) 13.1 (0.8) 9,214.9 (433.2) 7.1 (0.9) 1.0 (0.1)
0.53 (0.30-0.94) [37] 1.42 (0.51-3.93) [18] 0.57 (0.33-0.99) [41] 17.2 1,536.5 14.1 9,134.8 7.4 0.8
139 (0.6) (131.5) (0.5) (262.5) (0.5) (0.1)
0.68 (0.34-1.37) [17] 1.49 (0.46-4.86) [7] 0.65 (0.33-1.29) [17] 16.9 1,494.6 14.0 8,885.0 6.1 0.7
50 (1.1) (211.8) (0.8) (444.3) (0.9) (0.1)
0.57 (0.33-0.98) [54] 1.44 (0.54-3.86) [25] 0.59 (0.35-1.00) [58] 17.1 1,524.6 14.1 9,070.2 7.1 0.8
189 (0.5) (111.6) (0.4) (225.4) (0.4) (0.0)
BMD and bone markers were adjusted for age, time since menopause, and BMI. P values were determined using analysis of covariance or x2 test. BMD, bone mineral density; OR, odds ratio; TSM, time since menopause; BMI, body mass index; BAP, bone alkaline phosphatase; CTX, carboxyterminal telopeptide of type I collagen; OST, osteocalcin; OPG, osteoprotegerin; sRANKL, soluble receptor activator for nuclear factor kB. a P values for comparison between TT-TT and non–TT-TT.
The mechanism by which NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene affect bone remains to be elucidated. Among these polymorphisms, three polymorphisms (NPY rs17149106, NPY2R rs68577715, and NOS1 rs41279104) are in the promoter region of each gene. It has been reported that circulating NPY levels may be affected by NPY promoter 399T>C polymorphism,39 and that NOS1 rs41279104 polymorphism alters transcription of NOS1.40 Accordingly, these promoter polymorphisms may play a functional role in the expression of each protein; however, NPY and NOS1 were not measured in the present study. Another suggested mechanism is that bone-associated polymorphisms identified in this study may be in linkage disequilibrium with other genes responsible for osteoporosis because NPY2R rs2880415 is a synonymous polymorphism located in the exon 2 and NPY rs16123 polymorphism is located downstream of the NPY gene. CART is expressed in the CNS (including hypothalamic neurons) and in peripheral organs.14 It has recently been demonstrated that CART inhibits bone resorption in vivo by modulating RANKL expression in osteoblasts. The CART gene is located on chromosome 5q13.2. To date, there has been only one report on the association between CART rs4703647 polymorphism and BMD. Guerardel et al21 reported an association between this polymorphism in the CART gene and forearm BMD (not hip BMD) in Danish postmenopausal women. In the present study, CART rs4703647 polymorphism did not demonstrate an association with BMD at the lumbar spine and femoral neck, whereas
1262
Menopause, Vol. 22, No. 11, 2015
CART rs2239670 polymorphism was associated with BMD at the lumbar spine, but not at the femoral neck. Furthermore, the AG genotype had the highest BMD at the lumbar spine compared to other homozygotes, indicating molecular heterosis.41 The present findings supply additional evidence on the central physiological effects of CART neurons on bone (inhibitory effect on bone loss), although its exact mechanism remains to be determined. The present study has some limitations. First, this study was undertaken with a relatively small number of women in an ethnically homogenous Korean population. Second, a limited number of polymorphisms in various neuropeptide genes were analyzed, and this study was carried out only with postmenopausal women. Therefore, further studies of other polymorphisms in neuropeptide genes in a larger general population and in other ethnic groups are warranted. CONCLUSIONS Osteoporosis at the lumbar spine is more frequently observed in the GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism and, less frequently, in the TT-TT genotype of a combined polymorphism in the NPY2R gene, compared with the corresponding genotypes. The AA genotype of NOS1 rs1279104 polymorphism has a higher rate of osteoporosis at the femoral neck compared with the GG genotype. The combined polymorphism in NPY2R plays a role in protecting against osteoporosis, whereas the GG genotype of NPY rs17149106 polymorphism and the CC genotype of NPY rs16123 polymorphism show an increased risk of osteoporosis at the lumbar spine. ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
These findings may provide additional evidence for central regulation of bone mass and may suggest that measurement of NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene may be useful in identifying women at risk for osteoporosis. REFERENCES 1. NIH Consensus Development Panel on Osteoporosis Prevention, Diagnosis, and Therapy. Osteoporosis prevention, diagnosis, and therapy. JAMA 2001;285:785-795. 2. Jouanny P, Guillemin F, Kuntz C, Jeandel C, Pourel J. Environmental and genetic factors affecting bone mass. Similarity of bone density among members of healthy families. Arthritis Rheum 1995;38:61-67. 3. Gong G, Haynatzki G. Association between bone mineral density and candidate genes in different ethnic populations and its implications. Calcif Tissue Int 2003;72:113-123. 4. Hosoi T. Genetic aspects of osteoporosis. J Bone Miner Metab 2010;28:601-607. 5. Richards JB, Kavvoura FK, Rivadeneira F, et al. Collaborative metaanalysis: associations of 150 candidate genes with osteoporosis and osteoporotic fracture. Ann Intern Med 2009;151:528-537. 6. Kim JG, Roh KR, Lee JY. The relationship among serum insulin-like growth factor-I, insulin-like growth factor-I gene polymorphism, and bone mineral density in postmenopausal women in Korea. Am J Obstet Gynecol 2002;186:345-350. 7. Kim JG, Kwon JH, Kim SH, Choi YM, Moon SY, Lee JY. Association between vitamin D receptor gene haplotypes and bone mass in postmenopausal Korean women. Am J Obstet Gynecol 2003;189:1234-1240. 8. Kim JG, Kim JH, Kim JY, et al. Association between osteoprotegerin (OPG), receptor activator of nuclear factor-kB (RANK), and RANK ligand (RANKL) gene polymorphisms and circulating OPG, soluble RANKL levels, and bone mineral density in Korean postmenopausal women. Menopause 2007;14:913-918. 9. Kim H, Chun S, Ku SY, Suh CS, Choi YM, Kim JG. Association between polymorphisms in tumor necrosis factor (TNF) and TNF receptor genes and circulating TNF, soluble TNF receptor levels, and bone mineral density in postmenopausal Korean women. Menopause 2009;16:10141020. 10. Lee DY, Kim H, Ku SY, Kim SH, Choi YM, Kim JG. Association between polymorphisms in Wnt signaling pathway genes and bone mineral density in postmenopausal Korean women. Menopause 2010;17:1064-1070. 11. Elefteriou F, Ahn JD, Takeda S, et al. Leptin regulation of bone resorption by the sympathetic nervous system and CART. Nature 2005;434:514520. 12. Khor EC, Baldock P. The NPY system and its neural and neuroendocrine regulation of bone. Curr Osteoporos Rep 2012;10:160-168. 13. Lee NJ, Herzog H. NPY regulation of bone remodelling. Neuropeptides 2009;43:457-463. 14. Patel MS, Elefteriou F. The new field of neuroskeletal biology. Calcif Tissue Int 2007;80:337-347. 15. Takeda S. Central control of bone remodelling. J Neuroendocrinol 2008;20:802-807. 16. Wong IP, Zengin A, Herzog H, Baldock PA. Central regulation of bone mass. Semin Cell Dev Biol 2008;19:452-458. 17. Ducy P, Amling M, Takeda S, et al. Leptin inhibits bone formation through a hypothalamic relay: a central control of bone mass. Cell 2000;100:197-207. 18. Goodrich LJ, Yerges-Armstrong LM, Miljkovic I, et al. Molecular variation in neuropeptide Y and bone mineral density among men of African ancestry. Calcif Tissue Int 2009;85:507-513. 19. Farooqi IS, Yeo GS, Keogh JM, et al. Dominant and recessive inheritance of morbid obesity associated with melanocortin 4 receptor deficiency. J Clin Invest 2000;106:271-279.
