bs_bs_banner
Nephrology 19 (2014) 623–629
Original Article
Polymorphisms in oxidative stress pathway genes and risk of diabetic nephropathy in South Indian type 2 diabetic patients PARIMALA NARNE,1 KAMAKSHI CHAITHRI PONNALURI,1 MOHAMMED SIRAJ2 and MOHAMMED ISHAQ1 1
Department of Genetics, Osmania University and 2Department of Medicine, Deccan College of Medical Sciences, Hyderabad, India
KEY WORDS: diabetic nephropathy, oxidative stress, polymorphism, type 2 diabetes mellitus. Correspondence: Dr Parimala Narne, Department of Genetics, Osmania University, Hyderabad 500 007, India. Email: [email protected]. Accepted for publication 11 June 2014. Accepted manuscript online 8 July 2014. doi:10.1111/nep.12293 Conflict of Interest Statement The authors declare that they have no conflict of interest.
SUMMARY AT A GLANCE The authors investigated the contribution of polymorphisms of oxidative stress genes in the development of DN in the South Indian T2DM population. They showed that eNOS and PARP-1 gene variants were associated with increased and reduced susceptibility to DN, respectively.
ABSTRACT: Aim: Diabetic nephropathy (DN), a common microvascular complication of type 2 diabetes mellitus (T2DM) is polygenic, with a vast array of genes contributing to disease susceptibility. Accordingly, we explored the association between DN and six polymorphisms in oxidative stress related genes, namely eNOS, p22phox subunit of NAD(P)H oxidase, PARP-1 and XRCC1 in South Indian T2DM subjects. Methods: The study included 155 T2DM subjects with DN and 162 T2DM patients with no evidence of DN. The selected polymorphisms were genotyped by polymerase chain reaction and Taqman allele discrimination assay. Results: No significant difference was observed in the genotype and allele distribution of eNOS −786T>C, intron 4a4b, p22phox 242C>T and XRCC1 Arg399Gln polymorphisms between T2DM groups with and without DN. Contrastingly, there appeared to be a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN wherein, the presence of 894T allele was associated with an enhanced risk for DN [P = 0.005; OR = 1.78 (1.17–2.7)], while the 762Ala allele seemed to confer significant protection against DN [P = 0.02; OR = 0.59 (0.37–0.92)]. Multiple logistic regression analysis revealed a significant and independent association of eNOS 894G>T, PARP-1 Val762Ala polymorphisms and hypertension with DN in T2DM individuals. Conclusions: eNOS 894G>T and PARP-1 Val762Ala polymorphisms appeared to associate significantly with DN, with the former contributing to an enhanced risk and the latter to a reduced susceptibility to DN in South Indian T2DM individuals.
Diabetic nephropathy (DN) is the predominant cause of renal failure in India. The primacy of persistent hyperglycaemia in the development of DN is exemplified by the fact that intensive glycemic control in type 2 diabetes mellitus (T2DM) is associated with reduced occurrence of DN.1 Oxidative stress has been inculpated as an important mediator in the pathophysiology of DN. The harmful sequelae of oxidative stress in the realm of DN include endothelial dysfunction, leukocyte adherence, impaired coagulation in the kidney and glomerular cell apoptosis. Hyperglycaemia spurs haemodynamic changes with a consequent shift in nitroso-oxidant balance towards a pro-oxidant state that accelerates tissue and vascular injury.2 There is a regional variation in the prevalence of diabetes in India, with southern and western Indian populations © 2014 Asian Pacific Society of Nephrology
being highly susceptible as compared to northern and eastern counterparts.3 There also appears to be a variable proclivity for renal disease, with African Americans, Asians and Native Americans being more vulnerable to developing DN than Caucasians.4 The promoters of progression of DN comprising albuminuria, hypertension and metabolic dysregulation only account for approximately one-third of the variability. Alongside, a plausible genetic basis that could elucidate the variable susceptibility has been advocated based on the reports on familial clustering of nephropathy and linkage to circumscribed regions of the human genome.5,6 Association studies using the candidate gene approach constitutes one of the principal strategies for identification of the genetic variants portending an increased risk for DN. Therein, polymorphic variants of the genes involved 623
P Narne et al.
in the oxidative stress pathways insinuated in DN could supposedly modulate the risk associated with development of DN in T2DM individuals. Candidate gene association studies focusing on oxidative stress-related pathologies have increasingly indicated that genetic variation in the vascular oxidative enzymes affecting redox balance could significantly underlie the interindividual variation in vascular oxidative stress. Accordingly, genetic variants of endothelial nitric oxide synthase (eNOS), namely −786T>C (rs2070744), 894G>T (rs1799983) (exon 7), 27 bp variable number tandem repeat (VNTR) 4a4b (intron 4) polymorphisms have been analyzed for their association with DN in different populations generating conflicting results.7–11 These sequence variants significantly lower the levels of endothelium-derived nitric oxide (NO) through alteration in eNOS gene expression and activity that spurs endothelial dysfunction and aggravated oxidative stress, which presage the development of DN. In that order, the −786T>C promoter polymorphism lessens the promoter activity by approximately 50% due to the differential binding of replication protein RpA1 at the site of −786C variant, while 894G>T polymorphism effectuates a selective proteolytic cleavage of eNOS protein due to a tight turn in the alpha helix, resulting in a reduction in NO bioavailability.12,13 With respect to intron 4a4b polymorphism, the 27 base pair repeats act as a cis-acting regulator of eNOS expression and the 4a allele with four 27bp repeats is associated with a significant lowering of NO levels.14 In a similar vein, the exonic and intronic variants of cytochrome b245 (CYBA) gene encoding the p22phox subunit of NAD(P)H oxidase, indispensable for the enzymatic activity, are surmised to contribute to an inter-individual variation in vascular superoxide (O2−) generation. This finds pathological relevance in the fact that NAD(P)H oxidase is critical for O2− generation in the mesangial cells, which in turn is substantiated by an experimental observation demonstrating a higher NAD(P)H oxidase dependent O2− generation in the renal cortex and outer medulla of the rat kidney.15 Therein, the 242C>T (rs4673) polymorphism in exon 4 of CYBA resulting in replacement of histidine by tyrosine at codon 72 (His72Tyr) in the putative heme binding site was selected for the study. Studies have averred that this genetic variant is associated with a reduced activity of the modified oxidase and hence contributes to an appreciable decline in vascular O2− production and alleviation of oxidative stress. By virtue of enhanced O2− production by NAD(P)H oxidase under hyperglycaemic conditions, it seems plausible for the 242C allele to confer a higher risk for DN and 242T allele to be associated with a significantly reduced O2− production.16 It is indeed reasonable to speculate that polymorphisms in DNA repair genes could modulate DNA repair efficiency. In this regard, the selection of Val762Ala (rs1136410) polymorphism in Poly (ADP-ribose) Polymerase-1 (PARP-1) gene for the current study seems cogent, with the consideration that PARP-1 overactivation is intrinsic to hyperglycaemia induced 624
reversible NADPH deficiency and that the variant allele (762Ala) is associated with a reduced activity of PARP-1 as evinced by in vitro enzymatic analysis.17,18 Thereby, a reduction in the activity of PARP-1 could possibly correspond to conservation of cellular energetic pools and abrogation of unfavourable sequelae of PARP overactivation in a hyperglycaemic milieu.19 Also, Arg399Gln (rs25487) polymorphism in exon 10 of X-ray Repair Cross Complementing group1 (XRCC1) gene has been reported to interfere with the complex assembly as the sequence variant is located in the PARP binding domain that spans the amino acids 301– 402.20 XRCC1 is a multidomain scaffolding protein and functions in DNA repair by complexing with PARP, DNA ligase III via a BRCT (BRCA1 C-terminal) domain in its carboxyl terminus and DNA polymerase H via the amino-terminal domain. This polymorphism is thereby understood to reduce DNA repair proficiency resulting in accumulation of altered DNA bases and potentiating oxidative DNA damage, culminating in cellular vascular senescence. There has been paucity of data concerning the contribution of the aforementioned polymorphisms towards the development of DN in South Indian population. In this milieu, we explored the association between the polymorphic variants of oxidative stress-related genes selected based on their biological plausibility, putative risk factors and DN in South Indian T2DM individuals.
