Reproductive BioMedicine Online (2014) 29, 745–751
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Polymorphisms in the fibrinolytic pathway genes and the risk of recurrent spontaneous abortion Prabha H Andraweera a,b,*, Gustaaf A Dekker a,c, Steven D Thompson a, Rachael C Nowak a, Rohan W Jayasekara b, Vajira HW Dissanayake b, Claire T Roberts a a
School of Paediatrics and Reproductive Health, Robinson Research Institute, University of Adelaide, Adelaide, Australia; Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka; c Women’s and Children’s Division, Lyell McEwin Hospital, Elizabeth Vale, South Australia, Australia b
* Corresponding author.
E-mail address: [email protected] (P Andraweera). Prabha Andraweera MBBS, PhD, is a Postdoctoral Fellow in the Discipline of Obstetrics and Gynaecology, Robinson Research Institute, University of Adelaide, Australia. Her current research focuses on the role of genetics of adverse pregnancy outcomes, including recurrent miscarriage, preeclampsia, intrauterine growth restriction, preterm birth and gestational diabetes mellitus. Her basic science research explores the molecular pathways in the placenta that are implicated in the pathogenesis of these pregnancy complications.
Impaired fibrinolytic activity is implicated in the pathogenesis of recurrent spontaneous abortion (RSA). This case-control study assessed the prevalence of polymorphisms in fibrinolytic system genes in RSA. Cases comprised 202 Sinhalese women who had experienced at least two first-trimester spontaneous abortions and had no living children; controls were 202 women with no history of spontaneous abortion and two or more living children. The groups were matched for age and ethnicity. DNA was genotyped using the Sequenom MassARRAY system. The PLAUR rs4251923 A (OR 95% CI 2.3 [1.3 to 4.0]), SERBP2 rs6098 A (OR 95% CI 1.4 [1.1 to 1.9]) and SERBP2 rs6103 C alleles (OR 95% CI 1.4 [1.1 to 1.9]) were increased in the RSA group compared with controls. The prevalence of PLAUR rs4251923/ SERBP2 rs6098/ SERBP2 rs6103 GG/AA/CC (OR 95% CI 2.4 [1.2 to 4.9], GA/GA/GC(OR 95% CI 3.9 [1.3 to 11.2]), GA/AA/CC (OR 95% CI 2.9 [1.0 to 8.6] and GA/GG/GG (OR 95% CI 21.3 [1.1 to 410.3]) genotypes were also increased in cases. Polymorphisms in the fibrinolytic system genes are associated with RSA in Sinhalese women. These likely impair implantation.
Abstract
© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. KEYWORDS: fibrinolytic pathway, gene, miscarriage, polymorphism, pregnancy
http://dx.doi.org/10.1016/j.rbmo.2014.08.014 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
746
Introduction Recurrent spontaneous abortion (RSA), defined as two or more spontaneous abortions before 20 weeks of gestation, affects about 1–3% of couples (Practice Committee of American Society for Reproductive Medicine, 2013). Hereditary and acquired thrombophilias, as well as fibrinolytic defects, are known to be associated with increased risk of RSA (Gris et al., 1990; Patnaik et al., 2007; Quenby et al., 2005; Rey et al., 2003). Hypo-fibrinolysis is known to be associated with thrombosis, but importantly the fibrinolytic system also participates in the regulation of early placental trophoblast invasion. The urokinase type plasminogen activator (uPA) encoded by the PLAU gene is activated after it binds to its receptor (uPAR) encoded by the PLAUR gene and converts the inactive proenzyme plasminogen (PLG) to active plasmin, which in-turn cleaves fibrin (Naruse et al., 2009). Plasmin promotes trophoblast invasion by activating matrix metalloproteinases and by degrading some components of the extracellular matrix of the decidua (Naruse et al., 2009). This process is inhibited by binding of either the major plasminogen activator inhibitors (PAI-1 encoded by the SERBP gene or PAI-2 encoded by the SERBP2 gene) to the uPA/uPAR complex leading to internalisation of the ligand-receptor complex (Naruse et al., 2009). The first evidence of a role of the fibrinolytic system in the pathogenesis of RSA was reported in 1990 when Gris et al. (1990) reported that maternal venous plasminogen activator inhibitor activity was increased in women who had experience RSA. Subsequently, however, few groups have studied the effects of this pathway in RSA. It was recently demonstrated that the concentrations of uPA and uPAR were decreased in the uterine fluid of women experiencing idiopathic RSA (Skrzypczak et al., 2007). In addition, some investigators demonstrated that polymorphisms in SERBP1 are associated with RSA. Because interactions among many proteins in the fibrinolytic pathway are vital for the optimal physiological function of the fibrinolytic system, it is important to identify the prevalence of a combination of polymorphisms in genes of this system in women with RSA. Therefore, the aim of this study was to investigate the association of selected polymorphisms in PLAU, PLAUR, PLG, SERBP1 and SERBP2 in Sinhalese women who had experienced RSA.