20. Ahn JD, Dubern B, Lubrano-Berthelier C, Clement K, Karsenty G. Cart overexpression is the only identifiable cause of high bone mass in melanocortin 4 receptor deficiency. Endocrinology 2006;147:3196-3202. 21. Guerardel A, Tanko LB, Boutin P, Christiansen C, Froguel P. Obesity susceptibility CART gene polymorphism contributes to bone remodeling in postmenopausal women. Osteoporos Int 2006;17:156-157. 22. Sato S, Hanada R, Kimura A, et al. Central control of bone remodeling by neuromedin U. Nat Med 2007;13:1234-1240. 23. Mitchell JD, Maguire JJ, Davenport AP. Emerging pharmacology and physiology of neuromedin U and the structurally related peptide neuromedin S. Br J Pharmacol 2009;158:87-103. 24. Hainerova I, Torekov SS, Ek J, et al. Association between neuromedin U gene variants and overweight and obesity. J Clin Endocrinol Metab 2006;91:5057-5063. 25. van’t Hof RJ, Macphee J, Libouban H, Helfrich MH, Ralston SH. Regulation of bone mass and bone turnover by neuronal nitric oxide synthase. Endocrinology 2004;145:5068-5074. 26. Armour KE, Armour KJ, Gallagher ME, et al. Defective bone formation and anabolic response to exogenous estrogen in mice with targeted disruption of endothelial nitric oxide synthase. Endocrinology 2001;142:760-766. 27. Nicolin V, Ponti C, Narducci P, et al. Different levels of the neuronal nitric oxide synthase isoform modulate the rate of osteoclastic differentiation of TIB-71 and CRL-2278 RAW 264.7 murine cell clones. Anat Rec A Discov Mol Cell Evol Biol 2005;286:945-954. 28. Liu SZ, Yan H, Hou WK, et al. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women. J Zhejiang Univ Sci B 2009;10:609-618. 29. Kanis JA, Melton LJ III, Christiansen C, Johnston CC, Khaltaev N. The diagnosis of osteoporosis. J Bone Miner Res 1994;9:1137-1141. 30. Jung SK, Hong MS, Suh GJ, et al. Association between polymorphism in intron 1 of cocaine- and amphetamine-regulated transcript gene with alcoholism, but not with bipolar disorder and schizophrenia in Korean population. Neurosci Lett 2004;365:54-57. 31. Wetherill L, Schuckit MA, Hesselbrock V, et al. Neuropeptide Y receptor genes are associated with alcohol dependence, alcohol withdrawal phenotypes, and cocaine dependence. Alcohol Clin Exp Res 2008;32:20312040. 32. Yu JT, Yu NN, Gao SS, et al. Neuropeptide Y polymorphisms and ischemic stroke in Chinese population. Clin Chim Acta 2010;411:242245. 33. Cho K, Demissie S, Dupuis J, et al. Polymorphisms in the endothelial nitric oxide synthase gene and bone density/ultrasound and geometry in humans. Bone 2008;42:53-60. 34. Taylor BC, Schreiner PJ, Zmuda JM, et al. Association of endothelial nitric oxide synthase genotypes with bone mineral density, bone loss, hip structure, and risk of fracture in older women: the SOF study. Bone 2006;39:174-180. 35. Igwe JC, Jiang X, Paic F, et al. Neuropeptide Y is expressed by osteocytes and can inhibit osteoblastic activity. J Cell Biochem 2009;108:621-630. 36. Heikkinen AM, Niskanen LK, Salmi JA, et al. Leucine7 to proline7 polymorphism in prepro-NPY gene and femoral neck bone mineral density in postmenopausal women. Bone 2004;35:589-594. 37. Ding B, Bertilsson L, Wahlestedt C. The single nucleotide polymorphism T1128C in the signal peptide of neuropeptide Y (NPY) was not identified in a Korean population. J Clin Pharm Ther 2002;27:211-212. 38. Cho YS, Go MJ, Kim YJ, et al. A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. Nat Genet 2009;41:527-534. 39. Kallio J, Pesonen U, Jaakkola U, Karvonen MK, Helenius H, Koulu M. Changes in diurnal sympathoadrenal balance and pituitary hormone secretion in subjects with Leu7Pro polymorphism in the prepro-neuropeptide Y. J Clin Endocrinol Metab 2003;88:3278-3283. 40. Saur D, Vanderwinden JM, Seidler B, Schmid RM, De Laet MH, Allescher HD. Single-nucleotide promoter polymorphism alters transcription of neuronal nitric oxide synthase exon 1c in infantile hypertrophic pyloric stenosis. Proc Natl Acad Sci U S A 2004;101:1662-1667. 41. Comings DE, MacMurray JP. Molecular heterosis: a review. Mol Genet Metab 2000;71:19-31.
Menopause, Vol. 22, No. 11, 2015
1263
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
Polymorphisms in neuropeptide genes and bone mineral density in Korean postmenopausal women Eun Hee Chun, MD,1 Hoon Kim, MD, PhD,2,3 Chang Suk Suh, MD, PhD,2,3 Jong Hak Kim, MD, PhD,1 Dong Yeon Kim, MD, PhD,1 and Jung Gu Kim, MD, PhD 2,3 Abstract Objective: The purpose of this study was to investigate the association between single nucleotide polymorphisms in neuropeptide genes and bone mineral density (BMD) in Korean postmenopausal women. Methods: Twenty polymorphisms in NMU (neuromedin U; two polymorphisms), NMU2R (NMU receptor 2; six polymorphisms), CART (cocaine- and amphetamine-regulated transcript; three polymorphisms), NPY (neuropeptide Y; four polymorphisms), NPY2R (NPY type 2 receptor; two polymorphisms), NOS1 (neuronal nitric oxide synthase; two polymorphisms), and MC4R (melanocortin 4 receptor; one polymorphism) genes were analyzed in 482 Korean postmenopausal women. BMD at the lumbar spine and femoral neck was also examined. Effects of polymorphisms on BMD were evaluated after adjusting for potential confounding factors using analysis of covariance. Odds ratios and 95% CIs for osteoporosis were estimated using x2 test or Fisher’s exact test. Results: Among the polymorphisms measured, the AG genotype of CART rs2239670 had the highest BMD at the lumbar spine. Furthermore, osteoporosis at the lumbar spine was more frequently observed in the GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism and was less frequently observed in the TT-TT genotype identified by a combined polymorphism in the NPY2R gene, compared with the other genotypes. The AA genotype of NOS1 rs1279104 polymorphism was found to have a 3.68-fold higher prevalence of osteoporosis at the femoral neck compared with the GG genotype (95% CI, 1.29-10.50; P ¼ 0.02). Conclusions: Results suggest that CART rs2239670 polymorphism may be one of the genetic factors affecting lumbar spine BMD in Korean postmenopausal women and that NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene may be useful in identifying women at risk for osteoporosis. Key Words: Bone density – Neuropeptides – Osteoporosis – Polymorphism.