MATERIALS AND METHODS Study participants and phenotypic data A total of 317 T2DM subjects visiting Kamineni hospitals, Hyderabad, were recruited for the study. Of these, 155 T2DM subjects diagnosed with a urinary albumin excretion of >300 mg/day on two different occasions in a span of 3–6 months, with diabetic retinopathy and without any clinical or laboratory evidence of other kidney disease, infectious condition and congestive heart disease constituted the diabetic nephropathy group (T2DM+DN). Similarly, a total of 162 T2DM subjects with a urinary albumin excretion of C
eNOS (rs1799983) 894G>T Glu298Asp
eNOS 27-bp dup 4a4b p22phox (rs4673) 242C>T His72Lys PARP-1 (rs1136410) 2444T>C Val762Ala XRCC1 (rs25487) 28152G>A Arg399Gln
Primers/Probes Probes T allele: 5'TET-CATCAAGCTCTTCCCTG GCTG-TAMRA3' C allele: 5'FAM-CATCAAGCTCTTCCCTGGCCG-TAMRA3' Primers F: 5'-CACCTGCATTCTGGGAACTGTA-3', R: 5'-GCCGCAGTA GCAGAGAGAC-3' Probes G allele: 5'TET-CCCCAGATGAGCCCCCAGAACT-TAMRA3', T allele: 5'FAM-CCCCAGATGATC CCCCAGAACTC-TAMRA3' Primers F: 5'-CGGTCGCTTCGACGTGCT-3' R: 5'-CCAGTCA ATCCCTTTGGTGCT-3' F: 5'-AGGCCCTATGGTAGTGCCTTT-3' R: 5'-TCTCTTAGTGCTGTGGTCAC-3' F: 5'-TGCTTGTGGGTAAACCAAGGCCGGTG-3'; R: 5'-AACAC TGAGGTAAGTGGGGGTGGCTCCTGT-3'
4a = 393bp 4b = 420bp C = 348bp T = 160bp,188bp
F: 5'-TTTGCTCCTCCAGGCCAACG-3' R: 5'-TGGAAGTTTGGGACCGCTGC-3'
Val = 210bp Ala = 190bp,20bp
F: 5'TTGTGC TTTCTCTGTGTCCA3' R: 5'TCCTCCAGCCTTTTCTGATA3'
Arg = 374bp,221bp Gln = 615bp
The genomic DNA was isolated from the whole blood by rapid salting out method.21
Genotype determination The respective primer and probe sequences and the polymerase chain reaction (PCR) products for the gene polymorphisms selected for this study are outlined in Table 1. The reaction mixture consisted of 30–500 ng of genomic DNA, 0.2 mM of each dNTP (Eppendorf, Hamburg, Germany), 10 pmol of each primer (Sigma Aldrich, St. Louis, MO, USA), 1.5 mM MgCl2, 1X Taq buffer and 1.0–1.25U of Taq DNA polymerase (Bangalore Genei, India) in a final volume of 25 μL. PCR cycling conditions included an initial denaturation of 5 min at 94°C, followed by 30 cycles of denaturation at 94°C (30–60 s), annealing at 58°C for 1 min (eNOS 4a4b), 56°C for 1 min (p22phox 242C4T), 62°C (PARP-1 Val762Ala) and 64°C (XRCC1 Arg399Gln) for 30 s respectively, elongation at 72°C (30 s– 2 min) and final elongation at 72°C for 5 min in an iCycler machine (Bio-Rad Laboratories, Hercules, CA, USA). The resulting PCR products were digested overnight at 37°C with RsaI (5U) for 242C4T, MspI (10U) for Arg399Gln and at 60°C with BstUI (5U) (New England Biolabs, Beverly, MA, USA) for Val762Ala polymorphisms respectively. The PCR products and the fragments resulting from restriction digestion were resolved on 10% polyacrylamide gels and visualized by ethidium bromide (10 mg/mL) staining. Genotyping of eNOS-786T>C and 894G>T polymorphisms was performed by Taqman Allele Discrimination Assay (Applied Biosystems, Carlsbad, CA, USA) and real-time PCR. Each 25 μL PCR volume consisted of 30 ng of genomic DNA, 300 nM primers, 100 nM probes, and 12.5 μL of TaqMan Universal PCR master mix (Eppendorf, Hamburg, Germany), which is a solution containing buffer, Uracil-N© 2014 Asian Pacific Society of Nephrology
Allele/Product Size
glycosylase, deoxyribonucleotides, uridine, passive reference dye (ROX), and TaqGold DNA polymerase. Amplification was done under the following conditions: 50°C, 2 min; 95°C, 10 min; followed by 40 cycles of 94°C for 15 s and 62°C for 1 min in a Perkin-Elmer 9600 thermocycler. Fluorescence in each well was measured before and after PCR using an ABI 7700 machine (Perkin Elmer, Applied Biosystems Division).
Statistical analysis Percentage distribution of the corresponding genotypes and alleles of selected gene polymorphisms was determined and the differences in genotype and allele frequencies between the specified groups were compared using the Pearson’s χ2 or Fisher’s exact tests as appropriate. Differences in continuous data among the groups were determined by unpaired student’s t-test. The risk estimates for alleles, genotype contrasts and various risk factors were obtained by computing odds ratio (OR) and respective 95% confidence interval (CI) by multiple logistic regression (MLR) analysis after adjusting for potential confounding variables. A two-tailed P-value of T and PARP-1 Val762Ala polymorphisms varied significantly between the two groups. It can be evinced from the data that T2DM+DN group demonstrated an increased frequency of GT, TT genotypes and 894T allele compared to T2DM individuals without nephropathy (T2DM) (P = 0.01, 0.005). Conversely, a decreased frequency of Val/Ala, Ala/ Ala genotypes and 762Ala allele with an accompanying increase in the frequency of Val/Val homozygotes and 762Val allele was observed in T2DM+DN group as compared to T2DM group (P = 0.036, 0.02). Contrastingly, there was no 626
discernible difference in the genotype distributions and allele frequencies of eNOS −786T>C, intron 4a/b; p22phox 242C>T and XRCC1 Arg399Gln polymorphisms between the two groups. The influence of the polymorphisms that emerged as significant ones, on development of DN was further assessed by comparing various genotype contrasts between T2DM+DN and T2DM groups (Table 4). Accordingly, it was observed that GT genotype per se and in combination with TT contributed maximally to an elevated risk for DN when compared with GG genotype carriers respectively. Further, the Val/Ala genotype in combination with Ala/Ala genotype was associated with a reduced risk for DN (P = 0.015) thereby conforming to the dominant model. Comparisons between Ala allele homozygotes (Ala/Ala) vs Val allele carriers (Val/ Ala+Val/Val) and heterozygotes (Val/Ala) vs Val allele homozygotes (Val/Val) revealed that imposition of protective effect was confined to the heterozygous genotype. Subsequently, a perusal of the results of MLR analysis aiming at identifying the independent risk factors for DN apparently indicated that hypertension and eNOS 894T allele were associated with an enhanced risk for DN while PARP-1 762Ala allele seemingly reduced the risk for development of DN in T2DM patients (Table 5).