Materials and methods In this case-control study, all 404 DNA samples that comprised a biobank of samples extracted from peripheral blood of 404 recruited women were analysed with the aim of identifying genetic variants that are associated with RSA. The participants were consecutively recruited at two tertiary care maternity hospitals and at the Human Genetics Unit of the Faculty of Medicine, University of Colombo, Sri Lanka between January 2006 and December 2008. The study was approved by the Ethics Review Committee of the Faculty of Medicine, University of Colombo, Sri Lanka (EC/05/003, 10/02/2005) and the Human Ethics Committee of the University of Adelaide, Australia (H147-2008, 13/11/2008). All women provided written informed consent. The study population consisted of
PH Andraweera et al. 202 women who had experienced RSA and 202 control participants. The eligibility criteria for recruitment into the RSA group included women who had experienced at least two consecutive first-trimester pregnancy losses and having no living children. All women in the RSA group had been assessed by an obstetrician and had undergone routine testing to identify a cause for RSA, including endocrine disorders, structural abnormalities of the reproductive tract, thrombophilias and antiphospholipid antibody syndrome. Those with an identifiable cause for RSA were not eligible for participation. The other exclusion criteria were non-Sinhalese women or women of mixed ethnicity, pregnancy fathered by a non-Sinhalese man and chromosome abnormalities in the woman or the partner identified by high-resolution karyotyping. The control participants were 202 women matched for ethnicity and age who had two or more living children and who did not have a past history of spontaneous abortion. The following polymorphisms of the fibrinolytic pathway genes were selected: PLAU rs2227564, PLAUR rs4251923, PLG rs4252114, SERBP1 rs1799889, SERBP1 rs1799768, SERBP2 rs6103 and SERBP2 rs6098. Selection was based on known functional effects or previous reported associations with disease phenotypes. Peripheral blood samples were collected from the women, and DNA was extracted using QiaAmp blood midi DNA extraction kits (Qiagen). Genotyping was carried out at the Australian Genome Research Facility using the Sequenom MassARRAY system. The primers used for genotyping are detailed in Table 1. As a quality-control measure, 300 independent DNA samples from women recruited to a study on adverse pregnancy outcomes in Adelaide, Australia, were genotyped in house for the same single nucleotide polymorphisms using real-time polymerase chain reaction and highresolution melt. The concordance rate of the real-time polymerase chain reaction results and MassARRAY results was 100%. Each sample was also genotyped for amelogenin to ensure that the sex of the sample was correct. Chi-squared test was used to test the genotypes at each polymorphic locus for Hardy–Weinberg equilibrium and to compare categorical variables. PASW version 17.02 (SPSS, Chicago, IL) was used for all data analyses. The genotype and allele frequencies of cases were compared with controls using chi-squared analyses. Results were reported as number and per cent or mean ± SD where appropriate. P < 0.05 was considered statistically significant. A false discovery rate (FDR) correction was made to adjust for multiple comparisons controlling the FDR at 15% (Benjamini et al., 2001). The prevalence of the polymorphisms in the general population was determined by genotyping 85 randomly selected Sinhalese men and women. On the basis of prevalence of a polymorphism in 20% of the general population, a ratio of one control participant to one case, 202 women who had experienced recurrent pregnancy loss and 202 control participants had 80% power to detect an odds ratio of 2.0 (β = 80%, α = 0.05).
Results The mean age of the women in the RSA group was 31.9 ± 0.4 years and the mean age of the control group was 32.3 ± 0.3 years. Of the 202 women in the RSA group, 140 (69.3%) had experienced three or more first-trimester pregnancy losses
Table 2
CTAATGCACCATGCACTCTTGGACAAGC TGAAGGGCAAAGGGGT ACTTATAATTGGAAATTGCACTTAC GTCTGGACACGTGGGG CCGCGGATGATACACGGCTGACTCCCC CTTTTATTGACACTTTCCAGTAAATAAT TTTTCTTATTATGCATAAGATAACCAA
Extend primer
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion
747
Characteristics of the study population.
Characteristic
Age (years) Pregnancy loss n (%) T1 only T1 and T2 T1 and T3 T1, T2 and T3 ≥ 3 T1 losses
Controls
Recurrent spontaneous abortion
(n = 202)
(n = 202)
32.3 ± 0.33
31.9 ± 0.41
0 0 0 0 0
114 (56.4) 75 (37.1) 9 (4.5) 4 (2.0) 140 (69.3)
PCR = polymerase chain reaction.
ACGTTGGATGTGGTGCTATGTGCAGGTGG ACGTTGGATGACCTGAAATCCCCCTCTCTG ACGTTGGATGCACTCAGTAGGGACCCATAA ACGTTGGATGTTCCCTCATCCCTGCCATGT ACGTTGGATGGTTGTTGACACAAGAGAGCC ACGTTGGATGTCTCAGCTCTGCAATCAATG ACGTTGGATGAAAATCTGCCGAAAAATAA ACGTTGGATGAGTGATGCTCACCATCTGCG ACGTTGGATGAAGTCTGTAGGGCTGGGAG ACGTTGGATGGAAAGAACAGATAGAGTACTT ACGTTGGATGCACAGAGAGAGTCTGGACAC ACGTTGGATGCTCCGATGATACACGGCTGA ACGTTGGATGTCGCAGACTTCTCACCAAAC ACGTTGGATGACAGTTTGTGGCAGATCATC PLAU rs2227564 PLAUR rs4251923 PLG rs4252114 SERBP1 rs1799889 SERBP1 rs1799768 SERBP2 rs6098 SERBP2 rs6103
Second PCR primer First PCR primer Single single nucleotide polymorphisms
Table 1
Primer sequences for Sequenom MassArray system.