B
one mass is maintained through a balance of bone remodeling: formation by osteoblasts and resorption by osteoclasts. Osteoporosis occurs as a result of a defect in bone remodeling. Osteoporosis is defined as a systemic skeletal disorder characterized by compromised Received November 20, 2014; revised and accepted January 29, 2015. From the 1Department of Anesthesiology and Pain Medicine, School of Medicine, Ewha Womans University, Seoul, Korea; 2Department of Obstetrics and Gynecology, Seoul National University College of Medicine, Seoul, Korea; and 3Biomedical Research Institute, Seoul National University Hospital, Seoul, Korea. D.Y.K. and J.G.K. contributed equally to this work as corresponding authors. Funding/support: This research was supported by the Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education, Science, and Technology (20110022334) and by a grant from the Seoul National University College of Medicine Research Fund (800-20140174). Financial disclosure/conflicts of interest: None reported. Address correspondence to: Jung Gu Kim, MD, PhD, Department of Obstetrics and Gynecology, Seoul National University College of Medicine, 28 Yeungun-dong, Chongno-gu, Seoul, Korea, E-mail: kimjg@ plaza.snu.ac.kr or Dong Yeon Kim, MD, PhD, Department of Anesthesiology and Pain Medicine, Ewha Womans University, Mokdong Hospital, 911 Mok-dong, Yangcheon-gu, Seoul 158-710, Korea, E-mail: [email protected]
1256
bone strength, which predisposes a person to increased risk of fractures.1 Bone mineral density (BMD) accounts for approximately 70% of bone strength, and 70% of variance in BMD is determined by genetic factors.2 Studies of candidate genes for osteoporosis have been performed in various populations, with conflicting results.3-5 Osteoporosis is also believed to be a multigenetic disorder wherein multiple genes affect bone mass and their contributions vary with ethnicity. We have previously demonstrated that insulin-like growth factor (CA) polymorphisms,6 vitamin D receptor baTL haplotype,7 osteoprotegerin (OPG) gene 1181G>C polymorphism,8 some polymorphisms in tumor necrosis factor and its receptor genes,9 and sFRP4 c.1019G>A polymorphism10 are possible candidates for genetic factors contributing to osteoporosis in Korean women. Bone remodeling has been suggested to be regulated by peripheral hormonal factors and mechanical factors. The OPG–receptor activator of the nuclear factor kB ligand (RANKL) system has been known to play an important role in osteoclastogenesis. It has recently been found that leptin acts as a regulator of bone remodeling through the hypothalamus and via the sympathetic nerve system to osteoblasts.11 The discovery of this action of leptin suggests that bone
Menopause, Vol. 22, No. 11, 2015
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
remodeling may also be centrally regulated by the brain. Successively, many neuropeptides, such as neuropeptide Y (NPY), melanocortin 4 receptor (MC4R), neuromedin U (NMU), cocaine- and amphetamine-regulated transcript (CART), and neuronal nitric oxide synthase (NOS1), have been demonstrated to be bone-regulating neural factors.12-16 NPY acts through at least five receptors in mammals. Immunoreactivity to NPY has been identified in bones, and central treatment of NPY has been associated with a reduction in bone mass.12,13,17 It has been suggested that NPY type 2 receptor (NPY2R) signaling in the hypothalamus inhibits bone formation.12-14 Goodrich et al18 reported that NPY rs16135 and rs16123 polymorphisms are related to total hip BMD but that no study of the NPY receptor has been performed. It has been demonstrated that CART-deficient mice display a low bone mass because of an increase in bone resorption.11 CART is suggested to affect bone resorption by modulating RANKL expression in osteoblasts. Study participants with MC4R deficiency demonstrated a high bone mass with a decrease in bone resorption.19 It has been reported that CART overexpression is the only identifiable cause of high bone mass in MC4R deficiency.20 So far, only one study has demonstrated an association between the CART promoter 3608 C allele and BMD of the forearm.21 It has been shown that NMU-deficient mice present a high bone mass with an increase in bone formation.22 NMU in the hypothalamus has been suggested to affect only the negative regulation of osteoblastic proliferation.15 NMU receptor 1 is abundantly expressed in peripheral tissues, whereas NMU receptor 2 (NMU2R) is limited to the central nervous system (CNS), especially the hypothalamus.23 The association between NMU gene variants and obesity has been reported,24 but a relationship with bone mass has not been reported. Nitric oxide is well known to play an important role in the regulation of bone metabolism and is synthesized from L-arginine by three types of nitric oxide synthase (NOS): neuronal, inducible, and endothelial.14 All NOS isoforms also play an important role in the regulation of bone mass. NOS1deficient mice have been shown to display a high bone mass,25 whereas endothelial NOS knockout mice have been shown to have osteoporosis.26 Different levels of the NOS1 isoform modulate the rate of osteoclastic differentiation of murine cell clones.27 The G894T polymorphism in the endothelial NOS gene has been reported to be related to BMD in Chinese postmenopausal women,28 but no studies on the relationship between polymorphisms in the NOS1 gene and bone mass have been undertaken. The aim of the present study was to investigate the relationship of polymorphisms in NMU, NPY, and their receptors (MC4R, CART, and NOS1 genes) with bone mass in Korean postmenopausal women. METHODS Study participants A total of 570 postmenopausal women aged 48 to 65 years who attended the Menopause Clinic of Seoul National