DISCUSSION The present study aimed at comprehensively analyzing the association of selected polymorphisms in the genes related to oxidative stress and DN in South Indian T2DM patients. Analysis of the results suggested a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN. Further, we did not observe any association between eNOS −786T>C, intron 4a4b, p22phox 242C>T and XRCC1 Arg399Gln polymorphisms and DN in the study population. Studies have averred that dysfunctional eNOS partakes in DN pathogenesis, as evidenced by an increased susceptibility to glomerular disease in eNOS knockout diabetic mice.22 The significant association of eNOS 894G>T polymorphism with DN is seemingly relevant, as a genetic variation in eNOS gene (894G>T variant) forges a reduction in NO levels.13 This could further be potentiated by the persistent hyperglycaemic milieu that instigates an increased generation of ROS, the O2− in particular, which oxidizes the activating cofactor of eNOS, namely tetrahydrobiopterin (BH4) resulting in plummeting levels of BH4, with the resultant effect of disruption of eNOS dimerization and consequential eNOS uncoupling. This in turn precipitates the oxidative damage as eNOS becomes the net producer of O2− rather than NO. This further evokes a substantial reduction of NO-mediated cGMP generation, resulting in revoking the suppression of protein kinase C thereby escalating oxidant stress in the glomeruli of diabetic individuals, aggravating mesangial matrix expansion and further deteriorating endothelial function.23 Our results are in agreement with a © 2014 Asian Pacific Society of Nephrology
Gene polymorphisms and diabetic nephropathy
Table 3 Genotype and allele frequencies of the polymorphisms in the genes related to oxidative stress. Polymorphism eNOS −786T>C (rs2070744) eNOS 894G>T Glu298Asp (rs1799983) eNOS 27-bp dup 4a4b p22phox 242C>T His72Lys (rs4673) PARP-1 2444T>C Val762Ala (rs1136410) XRCC1 28152G>A Arg399Gln (rs25487)
Genotype TT TC CC GG GT TT 4b/b 4a/b 4a/a CC CT TT Val/Val Val/Ala Ala/Ala Arg/Arg Arg/Gln Gln/Gln
T2DM+DN (n = 155)
T2DM (n = 162)
P
Allele
T2DM+DN
T2DM
P
OR (95%CI)
89 (57.4) 59 (38.1) 7 (4.5) 85 (54.8) 64 (41.3) 6 (3.9) 98 (63.2) 52 (33.5) 5 (3.2) 81 (52.3) 56 (36.1) 18 (11.6) 117 (75.5) 37 (23.9) 1 (0.6) 73 (47.1) 65 (41.9) 17 (11.0)
102 (63.0) 57 (35.2) 3 (1.8) 114 (70.4) 46 (28.4) 2 (1.2) 99 (61.1) 59 (36.4) 4 (2.5) 88 (54.3) 62 (38.3) 12 (7.4) 101 (62.3) 58 (35.8) 3 (1.9) 96 (59.3) 52 (32.1) 14 (8.6)
0.31
T C
237 (76.5) 73 (23.5)
261 (80.6) 63 (19.4)
0.21
1.28 (0.86–1.9)
0.01
G T
234 (75.5) 76 (24.5)
274 (84.6) 50 (15.4)
0.005
1.78 (1.17–2.7)
0.82
b a
248 (80.0) 62 (20.0)
257 (79.3) 69 (21.3)
0.77
0.93 (0.62–1.39)
0.44
C T
218 (70.3) 92 (29.7)
238 (73.5) 86 (26.5)
0.43
1.17 (0.81–1.68)
0.036
Val Ala
271 (87.4) 39 (12.6)
260 (80.2) 64 (19.8)
0.02
0.59 (0.37–0.92)
0.1
Arg Gln
211 (68.1) 99 (31.9)
244 (75.3) 80 (24.7)
0.052
1.43 (0.99–2.06)
T2DM, Type 2 Diabetes Mellitus; DN, Diabetic Nephropathy; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; XRCC1, X-Ray Cross Complementing; OR, Odds Ratio; CI, Confidence Interval.
Table 4 Comparison of the genotype contrasts of eNOS 894G>T and PARP-1 Val762Ala polymorphisms in T2DM+DN and T2DM groups Group and genotype contrast eNOS 894G>T Dominant model GT and TT vs GG Recessive model TT vs GT and GG Homozygote codominant model TT vs GG Heterozygote co-dominant model GT vs GG PARP-1 Val762Ala Dominant model Val/Ala and Ala/Ala vs Val/Val Recessive model Ala/Ala vs Val/Val and Val/Ala Homozygote Codominant model Ala/Ala vs Val/Val Heterozygote Codominant model Val/Ala vs Val/Val
P†
OR (95%CI)†
P*
OR (95%CI)*
0.005
1.96 (1.23–3.19)
0.01
1.65 (1.18–2.92)
0.17
3.22 (0.58–23.46)
0.23
4.12 (0.65–27.61)
0.14
4.02 (0.71–29.62)
0.2
5.11 (0.8–31.42)
0.01
1.87 (1.13–3.08)
0.01
1.71 (1.1–2.88)
0.015
0.54 (0.32–0.89)
0.009
0.47 (0.29–0.85)
0.62
0.34 (0.01–3.75)
0.71
0.37 (0.09–4.2)
0.34
0.29 (0.01–3.17)
0.41
0.35 (0.05–4.11)
0.02
0.55 (0.33–0.93)
0.03
0.57(0.38–0.97)
†Unadjusted, calculated by Fisher’s exact test; *Adjusted for age, gender, duration of diabetes, family history of diabetes, body mass index, hypertension, systolic blood pressure, diastolic blood pressure, smoking, fasting blood glucose, postprandial blood glucose and serum lipids. T2DM, Type 2 Diabetes Mellitus; DN, Diabetic Nephropathy; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; OR, Odds Ratio; CI, Confidence Interval.
study in a north Indian population, wherein 894T allele and TT genotypes were associated with a high risk for DN in T2DM individuals.11 Evidence accumulated by meta-analysis studies indicated that 894G>T polymorphism is associated with susceptibility to DN in global and East Asian populations but not in Caucasians.24,25 With respect to eNOS −786T>C and intron 4a4b polymorphisms, our study observed no significant association with susceptibility to DN as reported in the north Indian population.11 Nonetheless, © 2014 Asian Pacific Society of Nephrology
there have been conflicting reports on the association of eNOS −786T>C and 4a/b polymorphisms with DN in different populations.7–11 These discrepancies could be attributed to ethnicity, geographic, sample size variations and phenotypic definitions. Further, meta-analysis studies indicated a significant association of 4a4b polymorphism with DN in an East Asian population but not in Caucasians, while no conceivable evidence was obtained for the association between −786T>C polymorphism and DN.24,25 627
P Narne et al.
Table 5 Multiple logistic regression analysis for the association between diabetic nephropathy, gene polymorphisms and other risk variables in type 2 diabetic patients Characteristic
Male sex Duration of T2DM BMI Hypertension Smoking Hyperlipidaemia eNOS 894T allele PARP-1 762Ala allele
Diabetic nephropathy P
OR (95%CI)
0.85 0.45 0.32 0.02 0.31 0.47 0.01 0.009
0.67 (0.32–3.25) 0.82 (0.65–2.29) 0.97 (0.85–1.74) 2.08 (1.02–4.21) 1.88 (0.64–4.02) 1.35 (0.54–4.87) 1.98 (1.47–3.61) 0.42 (0.31–0.89)
T2DM, Type 2 Diabetes Mellitus; BMI, Body Mass Index; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; OR, Odds Ratio; CI, Confidence Interval.
The observed association of PARP-1 Val762Ala polymorphism with DN in our study could predicate on the observation that 762Ala allele is associated with a significant reduction in the PARP-1 activity due to an increase in the Km of the enzyme for trans poly(ADP-ribosyl)ation.18 This could plausibly vanquish the unfavourable sequelae of PARP-1 overactivation in a hyperglycaemic milieu and confer a protective effect against development of DN. Alternatively, the Val762 allele is associated with an uncurbed activity of PARP-1 resulting in rapid depletion of energy stores with a concomitant suppression of endothelium dependent vasodilation. It also augurs well with the fact that overactivation of PARP regulates activation of transcription factors NF-kB, STAT-1, Oct-1 and p53, which in turn upregulate the expression of cyclooxygenase-2, inducible nitric oxide synthase, cell adhesion molecules and inflammatory cytokines that foment the renal injury due to incident oxidant stress.17 The protective effect of 762Ala allele against DN in our study also seems to be congruent with the experimental observations, wherein attenuation of PARP activation by PARP inhibitors counteracted the overexpression of endothelin-1 and its receptors in the renal cortex.19 This also stymied the above discussed attendant sequelae of PARP-1 overactivation, thereby ameliorating oxidative stress and endothelial dysfunction. This was further corroborated by an observation wherein the presence of glomerular depositions of IgG was significantly reduced in streptozotocin diabetic rats treated with the PARP inhibitor nicotinamide.26 The other genetic variants investigated for their possible association with DN generated no significant results. With reference to p22phox 242C>T polymorphism, our results are in concurrence with a study in Chinese T2DM population wherein, no significant association with DN was observed.27 Also, evaluation of this polymorphism in relation to chronic renal insufficiency in Indian T2DM population did not reveal any significant association.28 On the contrary, the CC genotype was reported to be more frequent in the T2DM+DN group in a Japanese population.29 Nevertheless, it is increas628
ingly possible for this polymorphism to exert its effect in concert with other polymorphic variants in the vicinity, which emphasizes the need for further investigations. By the same token, the analysis of XRCC1 Arg399Gln polymorphism in conjunction with other polymorphic variants of XRCC1 gene could possibly provide a vivid picture of the role of XRCC1 in DN pathogenesis, which could be reserved for future investigations. Further, the predominance of hypertensive individuals in the T2DM+DN group seems to be pertinent as systemic hypertension can incite endothelial injury in diabetics with disordered renal autoregulation. An association between subsequent development of DN and higher systemic pressures, particularly in the hypertensive range has been observed in prospective and animal studies.30 Also, control of hypertension has been portrayed to be an important and powerful intervention in attenuating the progression of DN.31 Taken together, the results from our study suggest a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN in T2DM individuals. Nevertheless, the study is not without limitations. The study apparently is not sufficiently powered to obtain conclusive evidence. However, it could be viewed as proffering clues for obtaining valuable information regarding the influence of the investigated polymorphisms on the susceptibility to DN in larger populations and in different ethnicities, with simultaneous biochemical evaluation of markers of oxidative stress induced cellular and DNA damage. This would substantially contribute towards deciphering the mechanisms that modulate the susceptibility to or protection against DN, which could eventually facilitate the identification of pharmacological targets for diminishing the risk associated with the development and progression of DN in T2DM individuals.