T1 = first trimester; T2 = second trimester; T3 = third trimester.
and 114 (56.4%) had experienced only first-trimester pregnancy losses (Table 2). All cases and controls were non smokers. All polymorphisms were in Hardy–Weinberg equilibrium in both cases and controls. PLAUR rs4251923 A allele (OR 95% CI 2.3 [1.3 to 4.0]; P = 0.003), SERBP2 rs6098 A allele (OR (95% CI 1.4 [1.1 to 1.9]; P = 0.01 and SERBP2 rs6103 C allele (OR 95% CI 1.4 [1.1 to 1.9]; P = 0.01) were increased in women in the RSA group compared with controls (Table 3). These results were significant after FDR correction for multiple testing. The other polymorphisms were not associated with RSA (Table 3). When the RSA was stratified in to those who had experienced only first-trimester pregnancy losses and those who had experienced first-trimester as well as second and third trimester pregnancy losses, PLAUR rs4251923 A allele (OR 95% CI 2.9 [1.6 to 5.4]; P = 0.002), SERBP2 rs6098 A allele (OR 95% CI 1.5 [1.1 to 2.2]; P = 0.02) and SERBP2 rs6103 C allele (OR 95% CI 1.6 [1.1 to 2.2]; P = 0.01) and SERBP1 rs1799768 5G allele (OR 95% CI 1.9 [1.4 to 2.7]; P = 0.0002) were increased among women who had experienced only firsttrimester spontaneous abortions compared with controls (Table 3). None of the polymorphisms were associated with RSA in women who had experienced first trimester as well as second and third trimester pregnancy losses (Table 3). As a posthoc analysis, RSA and control groups were stratified into genotype groups based on the significant associations. The combination of the reduced risk GG/GG/GG genotypes of the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 polymorphisms were used as the referent. The combinations of genotypes evident in the study population and the associations with RSA are detailed in Table 4. The prevalence of combinations of risk genotypes were increased in the RSA group compared with the control group.
Discussion As far as is known, this is the first study to investigate a combination of polymorphisms in the fibrinolytic system genes in Sinhalese women experiencing RSA. Our findings show that PLAUR rs4251923, SERBP2 rs6103 and SERBP2 rs6098 are individually associated with RSA and that genotype combinations of these polymorphisms increase the risk of RSA.
SNP genotype and allele
a
RSA All
OR (95% CI)
P
OR (95% CI)
n (%)
n (%)
73 103 25 249 153
(36.3) (51.3) (12.4) (61.9) (38.1)
88 84 29 260 142
(43.8) (41.8) (14.4) (64.7) (35.3)
1 NS NS 1 NS
1.0 0.7 0.9 1.0 0.9
(ref) (0.4–1.0) (0.5–1.8) (ref) (0.7–1.2)
54 46 14 154 74
(47.4) (40.3) (12.3) (67.5) (32.5)
1 0.04 NS 1 NS
1.0 0.6 1.2 1.0 0.8
182 19 0 383 19
(90.5) (9.5) (95.3) (4.7)
161 37 2 359 41
(80.5) (18.5) (1.0) (89.8) (10.2)
1 0.008 NS 1 0.003
1.0 2.2 5.7 1.0 2.3
(ref) (1.2–4.0) (0.3–118.6) (ref) (1.3–4.0)
86 25 2 197 29
(76.1) (22.1) (1.8) (87.2) (12.8)
1 0.002 NS 1 0.002
158 39 1 355 41
(79.8) (19.7) (0.5) (89.6) (10.4)
164 34 1 362 36
(82.4) (17.1) (0.5) (91.0) (9.0)
1 NS NS 1 NS
1.0 0.8 0.9 1.0 0.9
(ref) (0.5–1.4) (0.1–15.6) (ref) (0.5–1.4)
94 18 0 206 18
(83.9 (16.1)
96 43 60 235 163
(48.2) (21.6) (30.2) (59.0) (41.0)
92 34 73 218 180
(46.2) (17.1) (36.7) (54.8) (45.2)
1 NS NS 1 NS
1.0 0.8 1.3 1.0 1.2
(ref) (0.5–1.4) (0.8–1.9) (ref) (0.9–1.6)
47 99 54 193 207
(23.5) (49.5) (27.0) (48.2) (51.2)
42 92 67 176 226
(20.9) (45.8) (33.3) (43.8) (56.2)
1 NS NS 1 NS
1.0 1.0 1.4 1.0 1.2
28 96 77 152 250
(13.9) (47.8) (38.3) (37.8) (62.2)