University Hospital for bone mass examination were initially recruited for this study. These women had been without spontaneous menses for at least 1 year. Women who had undergone surgical menopause or with current hepatic disease, renal disease, or diabetes mellitus were excluded. All women who had taken postmenopausal hormone therapy or calcium (which are known to affect BMD) for at least 3 months before the study were also excluded. Furthermore, former users of bisphosphonates or calcitonin were excluded from this study. All participants signed a written informed consent form, and the Institutional Review Board of Seoul National University Hospital approved the study protocol. Finally, a total of 482 women were enrolled in the study. Measurement of BMD and body mass index BMD for the lumbar spine (L2-L4) and femoral neck was measured (g/cm2) by a Lunar DPX-L dual-energy radiography absorptiometer (Lunar Radiation Corp, Madison, WI). Study participants were classified into groups (normal or osteoporotic) based on World Health Organization criteria.29 T scores were based on the mean (SD) BMD in young adult Korean women. The in vivo coefficient of variation was 1.4% for the lumbar spine and 2.1% for the femoral neck. Body mass index (BMI) was calculated by dividing body weight (kg) by the square of body height (m2). Measurements of bone turnover markers Blood samples were collected from all participants in the morning after a 12-hour fasting, in accordance with Declaration of Helsinki guidelines. Serum bone alkaline phosphatase levels were measured using an immunoassay kit (Metra Biosystems Inc, Mountain View, CA). The minimal detection limit was 0.7 U/L, and the interassay and intra-assay coefficients of variation for bone alkaline phosphatase were 5.2% and 3.9%, respectively. Serum osteocalcin was measured using a competitive radioimmunoassay kit (Cis Bio International, Saclay, France); the minimal detection limit was 0.4 ng/mL, and the intra-assay and interassay coefficients of variation for osteocalcin were 5.2% and 3.8%, respectively. Serum carboxyterminal telopeptide of type I collagen was measured using a serum CrossLaps One Step enzyme-linked immunosorbent assay kit (Osteometer Biotech, Herlev, Denmark). The minimal detection limit was 94 pM/L, and the intra-assay and interassay coefficients of variation for carboxy-terminal telopeptide of type I collagen were 5.4% and 5.0%, respectively. Measurements of serum soluble RANKL and OPG Serum soluble RANKL (sRANKL) was measured using an enzyme immunoassay kit (Biomedica Gruppe, Wien, Austria). The minimal detection limit was 1.6 pg/mL, and the interassay and intra-assay coefficients of variation for sRANKL were 7.2% and 3.9%, respectively. Serum OPG was measured using an enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN). The minimal detection limit was 0.06 ng/ mL, and the interassay and intra-assay coefficients of variation for OPG were 7.0% and 5.9%, respectively. Menopause, Vol. 22, No. 11, 2015
1257
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 1. Polymerase chain reaction primers for single nucleotide polymorphisms in NMU, NMU2R, CART, MC4R, NPY, NPY2R, and NOS1 genes Gene
Single Nucleotide Polymorphism Database ID
Base (amino acid) alteration
Primer
NMU
rs12108463
c.444C>A (P148L)
rs3828555
c.53C>A (A18G)
NMU2R
rs14958535
c.893G>C (S298T)
CART
rs1895245 rs61735377 rs4958532 rs4958531 rs1363422 rs2239670
c.945C>A (P315L) c.1126G>A (G376L) c.1148C>T (P383L) c.1162A>G (M388V) c.1183A>G (A395T) 224G>A
F: CCCTGAATAAAAAATATCCTCGACTTTGAC R: GTAATGCCCTCATTTTCTCTTCTAGGA VIC: AAGGGACTTTGGAATTC FAM: AAAGGGACTTTGTAATTC F: AGCAGCAGCAGCAGCAG R: CGAGATGCTGCGAACAGAGA VIC: ACGCCGCGGCCAC FAM: ACGCCTCGGCCAC F: ACATGGACXGAGGTTGAACACA R: TGACCGACTCTTCTTCAGCTTTG VIC: AGGAGTGGAGTGAATC FAM: AGGAGTGGACTGAATC F: TGGGATGTTCCTCTCTGAAGTT R: CCTTCATGCCGGTCACTTA
3608C>T
MC4R
rs4703647 rs4703648 rs2229616
c.307G>A (V193I)
rs3037354 rs17149106 rs16147 rs16123
883TG (ins/del) 602G>T 485T>C A>G
rs2880415
c.936T>C (I312I)
rs6887715
c.1084C>T
rs41279104
84G>A
rs9658356
276C>T
NPY
NPY2R
NOS1
F: CCCGAGCCCTGGACATCTACT R: CCGGACCCACACGCACTCT F: CATGTGCCACCACTTCTGAC R: TGGCAAAACCCCATCTCTAC F: GTGATTGTGGCAATAGCCAA R: TCTGTACTGTTTAATAGGGTGTTG F: CAACAGGTTTAACGCGATGAGCA R: AGAGATAGGAGCAGCCCAGACGAT F: CTAAAGTAAGCCCATGCAAGTAGGT R: TGGGATGATTATCTTTTCATACAACATGGG VIC: TTGAAGGAGGAAGCTAATA FAM: TTGAAGGAGGAAGTTTAATA F: CCTTTCTGTAGTTGCTGTTCATCCA R: CCTGGACCTGAAGGAGTACAAAC VIC: CATGGCGATAATGTG FAM: CATGGCGATGATGTG F: AGCAGGATCTGAACTCGCTTTAC R: GCGCTGGTGCTCCTCTAG VIC: TGTGCTCCAAACGAGAAG FAM: TGTGCTCCAAACAAGAAG F: AGGCCGAGCCGACTGG R: CCCCTGCCCAAGGCTT VIC: CAGAGCCGCCTCCCA FAM: CAGAGCCACCTCCCA F: TTGCCGACAAGGGCAACCCA R: ACTTCAGTGGCTGAGGGACTG
F, forward; R, reverse; FAM, fluorescent amidite matrix-labeled oligonucleotide.
Determination of polymorphisms in neuropeptide genes Genomic DNA was extracted from peripheral blood leukocytes using a QIAamp DNA blood kit (QIAGEN, Valencia, CA). As shown in Table 1, 20 polymorphisms (nonsynonymous polymorphisms or disease-associated polymorphisms) in neuropeptide genes were selected based on previous reports and on the Single Nucleotide Polymorphism Database registered by the National Center for Biotechnology Information.18,21,30-32 NMU2R rs1895245, NMU2R rs1735377, NMU2R rs4958532, NMU2R rs4958531, NMU2R rs1363422, CART rs4703647, CART rs4703648, NPY rs3037354, NPY rs17149106, and NPY rs16147 polymorphisms These polymorphisms were analyzed by direct sequencing. Briefly, polymorphic regions of genes were amplified by polymerase chain reaction (PCR) using specific primers, as shown in Table 1. Sequences for PCR products were
1258
Menopause, Vol. 22, No. 11, 2015
determined by cycle sequencing using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA). CART rs2239670, MC4R rs2229616, and NOS1 rs9658386 polymorphisms These polymorphisms were measured by PCR restriction enzyme fragment length polymorphism analysis. PCR was performed using the specific primers shown in Table 1. The restriction enzymes used for analyses were AvaII for CART rs2239670 polymorphism, HincII for MC4R rs2229616 polymorphism, and NcoI for NOS1 rs9658356 polymorphism. NMU rs12108463, NMU rs3828555, NMU2R rs14958535, NPY 16123, NPY2R rs28804315, NPY2R rs6887715, and NPY2R rs41279104 polymorphisms These polymorphisms were determined using TaqMan allelic discrimination assay, as described previously. 10 ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