ACKNOWLEDGEMENTS This study was carried out at Immunogenetics Laboratory, Department of Genetics, Osmania University, Hyderabad, India. We thank University Grants Commission (UGC) and Council of Scientific and Industrial Research (CSIR), New Delhi for providing research fellowships to Parimala Narne and Kamakshi Chaithri Ponnaluri, respectively. We are grateful to all the patients who participated in this study.
REFERENCES 1. UK Prospective Diabetes Study (UKPDS) Group. Intensive blood glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet 1976; 352: 837–53. 2. Ha H, Hwang IA, Park JH, Lee HB. Role of reactive oxygen species in the pathogenesis of diabetic nephropathy. Diabetes Res. Clin. Pract. 2008; 82: S42–45. 3. Gupta R, Misra A. Type-2 diabetes epidemiology in India: Focus on regional disparities. Br. J. Diabetes Vasc. Dis. 2007; 79: 12–16. © 2014 Asian Pacific Society of Nephrology
Gene polymorphisms and diabetic nephropathy
4. Young BA, Maynard C, Boyko EJ. Racial differences in diabetic nephropathy, cardiovascular disease, and mortality in a national population of veterans. Diabetes Care 2003; 26: 2392–99. 5. Viswanathan V, Snehalatha C, Shina K, Lalitha S, Ramachandran A. Familial aggregation of diabetic kidney disease in Type 2 diabetes in South India. Diabetes Res. Clin. Pract. 1999; 43: 167–71. 6. Pezzolesi MG, Poznik GD, Skupien J et al. An intergenic region on chromosome 13q33.3 is associated with the susceptibility to kidney disease in type 1 and type 2 diabetes. Kidney Int. 2011; 80: 105–11. 7. Neugebauer S, Baba T, Watanabe T. Association of the nitric oxide synthase gene polymorphism with an increased risk for progression to diabetic nephropathy in type 2 diabetes. Diabetes 2000; 49: 500–3. 8. Shimizu T, Onuma T, Kawamori R, Makita Y, Tomino Y. Endothelial nitric oxide synthase gene and the development of diabetic nephropathy. Diabetes Res. Clin. Pract. 2002; 58: 179–85. 9. Shin Shin Y, Baek SH, Chang KY et al. Relations between eNOS Glu298Asp polymorphism and progression of diabetic nephropathy. Diabetes Res. Clin. Pract. 2004; 65: 257–65. 10. Liu Y, Burdon KP, Langefeld CD et al. T−786C polymorphism of the endothelial nitric oxide synthase gene is associated with albuminuria in the diabetes heart study. J. Am. Soc. Nephrol. 2005; 16: 1085–90. 11. Ahluwalia TS, Ahuja M, Rai TS et al. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians. Mol. Cell. Biochem. 2008; 314: 9–17. 12. Miyamoto Y, Saito Y, Nakayama M et al. Replication protein A1 reduces transcription of the endothelial nitric oxide synthase gene containing a −786T/C mutation associated with coronary spastic angina. Hum. Mol. Genet. 2000; 9: 2629–37. 13. Tesauro M, Thompson WC, Rogliani P, Qi L, Chaudhary PP, Moss J. Intracellular processing of endothelial nitric oxide synthase isoforms associated with differences in severity of cardiopulmonary diseases: Cleavage of proteins with aspartate vs. glutamate at position 298. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2832–35. 14. Wang XL, Sim AS, Badenhop RF, McCredie RM, Wilcken DE. A smoking-dependent risk of coronary artery disease associated with a polymorphism of the endothelial nitric oxide synthase gene. Nat. Med. 1996; 2: 41–5. 15. Zou AP, Li N, Cowley AW Jr. Production and actions of superoxide in the renal medulla. Hypertension 2001; 37: 547–53. 16. Guzik TJ, West N, Black EJ, McDonald E, Ratnatunga D. Functional effect of the C242T polymorphism in the NAD(P)H oxidase p22phox gene on vascular superoxide production in atherosclerosis. Circulation 2000; 102: 1744–47. 17. Soriano FG, Virag L, Szabó C. Diabetic endothelial dysfunction: Role of reactive oxygen and nitrogen species production and poly (ADP-ribose) polymerase activation. J. Mol. Med. 2001; 79: 437–48.
© 2014 Asian Pacific Society of Nephrology
18. Wang XG, Wang ZQ, Tong WM, Shen Y. PARP1 Val762Ala polymorphism reduces enzymatic activity. Biochem. Biophys. Res. Commun. 2007; 354: 122–26. 19. Minchenko AG, Stevens MJ, White L et al. Diabetes-induced overexpression of endothelin-1 and endothelin receptors in the rat renal cortex is mediated via poly(ADP-ribose) polymerase activation. FASEB J. 2003; 17: 1514–16. 20. Caldecott KW, Aoufouchi S, Johnson P, Shall S. XRCC1 polypeptide interacts with DNA polymerase beta and possibly poly ADP-ribose polymerase, and DNA ligase III is a novel molecular ‘nick-sensor’ in vitro. Nucleic Acids Res. 1996; 24: 4387–94. 21. Lahiri DK, Nurnberger JI. A rapid nonenzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991; 19: 5444. 22. Nakagawa T, Sato W, Glushakova O et al. Diabetic endothelial nitric oxide synthase knockout mice develop advanced diabetic nephropathy. J. Am. Soc. Nephrol. 2007; 18: 539–50. 23. Derubertis FR, Craven PA. Activation of protein kinase C in glomerular cells in diabetes: Mechanism and potential links to the pathogenesis of diabetic glomerulopathy. Diabetes 1994; 43: 1–8. 24. Zintzaras E, Papathanasiou AA, Stefanidis I. Endothelial nitric oxide synthase gene polymorphisms and diabetic nephropathy: A HuGE review and meta-analysis. Genet. Med. 2009; 11: 695–706. 25. He Y, Fan Z, Zhang J et al. Polymorphisms of eNOS gene are associated with diabetic nephropathy: A meta-analysis. Mutagenesis 2011; 26: 339–49. 26. Soriano FG, Mabley JG, Pacher P, Liaudet L, Szabó C. Rapid reversal of the diabetic endothelial dysfunction by pharmacological inhibition of poly(ADP-ribose) polymerase. Circ. Res. 2001; 89: 684–91. 27. Lim SC, Goh SK, Lai YR et al. Relationship between common functional polymorphisms of the p22phoxgene (-930A>G and +242C>T) and nephropathy as a result of Type 2 diabetes in a Chinese population. Diabet. Med. 2006; 23: 1037–41. 28. Tiwari AK, Prasad P, Thelma BK et al. Oxidative stress pathway genes and chronic renal insufficiency in Asian Indians with Type 2 diabetes. J. Diabetes Complications 2009; 23: 102–11. 29. Matsunaga-Irie S, Maruyama T, Yamamoto Y et al. Relation between development of nephropathy and the p22phox C242T and receptor for advanced glycation end product G1704T gene polymorphisms in type 2 diabetic patients. Diabetes Care 2004; 27: 303–07. 30. Ismail N, Becker B, Strzelczyk P, Ritz E. Renal disease and hypertension in noninsulin-dependent diabetes mellitus. Kidney 1999; 55: 1–28. 31. Murussi M, Baglio P, Gross JL, Silveiro SP. Risk factors for microalbuminuria and macroalbuminuria in type 2 diabetic patients: A 9-year follow-up study. Diabetes Care 2002; 25: 1101–3.