20 79 102 119 283
(10.0) (39.3) (50.7) (29.6) (70.4)
1 NS NS 1 0.01
29 93 76 151 245
(14.6) (47.0) (38.4) (38.1) (61.9)
20 78 101 118 280
(10.0) (39.2) (50.8) (29.6) (70.4)
1 NS 0.04 1 0.01
n (%)
P
OR (95% CI)
n (%)
(ref) (0.4–0.9) (0.6–2.6) (ref) (0.6–1.1)
34 38 15 106 68
(39.1) (43.7) (17.2) (60.9) (39.1)
1 NS NS 1 NS
1.0 0.8 1.3 1.0 1.0
(ref) (0.5–1.4) (0.6–2.3) (ref) (0.7–1.5)
1.0 2.8 10.6 1.0 2.9
(ref) (1.4–5.3) (0.5–222.3) (ref) (1.6–5.4)
75 12 0 162 12
(86.2) (13.8) (93.1) (6.9)
1 NS NS 1 NS
1.0 1.5 2.4 1.0 1.5
(ref) (0.7–3.3) (0.05–123.1) (ref) (0.7–3.1)
(91.9) (8.1)
1 NS NS 1 NS
1.0 0.8 0.6 1.0 0.7
(ref) (0.4–1.4) (0.02–13.9) (ref) (0.4–1.2)
70 16 1 156 18
(80.5) (18.4) (1.1) (89.7) (10.3)
1 NS NS 1 NS
1.0 0.9 2.3 1.0 0.9
(ref) (0.5–1.8) (0.1–36.6) (ref) (0.6–1.8)
55 16 42 126 100
(48.7) (14.1) (37.2) (55.8) (44.2)
1 NS NS 1 NS
1.0 0.6 1.2 1.0 1.1
(ref) (0.3–1.3) (0.7–2.0) (ref) (0.8–1.6)
37 18 31 92 80
(43) (20.9) (36.1) (53.5) (46.5)
1 NS NS 1 NS
1.0 1.1 1.3 1.0 1.3
(ref) (0.6–2.1) (0.8–2.4) (ref) (0.9–1.8)
(ref) (0.6–1.7) (0.8–2.4) (ref) (0.9–1.6)
18 54 42 90 138
(15.8) (47.4) (36.8) (39.5) (60.5)
1 NS 0.04 1 0.0002
1.0 0.4 2.0 1.0 1.9
(ref) (0.8–2.7) (1.0–3.9) (ref) (1.4–2.7)
24 38 25 86 88
(27.6) (43.7) (28.7) (49.4) (50.6)
1 NS NS 1 NS
1.0 0.8 0.9 1.0 1.3
(ref) (0.4–1.4) (0.5–1.8) (ref) (0.9–1.8)
1.0 1.2 1.9 1.0 1.4
(ref) (0.6–2.2) (0.9–3.5) (ref) (1.1–1.9)
10 45 59 65 163
(8.8) (39.5) (51.7) (28.5) (71.5)
1 NS NS 1 0.02
1.0 1.3 2.1 1.0 1.5
(ref) (0.6–2.9) (0.9–4.8) (ref) (1.1–2.2)
10 34 43 54 120
(11.5) (39.1) (49.4) (31.0) (69.0)
1 NS NS 1 NS
1.0 0.9 1.6 1.0 1.3
(ref) (0.4–2.2) (0.7–3.5) (ref) (0.9–1.9)
1.0 1.2 1.9 1.0 1.5
(ref) (0.6–2.3) (1.0–3.7) (ref) (1.1–2.0)
10 44 59 64 162
(8.9) (38.9) (52.2) (28.3) (71.7)
1 NS 0.04 1 0.01
1.0 1.4 2.3 1.0 1.6
(ref) (0.6–3.1) (1.0–4.9) (ref) (1.1–2.2)
10 34 42 54 118
(11.6) (39.5) (48.8) (31.4) (68.6)
1 NS NS 1 NS
1.0 1.1 1.6 1.0 1.3
(ref) (0.5–2.4) (0.7–3.6) (ref) (0.9–1.9)
P values and OR (95% CI) in bold are significant. Women who have experienced only first-trimester miscarriages (two or more). c Women who have experienced at least two first trimester miscarriages and have experienced pregnancy losses in the second and/or third trimesters. NS = not significant; ref = reference genotype; RSA = recurrent spontaneous abortion; SNP = single nucleotide polymorphism. b
RSA (others)c
PH Andraweera et al.
PLAU rs2227564 CC CT TT C T PLAUR rs4251923 GG GA AA G A PLG rs4252114 TT CT CC T C SERBP1 rs1799889 5G/5G 5G/4G 4G/4G 5G 4G SERBP1 rs1799768 4G/4G 4G/5G 5G/5G 4G 5G SERBP2 rs6098 GG GA AA G A SERBP2 rs6103 GG GC CC G C
P
RSA (T1)b
Control
748
Table 3 Genotype and allele frequency distribution of polymorphisms in fibrinolytic pathway genes in women who have experienced recurrent spontaneous abortion and controls.a
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion
749
Table 4 Combined effects of PLAUR rs4251923/SERBP2 rs6098/SERBP2 rs6103 genotypes on the risk of recurrent spontaneous abortion. Genotype of PLAUR rs4251923/SERBP2 rs6098/SERBP2 rs6103 GG/GG/GG GG/GA/GC GG/AA/CC GA/GA/GC GA/AA/CC GA/GG/GG
Control
RSA
n (%)
n (%)
27 86 68 8 8 0
14 61 85 16 14 6
(13.7) (43.7) (34.5) (4.1) (4.1)
(7.1) (31.1) (43.4) (8.2) (7.1) (3.1)
P-value
OR (95% CI)
ref. NS 0.01 0.01 0.04 0.005
ref. 1.4 2.4 3.9 2.9 21.3
(0.7–2.8) (1.2–4.9) (1.3–11.2) (1.0–8.6) (1.1–410.3)
NS = not significant; ref = reference genotype; RSA = recurrent spontaneous abortion.