Polymorphic regions were amplified by PCR with specific primers, as shown in Table 1. For quality control, 20 samples measured by TaqMan assay were also analyzed by direct sequencing. Statistical analyses Data are expressed as mean (SE). All statistical analyses were performed using Statistical Package for Social Science version 21.0 (SPSS Inc, Chicago, IL). Fisher’s exact test or x2 test was used to evaluate deviations from the Hardy-Weinberg equilibrium in genotypes and allele frequencies for each polymorphism. Linkage disequilibria between different polymorphisms were also assessed by x2 test. Haplotype analysis was performed using the single nucleotide polymorphisms analyzer 1.2A (Istech, Koyang City, Korea). Differences in anthropometric characteristics between genotypes in neuropeptide genes were tested using Student’s t test or one-way analysis of variance followed by least significant difference post hoc test. Effects of single and combined genotypes on BMD and serum levels of OPG, sRANKL, or bone turnover markers were evaluated after adjusting for potential confounding factors such as age, time since menopause, and BMI, using analysis of covariance. Odds ratios (ORs) and 95% CIs for osteoporosis were estimated using x2 test or Fisher’s exact test. The level of significance was set at P < 0.05. After Bonferroni correction in multiple testing, P < 0.025 was considered significant. RESULTS Single polymorphism NMU rs12108463, NMU2R rs1735377, and NMU2R rs1363422 polymorphisms were not observed. NMU2R rs1895245 polymorphism was in complete linkage with NMU2R rs4958532 and NMU2R rs4958531 polymorphisms. The allelic and genotypic frequencies of CART, MC4R, NPY, NPY2R, and NOS1 polymorphisms did not deviate from the Hardy-Weinberg equilibrium. NMU rs3828555, NMU2R rs14958535, and NMU2R rs1895245 polymorphisms were in Hardy-Weinberg equilibrium After adjustment for confounding factors such as age, BMI, and time since menopause, no significant differences in BMD at the lumbar spine or femoral neck were observed according to the polymorphisms measured in neuropeptide genes, with the exception of CART rs2239670 polymorphism (Table 2). The AG genotype of CART rs2239670 polymorphism had the highest lumbar spine BMD among genotypes, but this trend was not observed for femoral neck BMD. As shown in Table 3, NPY rs17149106, NPY rs16123, and NOS1 rs1279104 polymorphisms among polymorphisms in neuropeptide genes were related to the occurrence of osteoporosis. Osteoporosis at the lumbar spine was more frequently observed in women with the GG genotype of NPY rs17149106 polymorphism (OR, 3.78; 95% CI, 1.3710.45) and in women with the CC genotype of NPY rs16123 polymorphism (OR, 2.38; 95% CI, 1.22-4.63) compared with the corresponding genotypes, respectively. As for NOS1
rs1279104 polymorphism, the AA genotype was found to have a higher rate of osteoporosis (OR, 3.68; 95% CI, 1.2910.50) at the femoral neck compared with the GG genotype. Adjusted serum levels of bone turnover markers, OPG, sRANKL, or sRANKL 1,000/OPG ratios were not associated with the polymorphisms measured in neuropeptide genes (data not shown). Combined polymorphism Linkage disequilibrium analysis showed a significant association between the rs2880415 and rs6887715 polymorphisms in the NPY2R gene and between the rs41279104, and rs9658356 polymorphism in the NOS1 gene. Among haplotype alleles identified by combining polymorphisms in the NPY2R gene, the TT haplotype allele was the most common (50.4%). Osteoporosis at the lumbar spine and/or femoral neck was less frequently observed (OR, 0.59; 95% CI, 0.350.99) in the TT-TT genotype than in the non–TT-TT genotype (Table 4). The most common haplotype allele produced by combining polymorphisms in the NOS1 gene was GC allele. The genotype that did not carry the GC allele was found to have a 3.69-fold (95% CI, 1.12-12.16) higher rate of osteoporosis at the femoral neck (not at the lumbar spine) compared with the GC-GC genotype (data not shown). No significant associations between these NPY2R and NOS1 haplotype genotypes and adjusted serum levels of bone turnover markers, OPG, sRANKL, or sRANKL 1,000/OPG ratios were noted. DISCUSSION Genes controlling bone mass have yet to be identified. Recent evidence indicates that the CNS may contribute to the maintenance of bone mass through several neuropeptides.12-16 In the present study, several polymorphisms in neuropeptides candidate genes such as NPY, NMU, NPY2R, NMU2R, CART, MC4R, and NOS1 gene for bone mass were analyzed in genetically homogenous Korean postmenopausal women, and some polymorphisms in NPY, its receptor, and NOS1 genes were found to be associated with osteoporosis. Three isoforms of NOS play an important role in bone cells. Endothelial NOS seems to be a positive regulator of osteoblastic activity based on osteoporosis phenotype in endothelial NOS knockout mice.26 Inducible NOS acts as a mediator of cytokine effects in bone. It has been reported that NOS1 knockout mice have increased bone mass and reduced bone remodeling.25 The NOS1 isoform is expressed at very low levels in bone cells, and it has been hypothesized that the action of NOS1 on bone remodeling may be mediated by neurogenic relay. The endothelial NOS gene is located at 7q36.1, inducible NOS is located at 17q11.2, and NOS1 is located at 12q24.22. Cho et al33 and Taylor et al34 reported a relationship between endothelial NOS gene polymorphism and osteoporosis in Chinese postmenopausal women, in contrast with white women in whom there was no association. To our knowledge, this is the first study to show an association between NOS1 84G>A (rs1279104) polymorphism and Menopause, Vol. 22, No. 11, 2015
1259