629
Nephrology 19 (2014) 623–629
Original Article
Polymorphisms in oxidative stress pathway genes and risk of diabetic nephropathy in South Indian type 2 diabetic patients PARIMALA NARNE,1 KAMAKSHI CHAITHRI PONNALURI,1 MOHAMMED SIRAJ2 and MOHAMMED ISHAQ1 1
Department of Genetics, Osmania University and 2Department of Medicine, Deccan College of Medical Sciences, Hyderabad, India
KEY WORDS: diabetic nephropathy, oxidative stress, polymorphism, type 2 diabetes mellitus. Correspondence: Dr Parimala Narne, Department of Genetics, Osmania University, Hyderabad 500 007, India. Email: [email protected]. Accepted for publication 11 June 2014. Accepted manuscript online 8 July 2014. doi:10.1111/nep.12293 Conflict of Interest Statement The authors declare that they have no conflict of interest.
SUMMARY AT A GLANCE The authors investigated the contribution of polymorphisms of oxidative stress genes in the development of DN in the South Indian T2DM population. They showed that eNOS and PARP-1 gene variants were associated with increased and reduced susceptibility to DN, respectively.
ABSTRACT: Aim: Diabetic nephropathy (DN), a common microvascular complication of type 2 diabetes mellitus (T2DM) is polygenic, with a vast array of genes contributing to disease susceptibility. Accordingly, we explored the association between DN and six polymorphisms in oxidative stress related genes, namely eNOS, p22phox subunit of NAD(P)H oxidase, PARP-1 and XRCC1 in South Indian T2DM subjects. Methods: The study included 155 T2DM subjects with DN and 162 T2DM patients with no evidence of DN. The selected polymorphisms were genotyped by polymerase chain reaction and Taqman allele discrimination assay. Results: No significant difference was observed in the genotype and allele distribution of eNOS −786T>C, intron 4a4b, p22phox 242C>T and XRCC1 Arg399Gln polymorphisms between T2DM groups with and without DN. Contrastingly, there appeared to be a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN wherein, the presence of 894T allele was associated with an enhanced risk for DN [P = 0.005; OR = 1.78 (1.17–2.7)], while the 762Ala allele seemed to confer significant protection against DN [P = 0.02; OR = 0.59 (0.37–0.92)]. Multiple logistic regression analysis revealed a significant and independent association of eNOS 894G>T, PARP-1 Val762Ala polymorphisms and hypertension with DN in T2DM individuals. Conclusions: eNOS 894G>T and PARP-1 Val762Ala polymorphisms appeared to associate significantly with DN, with the former contributing to an enhanced risk and the latter to a reduced susceptibility to DN in South Indian T2DM individuals.
Diabetic nephropathy (DN) is the predominant cause of renal failure in India. The primacy of persistent hyperglycaemia in the development of DN is exemplified by the fact that intensive glycemic control in type 2 diabetes mellitus (T2DM) is associated with reduced occurrence of DN.1 Oxidative stress has been inculpated as an important mediator in the pathophysiology of DN. The harmful sequelae of oxidative stress in the realm of DN include endothelial dysfunction, leukocyte adherence, impaired coagulation in the kidney and glomerular cell apoptosis. Hyperglycaemia spurs haemodynamic changes with a consequent shift in nitroso-oxidant balance towards a pro-oxidant state that accelerates tissue and vascular injury.2 There is a regional variation in the prevalence of diabetes in India, with southern and western Indian populations © 2014 Asian Pacific Society of Nephrology
being highly susceptible as compared to northern and eastern counterparts.3 There also appears to be a variable proclivity for renal disease, with African Americans, Asians and Native Americans being more vulnerable to developing DN than Caucasians.4 The promoters of progression of DN comprising albuminuria, hypertension and metabolic dysregulation only account for approximately one-third of the variability. Alongside, a plausible genetic basis that could elucidate the variable susceptibility has been advocated based on the reports on familial clustering of nephropathy and linkage to circumscribed regions of the human genome.5,6 Association studies using the candidate gene approach constitutes one of the principal strategies for identification of the genetic variants portending an increased risk for DN. Therein, polymorphic variants of the genes involved 623
P Narne et al.
in the oxidative stress pathways insinuated in DN could supposedly modulate the risk associated with development of DN in T2DM individuals. Candidate gene association studies focusing on oxidative stress-related pathologies have increasingly indicated that genetic variation in the vascular oxidative enzymes affecting redox balance could significantly underlie the interindividual variation in vascular oxidative stress. Accordingly, genetic variants of endothelial nitric oxide synthase (eNOS), namely −786T>C (rs2070744), 894G>T (rs1799983) (exon 7), 27 bp variable number tandem repeat (VNTR) 4a4b (intron 4) polymorphisms have been analyzed for their association with DN in different populations generating conflicting results.7–11 These sequence variants significantly lower the levels of endothelium-derived nitric oxide (NO) through alteration in eNOS gene expression and activity that spurs endothelial dysfunction and aggravated oxidative stress, which presage the development of DN. In that order, the −786T>C promoter polymorphism lessens the promoter activity by approximately 50% due to the differential binding of replication protein RpA1 at the site of −786C variant, while 894G>T polymorphism effectuates a selective proteolytic cleavage of eNOS protein due to a tight turn in the alpha helix, resulting in a reduction in NO bioavailability.12,13 With respect to intron 4a4b polymorphism, the 27 base pair repeats act as a cis-acting regulator of eNOS expression and the 4a allele with four 27bp repeats is associated with a significant lowering of NO levels.14 In a similar vein, the exonic and intronic variants of cytochrome b245 (CYBA) gene encoding the p22phox subunit of NAD(P)H oxidase, indispensable for the enzymatic activity, are surmised to contribute to an inter-individual variation in vascular superoxide (O2−) generation. This finds pathological relevance in the fact that NAD(P)H oxidase is critical for O2− generation in the mesangial cells, which in turn is substantiated by an experimental observation demonstrating a higher NAD(P)H oxidase dependent O2− generation in the renal cortex and outer medulla of the rat kidney.15 Therein, the 242C>T (rs4673) polymorphism in exon 4 of CYBA resulting in replacement of histidine by tyrosine at codon 72 (His72Tyr) in the putative heme binding site was selected for the study. Studies have averred that this genetic variant is associated with a reduced activity of the modified oxidase and hence contributes to an appreciable decline in vascular O2− production and alleviation of oxidative stress. By virtue of enhanced O2− production by NAD(P)H oxidase under hyperglycaemic conditions, it seems plausible for the 242C allele to confer a higher risk for DN and 242T allele to be associated with a significantly reduced O2− production.16 It is indeed reasonable to speculate that polymorphisms in DNA repair genes could modulate DNA repair efficiency. In this regard, the selection of Val762Ala (rs1136410) polymorphism in Poly (ADP-ribose) Polymerase-1 (PARP-1) gene for the current study seems cogent, with the consideration that PARP-1 overactivation is intrinsic to hyperglycaemia induced 624
reversible NADPH deficiency and that the variant allele (762Ala) is associated with a reduced activity of PARP-1 as evinced by in vitro enzymatic analysis.17,18 Thereby, a reduction in the activity of PARP-1 could possibly correspond to conservation of cellular energetic pools and abrogation of unfavourable sequelae of PARP overactivation in a hyperglycaemic milieu.19 Also, Arg399Gln (rs25487) polymorphism in exon 10 of X-ray Repair Cross Complementing group1 (XRCC1) gene has been reported to interfere with the complex assembly as the sequence variant is located in the PARP binding domain that spans the amino acids 301– 402.20 XRCC1 is a multidomain scaffolding protein and functions in DNA repair by complexing with PARP, DNA ligase III via a BRCT (BRCA1 C-terminal) domain in its carboxyl terminus and DNA polymerase H via the amino-terminal domain. This polymorphism is thereby understood to reduce DNA repair proficiency resulting in accumulation of altered DNA bases and potentiating oxidative DNA damage, culminating in cellular vascular senescence. There has been paucity of data concerning the contribution of the aforementioned polymorphisms towards the development of DN in South Indian population. In this milieu, we explored the association between the polymorphic variants of oxidative stress-related genes selected based on their biological plausibility, putative risk factors and DN in South Indian T2DM individuals.