Many patients who have experienced RSA are known to be in a prothrombotic state even outside pregnancy, and hereditary thrombophilia is a recognized risk factor for spontaneous abortion (Quenby et al., 2005; Rey et al., 2003). The association between impaired fibrinolytic capacity and RSA was initially demonstrated by Gris et al. (1990), but research in this field is still limited. The fibrinolytic system includes a spectrum of proteolytic enzymes that are implicated in many physiological and pathophysiological processes, such as maintaining the haemostatic balance, tissue remodelling, tumour invasion, angiogenesis and reproduction (Zorio et al., 2008). The fibrinolytic system plays a key role in implantation as it regulates early human trophoblast migration and invasion. Plasmin is the main enzyme in the fibrinolytic system and cleaves fibrin into soluble degradation products. The activation of plasminogen to plasmin is mediated by two types of mediators, the uPA and the tissue-type plasminogen activator. Urokinase plasminogen activator is expressed by extravillous trophoblast cells and the catalytic domain of uPA converts the inactive proenzyme plasminogen to active plasmin. Plasmin promotes the degradation of the extracellular matrix by activating metalloproteinases (MMP), as well as by directly degrading certain extracellular matrix components (Lala and Chakraborty, 2003). In addition, the amino-terminal fragment of uPA is known to promote extravillous trophoblast cell migration independent of the catalytic domain, by binding to uPAR on the extravillous trophoblast cell surface (Lala and Chakraborty, 2003). The major antagonists of the plasminogen activators are the plasminogen activator inhibitors, PAI-1 and PAI-2. These proteins are expressed in invading human extravillous trophoblast cells and limit the depth of invasion (Lash et al., 2006; Xia et al., 2002). Therefore, abnormalities in the fibrinolytic system can lead to implantation failure and spontaneous abortion. The prevalence of the variant allele of the PLAUR rs4251923 polymorphism was found to be increased in women who had experienced RSA compared with controls. The PLAUR rs4251923 polymorphism is located in the 3′UTR of the PLAUR gene, and is a linkage disequilibrium tagging single nucleotide polymorphisms (Stewart et al., 2009). It has been shown that the concentration of uPA and its receptor uPAR, as well as MMP 9, are decreased in the uterine luminal fluid of women experiencing RSA (Skrzypczak et al., 2007). The above study has also shown that a positive correlation exists between the
concentration of uPA and MMP 9. Reduced expression of uPA and uPAR, resulting in the down regulation of the target MMPs, may alter extracellular matrix turnover and impair implantation. In the present study, the prevalence of the common alleles of the SERBP2 rs6103 and SERBP2 rs6098 polymorphisms were increased in women who had experienced RSA compared with controls. These polymorphisms are located in exon 4 and exon 8 of the SERBP2 gene, respectively, and have previously been shown to be associated with preterm birth among children with cerebral palsy (Gibson et al., 2007). The effects of these two polymorphisms on RSM were similar. Also, the SERBP1 rs1799768 5G allele, which is less active in transcription than the 4G allele (Ju et al., 2010) was increased among women who had experienced only first-trimester pregnancy losses compared with controls. Uncomplicated pregnancy is associated with a reduction of fibrinolytic activity leading to a hypercoagulable state compared with the non-pregnant state (Coolman et al., 2006). As the pregnancy advances, maternal plasma concentrations of fibrinolytic activators, uPA and tissue-type plasminogen activator, progressively increase, as well as the fibrinolytic inhibitors PAI-1 and PAI-2. The increase in fibrinolytic inhibitors is known to be greater than that of fibrinolytic activators, and the final result is a reduction in net fibrinolytic activity that helps to maintain a procoagulable environment (Gilabert et al., 1995). These changes are considered vital for normal placental function and help women meet the haemostatic challenges of delivery. These haemostatic changes may predispose women to thrombosis and placental vascular complications. Current literature suggests that an exaggerated haemostatic response during pregnancy resulting in thrombosis of the uteroplacental vasculature may be implicated in pregnancy losses occurring at 10 weeks gestation or more (Rai, 2003). It has been shown that women who have experienced RSA, as well as those experiencing recurrent implantation failure after embryo transfer, have reduced plasma fibrinolytic potential suggesting a causative role of the fibrinolytic system in recurrent reproductive failure (Bick and Hoppensteadt, 2005; Martinez-Zamora et al., 2010, 2011). The association of SERBP2 rs6103 and rs6098 polymorphisms with RSA in this study, and the previously reported association of these polymorphisms with preterm birth, demonstrate that they may be implicated in adverse pregnancy outcomes. The functionality of these polymorphisms has not yet been evaluated, and it would be important to study the
750 correlation between these variants and plasma PAI- 2 level. The PLAU rs2227564, PLG rs4252114 and SERBP1 rs1799889 polymorphisms were not associated with RSA in Sinhalese women. Of these, the SERBP1 rs1799889 polymorphism has previously been studied in RSA by many groups, with some reporting significant associations whereas others failed to show any association. A recent systematic review and metaanalysis showed that this polymorphism is not significantly associated with RSA (Sotiriadis et al., 2007). Our results also show that the association of polymorphisms in the fibrinolytic system genes with RSA is seen among women who have experienced only first-trimester spontaneous abortions. Our cohort of women who had experienced pregnancy losses in the second and third trimester, however, was small and therefore was not adequately powered to detect significant differences. A main limitation in candidate gene association studies is the heterogeneity of observed results. Many reported significant associations fail to show any significance when investigated in an independent cohort. Most individual polymorphisms have small effects on disease risk and it is important to investigate potential gene–gene and gene–environment interactions. In this study, the cumulative effects of risk genotypes of the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 were investigated on disease risk, taking the reduced risk genotypes as the referent. We were able to demonstrate significant associations of risk genotype combinations on the risk of RSM. These findings show that a woman who inherits a combination of risk genotypes in the fibrinolytic system genes is at risk of RSA. A possible mechanism would be the combined increased risk of impaired implantation. Buchholz et al. (2003) have previously studied the cumulative effect of polymorphisms in SERBP1 and ACE (angiotensin converting enzyme) genes in RSA, and have reported an increased risk. This provides further evidence on the potential role of polymorphisms in the fibrinolytic system genes in recurent spontaneous abortion. Spontaneous abortion is a multifactorial disorder and many genetic and environmental factors are implicated in its pathogenesis; however, it would be interesting to investigate potential gene–environmental interactions. The following limitations are acknowledged in this study: lack of prospective data on pregnancy outcome; no available data on environmental and life style factors; and hence, the inability to investigate gene–environment interactions. In conclucion, our findings demonstrate that the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 polymorphisms are individually associated with RSA in Sinhalese women and that genotype combinations of these polymorphisms further increase the risk of RSM. Functional studies are required to elucidate their cellular and molecular effects.