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 2. Demographic data and BMD in relation to NMU, NMU2R, MC4R, NPY, NPY2R, NOS1, and CART genotypes in postmenopausal women BMD (g/cm2) Polymorphism NMU rs3828555 c.53C>A NMU2R rs14958535 c.893G>C rs1895245 c.945C>A MC4R rs2229616 c.307G>A NPY rs3037354 883TG (ins/del) rs17149106 602G>T rs16147 485T>C rs16123 A>G
NPY2R rs2880415 936T>C rs6887715 1084C>T NOS1 rs41279104 84G>A rs9658356 276C>T CART rs2239670 224G>A
Genotype
Age (y)
TSM (y)
BMI (kg/m2)
CC (n ¼ 208) AC (n ¼ 207) AA (n ¼ 64) P
56.7 (0.5) 57.7 (0.5) 57.6 (0.8) 0.50
8.3 (0.5) 10.0 (0.6) 8.8 (0.8) 0.11
24.1 (0.2) 24.2 (0.2) 24.5 (0.3) 0.66
0.999 (0.011) 0.993 (0.011) 1.038 (0.020) 0.15
0.821 (0.009) 0.818 (0.009) 0.834 (0.016) 0.69
GG (n ¼ 445) GC (n ¼ 34) P CC (n ¼ 432) CA (n ¼ 37) P
57.4 (0.3) 57.3 (1.1) 0.95 57.5 (0.3) 56.7 (1.1) 0.52
9.2 (0.4) 8.8 (1.0) 0.79 9.1 (0.4) 9.3 (1.1) 0.90
24.2 (0.1) 24.3 (0.5) 0.90 24.2 (0.1) 24.5 (0.5) 0.53
1.004 (0.008) 0.974 (0.028) 0.32 1.003 (0.008) 0.998 (0.026) 0.86
0.823 (0.006) 0.806 (0.023) 0.47 0.823 (0.006) 0.810 (0.021) 0.58
AG (n ¼ 17) GG (n ¼ 458) P
58.4 (1.8) 57.4 (0.3) 0.54
11.8 (2.1) 9.1 (0.3) 0.14
24.3 (0.8) 24.2 (0.1) 0.88
1.012 (0.040) 1.000 (0.008) 0.77
0.812 (0.032) 0.821 (0.006) 0.78
ins/ins (n ¼ 275) ins/del (n ¼ 161) del/del (n ¼ 43) P GG (n ¼ 463) Non-GG (n ¼ 16) P TT (n ¼ 49) TC (n ¼ 192) CC (n ¼ 238) P CC (n ¼ 49) CT (n ¼ 207) TT (n ¼ 189) P CC (n ¼ 49) Non-CC (n ¼ 396) P
57.1 (0.4)a 58.7 (0.5)a 57.6 (0.3) 0.03 57.6 (0.3) 57.8 (1.7) 0.59 57.6 (0.9) 58.1 (0.4) 57.5 (0.4) 0.59 58.7 (1.1) 57.2 (0.4) 58.1 (0.5) 0.22 58.7 (1.1) 57.6 (0.3) 0.29
9.1 (0.4) 10.3 (0.6) 8.5 (0.9) 0.15 9.3 (0.3) 10.5 (2.0) 0.51 8.9 (0.9) 9.7 (0.5) 9.3 (0.5) 0.80 10.7 (1.1) 8.9 (0.5) 9.7 (0.6) 0.26 10.7 (1.1) 9.3 (0.4) 0.23
24.2 (0.2) 24.2 (0.2) 24.2 (0.4) 0.99 24.1 (0.1) 25.9 (0.6) 0.01 24.0 (0.4) 24.4 (0.2) 24.0 (0.2) 0.38 23.4 (0.4) 24.5 (0.2) 24.1 (0.2) 0.05 23.4 (0.4) 24.3 (0.1) 0.05
0.987 (0.010) 1.012 (0.012) 0.965 (0.025) 0.13 0.998 (0.007) 0.920 (0.040) 0.06 0.976 (0.023) 1.002 (0.011) 0.991 (0.010) 0.56 0.964 (0.024) 0.997 (0.012) 0.998 (0.012) 0.42 0.964 (0.024) 0.998 (0.008) 0.19
0.820 (0.008) 0.822 (0.010) 0.807 (0.020) 0.80 0.823 (0.006) 0.768 (0.032) 0.09 0.800 (0.018) 0.815 (0.009) 0.828 (0.008) 0.31 0.818 (0.020) 0.824 (0.009) 0.820 (0.010) 0.94 0.818 (0.020) 0.822 (0.007) 0.84
TT (n ¼ 282) TC (n ¼ 173) CC (n ¼ 19) P CC (n ¼ 89) CT (n ¼ 249) TT (n ¼ 136) P
57.8 (0.4) 57.3 (0.5) 57.3 (1.1) 0.64 57.4 (0.7) 57.6 (0.4) 57.8 (0.5) 0.91
9.3 (0.4) 9.5 (0.6) 8.6 (1.4) 0.88 9.2 (0.6) 9.3 (0.5) 9.4 (0.6) 0.97
24.3 (0.2) 24.1 (0.2) 24.0 (0.6) 0.73 24.0 (0.3) 24.2 (0.2) 24.3 (0.2) 0.67
0.996 (0.009) 0.997 (0.012) 1.046 (0.035) 0.40 1.022 (0.016) 0.989 (0.010) 0.987 (0.013) 0.17
0.818 (0.007) 0.819 (0.010) 0.860 (0.028) 0.35 0.836 (0.013) 0.814 (0.008) 0.815 (0.011) 0.28
GG (n ¼ 220) GA (n ¼ 222) AA (n ¼ 32) P CC (n ¼ 305) CT (n ¼ 145) TT (n ¼ 24) P
57.9 (0.4) 57.8 (0.4) 56.5 (1.1) 0.48 57.7 (0.4) 57.2 (0.5) 57.7 (1.5) 0.67
9.3 (0.4) 9.6 (0.5) 9.1 (1.3) 0.87 9.5 (0.4) 9.1 (0.7) 8.5 (1.5) 0.73
24.1 (0.2) 24.2 (0.2) 24.2 (0.4) 0.92 24.1 (0.2) 24.2 (0.2) 24.5 (0.5) 0.81
1.000 (0.010) 0.995 (0.010) 0.956 (0.028) 0.34 0.993 (0.009) 1.005 (0.013) 1.033 (0.032) 0.41
0.819 (0.008) 0.820 (0.008) 0.803 (0.022) 0.77 0.819 (0.007) 0.816 (0.011) 0.844 (0.025) 0.58
GG (n ¼ 245) AG (n ¼ 202) AA (n ¼ 35) P
57.1 (0.4) 57.9 (0.5) 58.2 (0.8) 0.33
8.5 (0.4) 9.9 (0.5) 10.0 (1.1) 0.08
24.2 (0.2) 24.3 (0.2) 23.8 (0.4) 0.58
0.986 (0.010)a 1.027 (0.011)a,b 0.958 (0.025)b 0.004
0.813 (0.008) 0.833 (0.008) 0.797 (0.020) 0.11
LS
FN
Data are presented as mean (SE). P values were determined using analysis of variance or t test. P values for BMD were determined using analysis of covariance adjusted for age, time since menopause, and BMI. BMD, bone mineral density; TSM, time since menopause; BMI, body mass index; LS, lumbar spine; FN, femoral neck. a P < 0.01. b P < 0.05.
1260
Menopause, Vol. 22, No. 11, 2015
ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD TABLE 3. Odds ratios for osteoporosis in relation to NPY, NPY2R, NOS1, and CART polymorphism genotypes in postmenopausal women Odds ratio (95% CI) [no. cases] Polymorphism NPY rs17149106 602G>T rs16123 A>G
NPY2R rs2880415 936T>C rs6887715 1084C>T NOS1 rs41279104 84G>A
CART rs2239670 224G>A
Genotype
LS
FN
LS and/or FN
GG (n ¼ 463) Non-GG (n ¼ 16) P CC (n ¼ 49) CT (n ¼ 207) TT (n ¼ 189) P CC (n ¼ 49) Non-CC (n ¼ 396) P
1 [75] 4.02 (1.45-11.14) [7] 0.01a 2.09 (1.02-4.26) [15] (P ¼ 0.04)b 0.77 (0.45-1.33) [29] 1 [33] 0.02 2.38 (1.22-4.63) [15] 1 [62] 0.01
1 [26] 2.40 (0.52-11.13) [2] 0.24a 0.24 (0.03-1.88) [1] 0.65 (0.29-1.46) [11] 1 [15] 0.25 0.30 (0.04-2.23) [1] 1 [26] 0.34a
1 [79] 3.78 (1.37-10.45) [7] 0.01a 1.94 (0.95-3.95) [15] 0.78 (0.46-1.32) [31] 1 [35] 0.04 2.21 (1.14-4.27) [15] 1 [66] 0.02
TT (n ¼ 282) TC (n ¼ 173) CC (n ¼ 19) P CC (n ¼ 89) CT (n ¼ 249) TT (n ¼ 136) P
1.09 (0.31-3.91) [48] 0.99 (0.27-3.62) [27] 1 [3] 0.92 1 [15] 0.86 (0.45-1.66) [37] 1.17 (0.58-2.35) [26] 0.56
1.01 (0.13-8.06) [15] 1.58 (0.20-12.82) [14] 1 [1] 0.49 1 [7] 0.97 (0.51-1.86) [17] 0.54 (0.18-1.67) [6] 0.52
1.18 (0.33-4.18) [51] 1.07 (0.29-3.92) [29] 1 [3] 0.92 1 [15] 0.97 (0.51-1.86) [41] 1.22 (0.61-2.45) [27] 0.69
GG (n ¼ 220) GA (n ¼ 222) AA (n ¼ 32) P Non-AA (n ¼ 442) AA (n ¼ 32) P
1 [32] 1.33 (0.80-2.21) [41] 1.65 (0.66-4.12) [7]a 0.40 1 [73] 1.42 (0.59-3.40) [7] 0.43
1 [13] 0.91 (0.41-2.04) [12] 3.68 (1.29-10.50) [6] (P ¼ 0.02)b 0.02 1 [25] 3.85 (1.45-10.21) [6] 0.01a
1 [34] 1.31 (0.80-2.16) [43] 1.82 (0.76-4.40) [8] 0.31 1 [77] 1.58 (0.68-3.65) [8] 0.28
GG (n ¼ 245) AG (n ¼ 202) AA (n ¼ 35) P
1 [45] 0.69 (0.41-1.15) [27] 1.11 (0.46-2.70) [7] 0.30
1 [16] 0.59 (0.25-1.41) [8] 1.34 (0.37-4.86) [3] 0.37
1 [46] 0.76 (0.46-1.25) [30] 1.08 (0.45-2.63) [7] 0.50
P values were determined using x2 test. LS, lumbar spine; FN, femoral neck. a P values were determined using Fisher’s exact test. b P < 0.025 was considered significant after Bonferroni correction.