MATERIALS AND METHODS Study participants and phenotypic data A total of 317 T2DM subjects visiting Kamineni hospitals, Hyderabad, were recruited for the study. Of these, 155 T2DM subjects diagnosed with a urinary albumin excretion of >300 mg/day on two different occasions in a span of 3–6 months, with diabetic retinopathy and without any clinical or laboratory evidence of other kidney disease, infectious condition and congestive heart disease constituted the diabetic nephropathy group (T2DM+DN). Similarly, a total of 162 T2DM subjects with a urinary albumin excretion of C
eNOS (rs1799983) 894G>T Glu298Asp
eNOS 27-bp dup 4a4b p22phox (rs4673) 242C>T His72Lys PARP-1 (rs1136410) 2444T>C Val762Ala XRCC1 (rs25487) 28152G>A Arg399Gln
Primers/Probes Probes T allele: 5'TET-CATCAAGCTCTTCCCTG GCTG-TAMRA3' C allele: 5'FAM-CATCAAGCTCTTCCCTGGCCG-TAMRA3' Primers F: 5'-CACCTGCATTCTGGGAACTGTA-3', R: 5'-GCCGCAGTA GCAGAGAGAC-3' Probes G allele: 5'TET-CCCCAGATGAGCCCCCAGAACT-TAMRA3', T allele: 5'FAM-CCCCAGATGATC CCCCAGAACTC-TAMRA3' Primers F: 5'-CGGTCGCTTCGACGTGCT-3' R: 5'-CCAGTCA ATCCCTTTGGTGCT-3' F: 5'-AGGCCCTATGGTAGTGCCTTT-3' R: 5'-TCTCTTAGTGCTGTGGTCAC-3' F: 5'-TGCTTGTGGGTAAACCAAGGCCGGTG-3'; R: 5'-AACAC TGAGGTAAGTGGGGGTGGCTCCTGT-3'
4a = 393bp 4b = 420bp C = 348bp T = 160bp,188bp
F: 5'-TTTGCTCCTCCAGGCCAACG-3' R: 5'-TGGAAGTTTGGGACCGCTGC-3'
Val = 210bp Ala = 190bp,20bp
F: 5'TTGTGC TTTCTCTGTGTCCA3' R: 5'TCCTCCAGCCTTTTCTGATA3'
Arg = 374bp,221bp Gln = 615bp
The genomic DNA was isolated from the whole blood by rapid salting out method.21
Genotype determination The respective primer and probe sequences and the polymerase chain reaction (PCR) products for the gene polymorphisms selected for this study are outlined in Table 1. The reaction mixture consisted of 30–500 ng of genomic DNA, 0.2 mM of each dNTP (Eppendorf, Hamburg, Germany), 10 pmol of each primer (Sigma Aldrich, St. Louis, MO, USA), 1.5 mM MgCl2, 1X Taq buffer and 1.0–1.25U of Taq DNA polymerase (Bangalore Genei, India) in a final volume of 25 μL. PCR cycling conditions included an initial denaturation of 5 min at 94°C, followed by 30 cycles of denaturation at 94°C (30–60 s), annealing at 58°C for 1 min (eNOS 4a4b), 56°C for 1 min (p22phox 242C4T), 62°C (PARP-1 Val762Ala) and 64°C (XRCC1 Arg399Gln) for 30 s respectively, elongation at 72°C (30 s– 2 min) and final elongation at 72°C for 5 min in an iCycler machine (Bio-Rad Laboratories, Hercules, CA, USA). The resulting PCR products were digested overnight at 37°C with RsaI (5U) for 242C4T, MspI (10U) for Arg399Gln and at 60°C with BstUI (5U) (New England Biolabs, Beverly, MA, USA) for Val762Ala polymorphisms respectively. The PCR products and the fragments resulting from restriction digestion were resolved on 10% polyacrylamide gels and visualized by ethidium bromide (10 mg/mL) staining. Genotyping of eNOS-786T>C and 894G>T polymorphisms was performed by Taqman Allele Discrimination Assay (Applied Biosystems, Carlsbad, CA, USA) and real-time PCR. Each 25 μL PCR volume consisted of 30 ng of genomic DNA, 300 nM primers, 100 nM probes, and 12.5 μL of TaqMan Universal PCR master mix (Eppendorf, Hamburg, Germany), which is a solution containing buffer, Uracil-N© 2014 Asian Pacific Society of Nephrology
Allele/Product Size
glycosylase, deoxyribonucleotides, uridine, passive reference dye (ROX), and TaqGold DNA polymerase. Amplification was done under the following conditions: 50°C, 2 min; 95°C, 10 min; followed by 40 cycles of 94°C for 15 s and 62°C for 1 min in a Perkin-Elmer 9600 thermocycler. Fluorescence in each well was measured before and after PCR using an ABI 7700 machine (Perkin Elmer, Applied Biosystems Division).
Statistical analysis Percentage distribution of the corresponding genotypes and alleles of selected gene polymorphisms was determined and the differences in genotype and allele frequencies between the specified groups were compared using the Pearson’s χ2 or Fisher’s exact tests as appropriate. Differences in continuous data among the groups were determined by unpaired student’s t-test. The risk estimates for alleles, genotype contrasts and various risk factors were obtained by computing odds ratio (OR) and respective 95% confidence interval (CI) by multiple logistic regression (MLR) analysis after adjusting for potential confounding variables. A two-tailed P-value of T and PARP-1 Val762Ala polymorphisms varied significantly between the two groups. It can be evinced from the data that T2DM+DN group demonstrated an increased frequency of GT, TT genotypes and 894T allele compared to T2DM individuals without nephropathy (T2DM) (P = 0.01, 0.005). Conversely, a decreased frequency of Val/Ala, Ala/ Ala genotypes and 762Ala allele with an accompanying increase in the frequency of Val/Val homozygotes and 762Val allele was observed in T2DM+DN group as compared to T2DM group (P = 0.036, 0.02). Contrastingly, there was no 626
discernible difference in the genotype distributions and allele frequencies of eNOS −786T>C, intron 4a/b; p22phox 242C>T and XRCC1 Arg399Gln polymorphisms between the two groups. The influence of the polymorphisms that emerged as significant ones, on development of DN was further assessed by comparing various genotype contrasts between T2DM+DN and T2DM groups (Table 4). Accordingly, it was observed that GT genotype per se and in combination with TT contributed maximally to an elevated risk for DN when compared with GG genotype carriers respectively. Further, the Val/Ala genotype in combination with Ala/Ala genotype was associated with a reduced risk for DN (P = 0.015) thereby conforming to the dominant model. Comparisons between Ala allele homozygotes (Ala/Ala) vs Val allele carriers (Val/ Ala+Val/Val) and heterozygotes (Val/Ala) vs Val allele homozygotes (Val/Val) revealed that imposition of protective effect was confined to the heterozygous genotype. Subsequently, a perusal of the results of MLR analysis aiming at identifying the independent risk factors for DN apparently indicated that hypertension and eNOS 894T allele were associated with an enhanced risk for DN while PARP-1 762Ala allele seemingly reduced the risk for development of DN in T2DM patients (Table 5).