Acknowledgements We wish to thank the women who generously consented to participate in this study. This study was funded by the National Health and Medical Research Council Australia (NHMRC) Project Grant ID519225 awarded to CTR and GAD. CTR is supported by a NHMRC Senior Research Fellowship APP1020749.
PH Andraweera et al. The recruitment, characterisation and establishment of the RSM sample collection in Sri Lanka was funded by a grant from the National Science Foundation, Sri Lanka awarded to VHWD and RWJ (Grant No: SIDA/BT/2005/04). The study sponsors had no role in study design, data analyses, and interpretation or writing this report.
References Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., Golani, I., 2001. Controlling the false discovery rate in behavior genetics research. Behav. Brain Res. 125, 279–284. Bick, R.L., Hoppensteadt, D., 2005. Recurrent miscarriage syndrome and infertility due to blood coagulation protein/platelet defects: a review and update. Clin. Appl. Thromb. Hemost 11, 1–13. Buchholz, T., Lohse, P., Rogenhofer, N., Kosian, E., Pihusch, R., Thaler, C.J., 2003. Polymorphisms in the ACE and PAI-1 genes are associated with recurrent spontaneous miscarriages. Hum. Reprod. 18, 2473–2477. Coolman, M., de Groot, C.J., Steegers, E.A., Geurts-Moespot, A., Thomas, C.M., Steegers-Theunissen, R.P., Sweep, F.C., 2006. Concentrations of plasminogen activators and their inhibitors in blood preconceptionally, during and after pregnancy. Eur. J. Obstet. Gynecol. Reprod. Biol. 128, 22–28. Gibson, C.S., MacLennan, A.H., Dekker, G.A., Goldwater, P.N., Dambrosia, J.M., Munroe, D.J., Tsang, S., Stewart, C., Nelson, K.B., 2007. Genetic polymorphisms and spontaneous preterm birth. Obstet. Gynecol. 109, 384–391. Gilabert, J., Estelles, A., Grancha, S., Espana, F., Aznar, J., 1995. Fibrinolytic system and reproductive process with special reference to fibrinolytic failure in pre-eclampsia. Hum. Reprod. 10 (Suppl. 2), 121–131. Gris, J.C., Schved, J.F., Neveu, S., Mares, P., Aguilar-Martinez, P., Dupaigne, D., 1990. Impaired fibrinolytic capacity and early recurrent spontaneous abortion. BMJ 300, 1500. Ju, H., Lim, B., Kim, M., Noh, S.M., Kim, W.H., Ihm, C., Choi, B.Y., Kim, Y.S., Kang, C., 2010. SERPINE1 intron polymorphisms affecting gene expression are associated with diffuse-type gastric cancer susceptibility. Cancer 116, 4248–4255. Lala, P.K., Chakraborty, C., 2003. Factors regulating trophoblast migration and invasiveness: possible derangements contributing to pre-eclampsia and fetal injury. Placenta 24, 575–587. Lash, G.E., Otun, H.A., Innes, B.A., Bulmer, J.N., Searle, R.F., Robson, S.C., 2006. Low oxygen concentrations inhibit trophoblast cell invasion from early gestation placental explants via alterations in levels of the urokinase plasminogen activator system. Biol. Reprod. 74, 403–409. Martinez-Zamora, M.A., Creus, M., Tassies, D., Bove, A., Reverter, J.C., Carmona, F., Balasch, J., 2010. Thrombin activatable fibrinolysis inhibitor and clot lysis time in women with recurrent miscarriage associated with the antiphospholipid syndrome. Fertil. Steril. 94, 2437–2440. Martinez-Zamora, M.A., Creus, M., Tassies, D., Reverter, J.C., Civico, S., Carmona, F., Balasch, J., 2011. Reduced plasma fibrinolytic potential in patients with recurrent implantation failure after IVF and embryo transfer. Hum. Reprod. 26, 510–516. Naruse, K., Lash, G.E., Bulmer, J.N., Innes, B.A., Otun, H.A., Searle, R.F., Robson, S.C., 2009. The urokinase plasminogen activator (uPA) system in uterine natural killer cells in the placental bed during early pregnancy. Placenta 30, 398–404. Patnaik, M.M., Haddad, T., Morton, C.T., 2007. Pregnancy and thrombophilia. Expert Rev. Cardiovasc. Ther. 5, 753–765. Practice Committee of American Society for Reproductive Medicine, 2013. Definitions of infertility and recurrent pregnancy loss: a committee opinion. Fertil. Steril. 99, 63.