osteoporosis. Osteoporosis at the femoral neck was observed 3.68 times more frequently in the AA genotype of this polymorphism than in the GG genotype. NPY is a neurotransmitter that is widely distributed in the CNS and peripheral nervous system. Recently, it has been reported that NPY is expressed by osteocytes and inhibits osteoblastic activity.35 Central NPY acts through NPY2R to centrally regulate bone mass. NPY2R signaling inhibits bone formation via hypothalamic relay, and NPY2R knockout mice show increased bone mass.12-14 NPY is located on 7p15.1, whereas NPY2R is located on 4q32.1. Only a few genetic studies focusing on the NPY gene and bone have been reported. Heikkinen et al36 reported that a leucine-to-proline polymorphism is related to a decrease in femoral neck BMD among Finnish postmenopausal women not on hormone treatment; however, this polymorphism is not present in Korean women.37 Goodrich et al18 found an association between NPY rs16123 and rs16135 polymorphisms and total hip BMD in men of African ancestry. In the present study, NPY rs17149106 and rs16123 polymorphisms have been shown to be related to osteoporosis at the lumbar spine. Osteoporosis was found to be more frequent in
the non-GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism compared with the corresponding genotypes. This result is not accordant with that of Goodrich et al,18 who reported a higher total hip BMD in the CC genotype of NPY rs16123 polymorphism. Although a genomewide association study has not documented this association of NPY polymorphism in Asians,38 the present finding, in conjunction with the finding of NOS1 polymorphism, may support central regulation of bone mass. In addition, measurement of these polymorphisms may be useful in identifying women at risk for osteoporosis. The present study is the first study to report an association between osteoporosis and NPY2R. In this study, single genotype analysis of NPY2R rs2880415 and rs6887715 polymorphisms did not show a relationship with osteoporosis; however, when these polymorphisms were combined, the non–TT-TT genotype of the combined polymorphism was found to have a lower rate of osteoporosis at the lumbar spine than the TT-TT genotype. Haplotype analysis seems to supply more information than does single genotype analysis. This combined polymorphism may play a role in protecting against osteoporosis. Menopause, Vol. 22, No. 11, 2015
1261
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
CHUN ET AL TABLE 4. Demographic data, BMD, OR for osteoporosis, and serum levels of bone markers in relation to haplotype genotypes of combined polymorphisms (rs2880415 and rs6887715) in the NPY gene in postmenopausal women NPY2R haplotype genotype TT-TT Demographic data and BMD, mean (SE)a n Age, y TSM, y BMI, kg/m2 BMD, g/cm2 Lumbar spine Femoral neck Osteoporosis, OR (95% CI) [no. cases] Lumbar spine Femoral neck Lumbar spine or femoral neck Serum bone markers, mean (SE)a n BAP, U/L CTX, pM/L OST, ng/mL OPG, ng/mL sRANKL, pg/mL sRANKL 1,000/OPG
TT-others
Others-others
Non–TT-TT
P
Pa
104 58.0 (0.6) 9.9 (0.7) 24.4 (0.3)
269 57.6 (0.4) 9.2 (0.5) 24.2 (0.2)
100 57.2 (0.7) 9.1 (0.6) 24.0 (0.3)
369 57.5 (0.3) 9.2 (0.4) 24.2 (0.1)
0.62 0.65 0.57
0.45 0.36 0.41
0.984 (0.016) 0.814 (0.012)
0.993 (0.010) 0.814 (0.008)
1.024 (0.016) 0.843 (0.012)
1.002 (0.008) 0.822 (0.007)
0.16 0.11
0.33 0.57
0.09 0.76 0.13
0.04 0.47 0.049
0.97 0.66 0.55 0.85 0.44 0.23
0.93 0.37 0.28 0.77 0.97 0.20
1 [24] 1 [5] 1 [25] 63 17.2 (1.0) 1,729.4 (198.4) 13.1 (0.8) 9,214.9 (433.2) 7.1 (0.9) 1.0 (0.1)
0.53 (0.30-0.94) [37] 1.42 (0.51-3.93) [18] 0.57 (0.33-0.99) [41] 17.2 1,536.5 14.1 9,134.8 7.4 0.8
139 (0.6) (131.5) (0.5) (262.5) (0.5) (0.1)
0.68 (0.34-1.37) [17] 1.49 (0.46-4.86) [7] 0.65 (0.33-1.29) [17] 16.9 1,494.6 14.0 8,885.0 6.1 0.7
50 (1.1) (211.8) (0.8) (444.3) (0.9) (0.1)
0.57 (0.33-0.98) [54] 1.44 (0.54-3.86) [25] 0.59 (0.35-1.00) [58] 17.1 1,524.6 14.1 9,070.2 7.1 0.8
189 (0.5) (111.6) (0.4) (225.4) (0.4) (0.0)
BMD and bone markers were adjusted for age, time since menopause, and BMI. P values were determined using analysis of covariance or x2 test. BMD, bone mineral density; OR, odds ratio; TSM, time since menopause; BMI, body mass index; BAP, bone alkaline phosphatase; CTX, carboxyterminal telopeptide of type I collagen; OST, osteocalcin; OPG, osteoprotegerin; sRANKL, soluble receptor activator for nuclear factor kB. a P values for comparison between TT-TT and non–TT-TT.
The mechanism by which NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene affect bone remains to be elucidated. Among these polymorphisms, three polymorphisms (NPY rs17149106, NPY2R rs68577715, and NOS1 rs41279104) are in the promoter region of each gene. It has been reported that circulating NPY levels may be affected by NPY promoter 399T>C polymorphism,39 and that NOS1 rs41279104 polymorphism alters transcription of NOS1.40 Accordingly, these promoter polymorphisms may play a functional role in the expression of each protein; however, NPY and NOS1 were not measured in the present study. Another suggested mechanism is that bone-associated polymorphisms identified in this study may be in linkage disequilibrium with other genes responsible for osteoporosis because NPY2R rs2880415 is a synonymous polymorphism located in the exon 2 and NPY rs16123 polymorphism is located downstream of the NPY gene. CART is expressed in the CNS (including hypothalamic neurons) and in peripheral organs.14 It has recently been demonstrated that CART inhibits bone resorption in vivo by modulating RANKL expression in osteoblasts. The CART gene is located on chromosome 5q13.2. To date, there has been only one report on the association between CART rs4703647 polymorphism and BMD. Guerardel et al21 reported an association between this polymorphism in the CART gene and forearm BMD (not hip BMD) in Danish postmenopausal women. In the present study, CART rs4703647 polymorphism did not demonstrate an association with BMD at the lumbar spine and femoral neck, whereas
1262
Menopause, Vol. 22, No. 11, 2015
CART rs2239670 polymorphism was associated with BMD at the lumbar spine, but not at the femoral neck. Furthermore, the AG genotype had the highest BMD at the lumbar spine compared to other homozygotes, indicating molecular heterosis.41 The present findings supply additional evidence on the central physiological effects of CART neurons on bone (inhibitory effect on bone loss), although its exact mechanism remains to be determined. The present study has some limitations. First, this study was undertaken with a relatively small number of women in an ethnically homogenous Korean population. Second, a limited number of polymorphisms in various neuropeptide genes were analyzed, and this study was carried out only with postmenopausal women. Therefore, further studies of other polymorphisms in neuropeptide genes in a larger general population and in other ethnic groups are warranted. CONCLUSIONS Osteoporosis at the lumbar spine is more frequently observed in the GG genotype of NPY rs17149106 polymorphism and in the CC genotype of NPY rs16123 polymorphism and, less frequently, in the TT-TT genotype of a combined polymorphism in the NPY2R gene, compared with the corresponding genotypes. The AA genotype of NOS1 rs1279104 polymorphism has a higher rate of osteoporosis at the femoral neck compared with the GG genotype. The combined polymorphism in NPY2R plays a role in protecting against osteoporosis, whereas the GG genotype of NPY rs17149106 polymorphism and the CC genotype of NPY rs16123 polymorphism show an increased risk of osteoporosis at the lumbar spine. ß 2015 The North American Menopause Society
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