DISCUSSION The present study aimed at comprehensively analyzing the association of selected polymorphisms in the genes related to oxidative stress and DN in South Indian T2DM patients. Analysis of the results suggested a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN. Further, we did not observe any association between eNOS −786T>C, intron 4a4b, p22phox 242C>T and XRCC1 Arg399Gln polymorphisms and DN in the study population. Studies have averred that dysfunctional eNOS partakes in DN pathogenesis, as evidenced by an increased susceptibility to glomerular disease in eNOS knockout diabetic mice.22 The significant association of eNOS 894G>T polymorphism with DN is seemingly relevant, as a genetic variation in eNOS gene (894G>T variant) forges a reduction in NO levels.13 This could further be potentiated by the persistent hyperglycaemic milieu that instigates an increased generation of ROS, the O2− in particular, which oxidizes the activating cofactor of eNOS, namely tetrahydrobiopterin (BH4) resulting in plummeting levels of BH4, with the resultant effect of disruption of eNOS dimerization and consequential eNOS uncoupling. This in turn precipitates the oxidative damage as eNOS becomes the net producer of O2− rather than NO. This further evokes a substantial reduction of NO-mediated cGMP generation, resulting in revoking the suppression of protein kinase C thereby escalating oxidant stress in the glomeruli of diabetic individuals, aggravating mesangial matrix expansion and further deteriorating endothelial function.23 Our results are in agreement with a © 2014 Asian Pacific Society of Nephrology
Gene polymorphisms and diabetic nephropathy
Table 3 Genotype and allele frequencies of the polymorphisms in the genes related to oxidative stress. Polymorphism eNOS −786T>C (rs2070744) eNOS 894G>T Glu298Asp (rs1799983) eNOS 27-bp dup 4a4b p22phox 242C>T His72Lys (rs4673) PARP-1 2444T>C Val762Ala (rs1136410) XRCC1 28152G>A Arg399Gln (rs25487)
Genotype TT TC CC GG GT TT 4b/b 4a/b 4a/a CC CT TT Val/Val Val/Ala Ala/Ala Arg/Arg Arg/Gln Gln/Gln
T2DM+DN (n = 155)
T2DM (n = 162)
P
Allele
T2DM+DN
T2DM
P
OR (95%CI)
89 (57.4) 59 (38.1) 7 (4.5) 85 (54.8) 64 (41.3) 6 (3.9) 98 (63.2) 52 (33.5) 5 (3.2) 81 (52.3) 56 (36.1) 18 (11.6) 117 (75.5) 37 (23.9) 1 (0.6) 73 (47.1) 65 (41.9) 17 (11.0)
102 (63.0) 57 (35.2) 3 (1.8) 114 (70.4) 46 (28.4) 2 (1.2) 99 (61.1) 59 (36.4) 4 (2.5) 88 (54.3) 62 (38.3) 12 (7.4) 101 (62.3) 58 (35.8) 3 (1.9) 96 (59.3) 52 (32.1) 14 (8.6)
0.31
T C
237 (76.5) 73 (23.5)
261 (80.6) 63 (19.4)
0.21
1.28 (0.86–1.9)
0.01
G T
234 (75.5) 76 (24.5)
274 (84.6) 50 (15.4)
0.005
1.78 (1.17–2.7)
0.82
b a
248 (80.0) 62 (20.0)
257 (79.3) 69 (21.3)
0.77
0.93 (0.62–1.39)
0.44
C T
218 (70.3) 92 (29.7)
238 (73.5) 86 (26.5)
0.43
1.17 (0.81–1.68)
0.036
Val Ala
271 (87.4) 39 (12.6)
260 (80.2) 64 (19.8)
0.02
0.59 (0.37–0.92)
0.1
Arg Gln
211 (68.1) 99 (31.9)
244 (75.3) 80 (24.7)
0.052
1.43 (0.99–2.06)
T2DM, Type 2 Diabetes Mellitus; DN, Diabetic Nephropathy; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; XRCC1, X-Ray Cross Complementing; OR, Odds Ratio; CI, Confidence Interval.
Table 4 Comparison of the genotype contrasts of eNOS 894G>T and PARP-1 Val762Ala polymorphisms in T2DM+DN and T2DM groups Group and genotype contrast eNOS 894G>T Dominant model GT and TT vs GG Recessive model TT vs GT and GG Homozygote codominant model TT vs GG Heterozygote co-dominant model GT vs GG PARP-1 Val762Ala Dominant model Val/Ala and Ala/Ala vs Val/Val Recessive model Ala/Ala vs Val/Val and Val/Ala Homozygote Codominant model Ala/Ala vs Val/Val Heterozygote Codominant model Val/Ala vs Val/Val
P†
OR (95%CI)†
P*
OR (95%CI)*
0.005
1.96 (1.23–3.19)
0.01
1.65 (1.18–2.92)
0.17
3.22 (0.58–23.46)
0.23
4.12 (0.65–27.61)
0.14
4.02 (0.71–29.62)
0.2
5.11 (0.8–31.42)
0.01
1.87 (1.13–3.08)
0.01
1.71 (1.1–2.88)
0.015
0.54 (0.32–0.89)
0.009
0.47 (0.29–0.85)
0.62
0.34 (0.01–3.75)
0.71
0.37 (0.09–4.2)
0.34
0.29 (0.01–3.17)
0.41
0.35 (0.05–4.11)
0.02
0.55 (0.33–0.93)
0.03
0.57(0.38–0.97)
†Unadjusted, calculated by Fisher’s exact test; *Adjusted for age, gender, duration of diabetes, family history of diabetes, body mass index, hypertension, systolic blood pressure, diastolic blood pressure, smoking, fasting blood glucose, postprandial blood glucose and serum lipids. T2DM, Type 2 Diabetes Mellitus; DN, Diabetic Nephropathy; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; OR, Odds Ratio; CI, Confidence Interval.
study in a north Indian population, wherein 894T allele and TT genotypes were associated with a high risk for DN in T2DM individuals.11 Evidence accumulated by meta-analysis studies indicated that 894G>T polymorphism is associated with susceptibility to DN in global and East Asian populations but not in Caucasians.24,25 With respect to eNOS −786T>C and intron 4a4b polymorphisms, our study observed no significant association with susceptibility to DN as reported in the north Indian population.11 Nonetheless, © 2014 Asian Pacific Society of Nephrology
there have been conflicting reports on the association of eNOS −786T>C and 4a/b polymorphisms with DN in different populations.7–11 These discrepancies could be attributed to ethnicity, geographic, sample size variations and phenotypic definitions. Further, meta-analysis studies indicated a significant association of 4a4b polymorphism with DN in an East Asian population but not in Caucasians, while no conceivable evidence was obtained for the association between −786T>C polymorphism and DN.24,25 627
P Narne et al.
Table 5 Multiple logistic regression analysis for the association between diabetic nephropathy, gene polymorphisms and other risk variables in type 2 diabetic patients Characteristic
Male sex Duration of T2DM BMI Hypertension Smoking Hyperlipidaemia eNOS 894T allele PARP-1 762Ala allele
Diabetic nephropathy P
OR (95%CI)
0.85 0.45 0.32 0.02 0.31 0.47 0.01 0.009
0.67 (0.32–3.25) 0.82 (0.65–2.29) 0.97 (0.85–1.74) 2.08 (1.02–4.21) 1.88 (0.64–4.02) 1.35 (0.54–4.87) 1.98 (1.47–3.61) 0.42 (0.31–0.89)
T2DM, Type 2 Diabetes Mellitus; BMI, Body Mass Index; eNOS, endothelial Nitric Oxide Synthase; PARP, Poly (ADP-ribose) Polymerase; OR, Odds Ratio; CI, Confidence Interval.
The observed association of PARP-1 Val762Ala polymorphism with DN in our study could predicate on the observation that 762Ala allele is associated with a significant reduction in the PARP-1 activity due to an increase in the Km of the enzyme for trans poly(ADP-ribosyl)ation.18 This could plausibly vanquish the unfavourable sequelae of PARP-1 overactivation in a hyperglycaemic milieu and confer a protective effect against development of DN. Alternatively, the Val762 allele is associated with an uncurbed activity of PARP-1 resulting in rapid depletion of energy stores with a concomitant suppression of endothelium dependent vasodilation. It also augurs well with the fact that overactivation of PARP regulates activation of transcription factors NF-kB, STAT-1, Oct-1 and p53, which in turn upregulate the expression of cyclooxygenase-2, inducible nitric oxide synthase, cell adhesion molecules and inflammatory cytokines that foment the renal injury due to incident oxidant stress.17 The protective effect of 762Ala allele against DN in our study also seems to be congruent with the experimental observations, wherein attenuation of PARP activation by PARP inhibitors counteracted the overexpression of endothelin-1 and its receptors in the renal cortex.19 This also stymied the above discussed attendant sequelae of PARP-1 overactivation, thereby ameliorating oxidative stress and endothelial dysfunction. This was further corroborated by an observation wherein the presence of glomerular depositions of IgG was significantly reduced in streptozotocin diabetic rats treated with the PARP inhibitor nicotinamide.26 The other genetic variants investigated for their possible association with DN generated no significant results. With reference to p22phox 242C>T polymorphism, our results are in concurrence with a study in Chinese T2DM population wherein, no significant association with DN was observed.27 Also, evaluation of this polymorphism in relation to chronic renal insufficiency in Indian T2DM population did not reveal any significant association.28 On the contrary, the CC genotype was reported to be more frequent in the T2DM+DN group in a Japanese population.29 Nevertheless, it is increas628
ingly possible for this polymorphism to exert its effect in concert with other polymorphic variants in the vicinity, which emphasizes the need for further investigations. By the same token, the analysis of XRCC1 Arg399Gln polymorphism in conjunction with other polymorphic variants of XRCC1 gene could possibly provide a vivid picture of the role of XRCC1 in DN pathogenesis, which could be reserved for future investigations. Further, the predominance of hypertensive individuals in the T2DM+DN group seems to be pertinent as systemic hypertension can incite endothelial injury in diabetics with disordered renal autoregulation. An association between subsequent development of DN and higher systemic pressures, particularly in the hypertensive range has been observed in prospective and animal studies.30 Also, control of hypertension has been portrayed to be an important and powerful intervention in attenuating the progression of DN.31 Taken together, the results from our study suggest a significant association of eNOS 894G>T and PARP-1 Val762Ala polymorphisms with DN in T2DM individuals. Nevertheless, the study is not without limitations. The study apparently is not sufficiently powered to obtain conclusive evidence. However, it could be viewed as proffering clues for obtaining valuable information regarding the influence of the investigated polymorphisms on the susceptibility to DN in larger populations and in different ethnicities, with simultaneous biochemical evaluation of markers of oxidative stress induced cellular and DNA damage. This would substantially contribute towards deciphering the mechanisms that modulate the susceptibility to or protection against DN, which could eventually facilitate the identification of pharmacological targets for diminishing the risk associated with the development and progression of DN in T2DM individuals.