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion Quenby, S., Farquharson, R.G., Dawood, F., Hughes, A.M., Topping, J., 2005. Recurrent miscarriage and long-term thrombosis risk: a case-control study. Hum. Reprod. 20, 1729–1732. Rai, R., 2003. Is miscarriage a coagulopathy? Curr. Opin. Obstet. Gynecol. 15, 265–268. Rey, E., Kahn, S.R., David, M., Shrier, I., 2003. Thrombophilic disorders and fetal loss: a meta-analysis. Lancet 361, 901–908. Skrzypczak, J., Wirstlein, P., Mikolajczyk, M., 2007. Could the defects in the endometrial extracellular matrix during the implantation be a cause for impaired fertility? Am. J. Reprod. Immunol. 57, 40–48. Sotiriadis, A., Makrigiannakis, A., Stefos, T., Paraskevaidis, E., Kalantaridou, S.N., 2007. Fibrinolytic defects and recurrent miscarriage: a systematic review and meta-analysis. Obstet. Gynecol. 109, 1146–1155. Stewart, C.E., Hall, I.P., Parker, S.G., Moffat, M.F., Wardlaw, A.J., Connolly, M.J., Ruse, C., Sayers, I., 2009. PLAUR polymorphisms and lung function in UK smokers. BMC Med. Genet. 10, 112.
751
Xia, Y., Wen, H.Y., Kellems, R.E., 2002. Angiotensin II inhibits human trophoblast invasion through AT1 receptor activation. J. Biol. Chem. 277, 24601–24608. Zorio, E., Gilabert-Estelles, J., Espana, F., Ramon, L.A., Cosin, R., Estelles, A., 2008. Fibrinolysis: the key to new pathogenetic mechanisms. Curr. Med. Chem. 15, 923–929.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 1 March 2014; refereed 23 July 2014; accepted 7 August 2014.
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Polymorphisms in the fibrinolytic pathway genes and the risk of recurrent spontaneous abortion Prabha H Andraweera a,b,*, Gustaaf A Dekker a,c, Steven D Thompson a, Rachael C Nowak a, Rohan W Jayasekara b, Vajira HW Dissanayake b, Claire T Roberts a a
School of Paediatrics and Reproductive Health, Robinson Research Institute, University of Adelaide, Adelaide, Australia; Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka; c Women’s and Children’s Division, Lyell McEwin Hospital, Elizabeth Vale, South Australia, Australia b
* Corresponding author.
E-mail address: [email protected] (P Andraweera). Prabha Andraweera MBBS, PhD, is a Postdoctoral Fellow in the Discipline of Obstetrics and Gynaecology, Robinson Research Institute, University of Adelaide, Australia. Her current research focuses on the role of genetics of adverse pregnancy outcomes, including recurrent miscarriage, preeclampsia, intrauterine growth restriction, preterm birth and gestational diabetes mellitus. Her basic science research explores the molecular pathways in the placenta that are implicated in the pathogenesis of these pregnancy complications.
Impaired fibrinolytic activity is implicated in the pathogenesis of recurrent spontaneous abortion (RSA). This case-control study assessed the prevalence of polymorphisms in fibrinolytic system genes in RSA. Cases comprised 202 Sinhalese women who had experienced at least two first-trimester spontaneous abortions and had no living children; controls were 202 women with no history of spontaneous abortion and two or more living children. The groups were matched for age and ethnicity. DNA was genotyped using the Sequenom MassARRAY system. The PLAUR rs4251923 A (OR 95% CI 2.3 [1.3 to 4.0]), SERBP2 rs6098 A (OR 95% CI 1.4 [1.1 to 1.9]) and SERBP2 rs6103 C alleles (OR 95% CI 1.4 [1.1 to 1.9]) were increased in the RSA group compared with controls. The prevalence of PLAUR rs4251923/ SERBP2 rs6098/ SERBP2 rs6103 GG/AA/CC (OR 95% CI 2.4 [1.2 to 4.9], GA/GA/GC(OR 95% CI 3.9 [1.3 to 11.2]), GA/AA/CC (OR 95% CI 2.9 [1.0 to 8.6] and GA/GG/GG (OR 95% CI 21.3 [1.1 to 410.3]) genotypes were also increased in cases. Polymorphisms in the fibrinolytic system genes are associated with RSA in Sinhalese women. These likely impair implantation.