NEUROPEPTIDE GENE POLYMORPHISMS AND BMD
These findings may provide additional evidence for central regulation of bone mass and may suggest that measurement of NPY rs17149106, NPY rs16123, NOS1 rs1279104, and combined (rs2880415 and rs6857715) polymorphisms in the NPY2R gene may be useful in identifying women at risk for osteoporosis. REFERENCES 1. NIH Consensus Development Panel on Osteoporosis Prevention, Diagnosis, and Therapy. Osteoporosis prevention, diagnosis, and therapy. JAMA 2001;285:785-795. 2. Jouanny P, Guillemin F, Kuntz C, Jeandel C, Pourel J. Environmental and genetic factors affecting bone mass. Similarity of bone density among members of healthy families. Arthritis Rheum 1995;38:61-67. 3. Gong G, Haynatzki G. Association between bone mineral density and candidate genes in different ethnic populations and its implications. Calcif Tissue Int 2003;72:113-123. 4. Hosoi T. Genetic aspects of osteoporosis. J Bone Miner Metab 2010;28:601-607. 5. Richards JB, Kavvoura FK, Rivadeneira F, et al. Collaborative metaanalysis: associations of 150 candidate genes with osteoporosis and osteoporotic fracture. Ann Intern Med 2009;151:528-537. 6. Kim JG, Roh KR, Lee JY. The relationship among serum insulin-like growth factor-I, insulin-like growth factor-I gene polymorphism, and bone mineral density in postmenopausal women in Korea. Am J Obstet Gynecol 2002;186:345-350. 7. Kim JG, Kwon JH, Kim SH, Choi YM, Moon SY, Lee JY. Association between vitamin D receptor gene haplotypes and bone mass in postmenopausal Korean women. Am J Obstet Gynecol 2003;189:1234-1240. 8. Kim JG, Kim JH, Kim JY, et al. Association between osteoprotegerin (OPG), receptor activator of nuclear factor-kB (RANK), and RANK ligand (RANKL) gene polymorphisms and circulating OPG, soluble RANKL levels, and bone mineral density in Korean postmenopausal women. Menopause 2007;14:913-918. 9. Kim H, Chun S, Ku SY, Suh CS, Choi YM, Kim JG. Association between polymorphisms in tumor necrosis factor (TNF) and TNF receptor genes and circulating TNF, soluble TNF receptor levels, and bone mineral density in postmenopausal Korean women. Menopause 2009;16:10141020. 10. Lee DY, Kim H, Ku SY, Kim SH, Choi YM, Kim JG. Association between polymorphisms in Wnt signaling pathway genes and bone mineral density in postmenopausal Korean women. Menopause 2010;17:1064-1070. 11. Elefteriou F, Ahn JD, Takeda S, et al. Leptin regulation of bone resorption by the sympathetic nervous system and CART. Nature 2005;434:514520. 12. Khor EC, Baldock P. The NPY system and its neural and neuroendocrine regulation of bone. Curr Osteoporos Rep 2012;10:160-168. 13. Lee NJ, Herzog H. NPY regulation of bone remodelling. Neuropeptides 2009;43:457-463. 14. Patel MS, Elefteriou F. The new field of neuroskeletal biology. Calcif Tissue Int 2007;80:337-347. 15. Takeda S. Central control of bone remodelling. J Neuroendocrinol 2008;20:802-807. 16. Wong IP, Zengin A, Herzog H, Baldock PA. Central regulation of bone mass. Semin Cell Dev Biol 2008;19:452-458. 17. Ducy P, Amling M, Takeda S, et al. Leptin inhibits bone formation through a hypothalamic relay: a central control of bone mass. Cell 2000;100:197-207. 18. Goodrich LJ, Yerges-Armstrong LM, Miljkovic I, et al. Molecular variation in neuropeptide Y and bone mineral density among men of African ancestry. Calcif Tissue Int 2009;85:507-513. 19. Farooqi IS, Yeo GS, Keogh JM, et al. Dominant and recessive inheritance of morbid obesity associated with melanocortin 4 receptor deficiency. J Clin Invest 2000;106:271-279.
20. Ahn JD, Dubern B, Lubrano-Berthelier C, Clement K, Karsenty G. Cart overexpression is the only identifiable cause of high bone mass in melanocortin 4 receptor deficiency. Endocrinology 2006;147:3196-3202. 21. Guerardel A, Tanko LB, Boutin P, Christiansen C, Froguel P. Obesity susceptibility CART gene polymorphism contributes to bone remodeling in postmenopausal women. Osteoporos Int 2006;17:156-157. 22. Sato S, Hanada R, Kimura A, et al. Central control of bone remodeling by neuromedin U. Nat Med 2007;13:1234-1240. 23. Mitchell JD, Maguire JJ, Davenport AP. Emerging pharmacology and physiology of neuromedin U and the structurally related peptide neuromedin S. Br J Pharmacol 2009;158:87-103. 24. Hainerova I, Torekov SS, Ek J, et al. Association between neuromedin U gene variants and overweight and obesity. J Clin Endocrinol Metab 2006;91:5057-5063. 25. van’t Hof RJ, Macphee J, Libouban H, Helfrich MH, Ralston SH. Regulation of bone mass and bone turnover by neuronal nitric oxide synthase. Endocrinology 2004;145:5068-5074. 26. Armour KE, Armour KJ, Gallagher ME, et al. Defective bone formation and anabolic response to exogenous estrogen in mice with targeted disruption of endothelial nitric oxide synthase. Endocrinology 2001;142:760-766. 27. Nicolin V, Ponti C, Narducci P, et al. Different levels of the neuronal nitric oxide synthase isoform modulate the rate of osteoclastic differentiation of TIB-71 and CRL-2278 RAW 264.7 murine cell clones. Anat Rec A Discov Mol Cell Evol Biol 2005;286:945-954. 28. Liu SZ, Yan H, Hou WK, et al. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women. J Zhejiang Univ Sci B 2009;10:609-618. 29. Kanis JA, Melton LJ III, Christiansen C, Johnston CC, Khaltaev N. The diagnosis of osteoporosis. J Bone Miner Res 1994;9:1137-1141. 30. Jung SK, Hong MS, Suh GJ, et al. Association between polymorphism in intron 1 of cocaine- and amphetamine-regulated transcript gene with alcoholism, but not with bipolar disorder and schizophrenia in Korean population. Neurosci Lett 2004;365:54-57. 31. Wetherill L, Schuckit MA, Hesselbrock V, et al. Neuropeptide Y receptor genes are associated with alcohol dependence, alcohol withdrawal phenotypes, and cocaine dependence. Alcohol Clin Exp Res 2008;32:20312040. 32. Yu JT, Yu NN, Gao SS, et al. Neuropeptide Y polymorphisms and ischemic stroke in Chinese population. Clin Chim Acta 2010;411:242245. 33. Cho K, Demissie S, Dupuis J, et al. Polymorphisms in the endothelial nitric oxide synthase gene and bone density/ultrasound and geometry in humans. Bone 2008;42:53-60. 34. Taylor BC, Schreiner PJ, Zmuda JM, et al. Association of endothelial nitric oxide synthase genotypes with bone mineral density, bone loss, hip structure, and risk of fracture in older women: the SOF study. Bone 2006;39:174-180. 35. Igwe JC, Jiang X, Paic F, et al. Neuropeptide Y is expressed by osteocytes and can inhibit osteoblastic activity. J Cell Biochem 2009;108:621-630. 36. Heikkinen AM, Niskanen LK, Salmi JA, et al. Leucine7 to proline7 polymorphism in prepro-NPY gene and femoral neck bone mineral density in postmenopausal women. Bone 2004;35:589-594. 37. Ding B, Bertilsson L, Wahlestedt C. The single nucleotide polymorphism T1128C in the signal peptide of neuropeptide Y (NPY) was not identified in a Korean population. J Clin Pharm Ther 2002;27:211-212. 38. Cho YS, Go MJ, Kim YJ, et al. A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. Nat Genet 2009;41:527-534. 39. Kallio J, Pesonen U, Jaakkola U, Karvonen MK, Helenius H, Koulu M. Changes in diurnal sympathoadrenal balance and pituitary hormone secretion in subjects with Leu7Pro polymorphism in the prepro-neuropeptide Y. J Clin Endocrinol Metab 2003;88:3278-3283. 40. Saur D, Vanderwinden JM, Seidler B, Schmid RM, De Laet MH, Allescher HD. Single-nucleotide promoter polymorphism alters transcription of neuronal nitric oxide synthase exon 1c in infantile hypertrophic pyloric stenosis. Proc Natl Acad Sci U S A 2004;101:1662-1667. 41. Comings DE, MacMurray JP. Molecular heterosis: a review. Mol Genet Metab 2000;71:19-31.
Menopause, Vol. 22, No. 11, 2015
1263
Copyright @ 2015 The North American Menopause Society. Unauthorized reproduction of this article is prohibited.