ACKNOWLEDGEMENTS This study was carried out at Immunogenetics Laboratory, Department of Genetics, Osmania University, Hyderabad, India. We thank University Grants Commission (UGC) and Council of Scientific and Industrial Research (CSIR), New Delhi for providing research fellowships to Parimala Narne and Kamakshi Chaithri Ponnaluri, respectively. We are grateful to all the patients who participated in this study.
REFERENCES 1. UK Prospective Diabetes Study (UKPDS) Group. Intensive blood glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet 1976; 352: 837–53. 2. Ha H, Hwang IA, Park JH, Lee HB. Role of reactive oxygen species in the pathogenesis of diabetic nephropathy. Diabetes Res. Clin. Pract. 2008; 82: S42–45. 3. Gupta R, Misra A. Type-2 diabetes epidemiology in India: Focus on regional disparities. Br. J. Diabetes Vasc. Dis. 2007; 79: 12–16. © 2014 Asian Pacific Society of Nephrology
Gene polymorphisms and diabetic nephropathy
4. Young BA, Maynard C, Boyko EJ. Racial differences in diabetic nephropathy, cardiovascular disease, and mortality in a national population of veterans. Diabetes Care 2003; 26: 2392–99. 5. Viswanathan V, Snehalatha C, Shina K, Lalitha S, Ramachandran A. Familial aggregation of diabetic kidney disease in Type 2 diabetes in South India. Diabetes Res. Clin. Pract. 1999; 43: 167–71. 6. Pezzolesi MG, Poznik GD, Skupien J et al. An intergenic region on chromosome 13q33.3 is associated with the susceptibility to kidney disease in type 1 and type 2 diabetes. Kidney Int. 2011; 80: 105–11. 7. Neugebauer S, Baba T, Watanabe T. Association of the nitric oxide synthase gene polymorphism with an increased risk for progression to diabetic nephropathy in type 2 diabetes. Diabetes 2000; 49: 500–3. 8. Shimizu T, Onuma T, Kawamori R, Makita Y, Tomino Y. Endothelial nitric oxide synthase gene and the development of diabetic nephropathy. Diabetes Res. Clin. Pract. 2002; 58: 179–85. 9. Shin Shin Y, Baek SH, Chang KY et al. Relations between eNOS Glu298Asp polymorphism and progression of diabetic nephropathy. Diabetes Res. Clin. Pract. 2004; 65: 257–65. 10. Liu Y, Burdon KP, Langefeld CD et al. T−786C polymorphism of the endothelial nitric oxide synthase gene is associated with albuminuria in the diabetes heart study. J. Am. Soc. Nephrol. 2005; 16: 1085–90. 11. Ahluwalia TS, Ahuja M, Rai TS et al. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians. Mol. Cell. Biochem. 2008; 314: 9–17. 12. Miyamoto Y, Saito Y, Nakayama M et al. Replication protein A1 reduces transcription of the endothelial nitric oxide synthase gene containing a −786T/C mutation associated with coronary spastic angina. Hum. Mol. Genet. 2000; 9: 2629–37. 13. Tesauro M, Thompson WC, Rogliani P, Qi L, Chaudhary PP, Moss J. Intracellular processing of endothelial nitric oxide synthase isoforms associated with differences in severity of cardiopulmonary diseases: Cleavage of proteins with aspartate vs. glutamate at position 298. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2832–35. 14. Wang XL, Sim AS, Badenhop RF, McCredie RM, Wilcken DE. A smoking-dependent risk of coronary artery disease associated with a polymorphism of the endothelial nitric oxide synthase gene. Nat. Med. 1996; 2: 41–5. 15. Zou AP, Li N, Cowley AW Jr. Production and actions of superoxide in the renal medulla. Hypertension 2001; 37: 547–53. 16. Guzik TJ, West N, Black EJ, McDonald E, Ratnatunga D. Functional effect of the C242T polymorphism in the NAD(P)H oxidase p22phox gene on vascular superoxide production in atherosclerosis. Circulation 2000; 102: 1744–47. 17. Soriano FG, Virag L, Szabó C. Diabetic endothelial dysfunction: Role of reactive oxygen and nitrogen species production and poly (ADP-ribose) polymerase activation. J. Mol. Med. 2001; 79: 437–48.
© 2014 Asian Pacific Society of Nephrology
18. Wang XG, Wang ZQ, Tong WM, Shen Y. PARP1 Val762Ala polymorphism reduces enzymatic activity. Biochem. Biophys. Res. Commun. 2007; 354: 122–26. 19. Minchenko AG, Stevens MJ, White L et al. Diabetes-induced overexpression of endothelin-1 and endothelin receptors in the rat renal cortex is mediated via poly(ADP-ribose) polymerase activation. FASEB J. 2003; 17: 1514–16. 20. Caldecott KW, Aoufouchi S, Johnson P, Shall S. XRCC1 polypeptide interacts with DNA polymerase beta and possibly poly ADP-ribose polymerase, and DNA ligase III is a novel molecular ‘nick-sensor’ in vitro. Nucleic Acids Res. 1996; 24: 4387–94. 21. Lahiri DK, Nurnberger JI. A rapid nonenzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991; 19: 5444. 22. Nakagawa T, Sato W, Glushakova O et al. Diabetic endothelial nitric oxide synthase knockout mice develop advanced diabetic nephropathy. J. Am. Soc. Nephrol. 2007; 18: 539–50. 23. Derubertis FR, Craven PA. Activation of protein kinase C in glomerular cells in diabetes: Mechanism and potential links to the pathogenesis of diabetic glomerulopathy. Diabetes 1994; 43: 1–8. 24. Zintzaras E, Papathanasiou AA, Stefanidis I. Endothelial nitric oxide synthase gene polymorphisms and diabetic nephropathy: A HuGE review and meta-analysis. Genet. Med. 2009; 11: 695–706. 25. He Y, Fan Z, Zhang J et al. Polymorphisms of eNOS gene are associated with diabetic nephropathy: A meta-analysis. Mutagenesis 2011; 26: 339–49. 26. Soriano FG, Mabley JG, Pacher P, Liaudet L, Szabó C. Rapid reversal of the diabetic endothelial dysfunction by pharmacological inhibition of poly(ADP-ribose) polymerase. Circ. Res. 2001; 89: 684–91. 27. Lim SC, Goh SK, Lai YR et al. Relationship between common functional polymorphisms of the p22phoxgene (-930A>G and +242C>T) and nephropathy as a result of Type 2 diabetes in a Chinese population. Diabet. Med. 2006; 23: 1037–41. 28. Tiwari AK, Prasad P, Thelma BK et al. Oxidative stress pathway genes and chronic renal insufficiency in Asian Indians with Type 2 diabetes. J. Diabetes Complications 2009; 23: 102–11. 29. Matsunaga-Irie S, Maruyama T, Yamamoto Y et al. Relation between development of nephropathy and the p22phox C242T and receptor for advanced glycation end product G1704T gene polymorphisms in type 2 diabetic patients. Diabetes Care 2004; 27: 303–07. 30. Ismail N, Becker B, Strzelczyk P, Ritz E. Renal disease and hypertension in noninsulin-dependent diabetes mellitus. Kidney 1999; 55: 1–28. 31. Murussi M, Baglio P, Gross JL, Silveiro SP. Risk factors for microalbuminuria and macroalbuminuria in type 2 diabetic patients: A 9-year follow-up study. Diabetes Care 2002; 25: 1101–3.
629