Abstract
© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. KEYWORDS: fibrinolytic pathway, gene, miscarriage, polymorphism, pregnancy
http://dx.doi.org/10.1016/j.rbmo.2014.08.014 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
746
Introduction Recurrent spontaneous abortion (RSA), defined as two or more spontaneous abortions before 20 weeks of gestation, affects about 1–3% of couples (Practice Committee of American Society for Reproductive Medicine, 2013). Hereditary and acquired thrombophilias, as well as fibrinolytic defects, are known to be associated with increased risk of RSA (Gris et al., 1990; Patnaik et al., 2007; Quenby et al., 2005; Rey et al., 2003). Hypo-fibrinolysis is known to be associated with thrombosis, but importantly the fibrinolytic system also participates in the regulation of early placental trophoblast invasion. The urokinase type plasminogen activator (uPA) encoded by the PLAU gene is activated after it binds to its receptor (uPAR) encoded by the PLAUR gene and converts the inactive proenzyme plasminogen (PLG) to active plasmin, which in-turn cleaves fibrin (Naruse et al., 2009). Plasmin promotes trophoblast invasion by activating matrix metalloproteinases and by degrading some components of the extracellular matrix of the decidua (Naruse et al., 2009). This process is inhibited by binding of either the major plasminogen activator inhibitors (PAI-1 encoded by the SERBP gene or PAI-2 encoded by the SERBP2 gene) to the uPA/uPAR complex leading to internalisation of the ligand-receptor complex (Naruse et al., 2009). The first evidence of a role of the fibrinolytic system in the pathogenesis of RSA was reported in 1990 when Gris et al. (1990) reported that maternal venous plasminogen activator inhibitor activity was increased in women who had experience RSA. Subsequently, however, few groups have studied the effects of this pathway in RSA. It was recently demonstrated that the concentrations of uPA and uPAR were decreased in the uterine fluid of women experiencing idiopathic RSA (Skrzypczak et al., 2007). In addition, some investigators demonstrated that polymorphisms in SERBP1 are associated with RSA. Because interactions among many proteins in the fibrinolytic pathway are vital for the optimal physiological function of the fibrinolytic system, it is important to identify the prevalence of a combination of polymorphisms in genes of this system in women with RSA. Therefore, the aim of this study was to investigate the association of selected polymorphisms in PLAU, PLAUR, PLG, SERBP1 and SERBP2 in Sinhalese women who had experienced RSA.
Materials and methods In this case-control study, all 404 DNA samples that comprised a biobank of samples extracted from peripheral blood of 404 recruited women were analysed with the aim of identifying genetic variants that are associated with RSA. The participants were consecutively recruited at two tertiary care maternity hospitals and at the Human Genetics Unit of the Faculty of Medicine, University of Colombo, Sri Lanka between January 2006 and December 2008. The study was approved by the Ethics Review Committee of the Faculty of Medicine, University of Colombo, Sri Lanka (EC/05/003, 10/02/2005) and the Human Ethics Committee of the University of Adelaide, Australia (H147-2008, 13/11/2008). All women provided written informed consent. The study population consisted of
PH Andraweera et al. 202 women who had experienced RSA and 202 control participants. The eligibility criteria for recruitment into the RSA group included women who had experienced at least two consecutive first-trimester pregnancy losses and having no living children. All women in the RSA group had been assessed by an obstetrician and had undergone routine testing to identify a cause for RSA, including endocrine disorders, structural abnormalities of the reproductive tract, thrombophilias and antiphospholipid antibody syndrome. Those with an identifiable cause for RSA were not eligible for participation. The other exclusion criteria were non-Sinhalese women or women of mixed ethnicity, pregnancy fathered by a non-Sinhalese man and chromosome abnormalities in the woman or the partner identified by high-resolution karyotyping. The control participants were 202 women matched for ethnicity and age who had two or more living children and who did not have a past history of spontaneous abortion. The following polymorphisms of the fibrinolytic pathway genes were selected: PLAU rs2227564, PLAUR rs4251923, PLG rs4252114, SERBP1 rs1799889, SERBP1 rs1799768, SERBP2 rs6103 and SERBP2 rs6098. Selection was based on known functional effects or previous reported associations with disease phenotypes. Peripheral blood samples were collected from the women, and DNA was extracted using QiaAmp blood midi DNA extraction kits (Qiagen). Genotyping was carried out at the Australian Genome Research Facility using the Sequenom MassARRAY system. The primers used for genotyping are detailed in Table 1. As a quality-control measure, 300 independent DNA samples from women recruited to a study on adverse pregnancy outcomes in Adelaide, Australia, were genotyped in house for the same single nucleotide polymorphisms using real-time polymerase chain reaction and highresolution melt. The concordance rate of the real-time polymerase chain reaction results and MassARRAY results was 100%. Each sample was also genotyped for amelogenin to ensure that the sex of the sample was correct. Chi-squared test was used to test the genotypes at each polymorphic locus for Hardy–Weinberg equilibrium and to compare categorical variables. PASW version 17.02 (SPSS, Chicago, IL) was used for all data analyses. The genotype and allele frequencies of cases were compared with controls using chi-squared analyses. Results were reported as number and per cent or mean ± SD where appropriate. P < 0.05 was considered statistically significant. A false discovery rate (FDR) correction was made to adjust for multiple comparisons controlling the FDR at 15% (Benjamini et al., 2001). The prevalence of the polymorphisms in the general population was determined by genotyping 85 randomly selected Sinhalese men and women. On the basis of prevalence of a polymorphism in 20% of the general population, a ratio of one control participant to one case, 202 women who had experienced recurrent pregnancy loss and 202 control participants had 80% power to detect an odds ratio of 2.0 (β = 80%, α = 0.05).
Results The mean age of the women in the RSA group was 31.9 ± 0.4 years and the mean age of the control group was 32.3 ± 0.3 years. Of the 202 women in the RSA group, 140 (69.3%) had experienced three or more first-trimester pregnancy losses
Table 2
CTAATGCACCATGCACTCTTGGACAAGC TGAAGGGCAAAGGGGT ACTTATAATTGGAAATTGCACTTAC GTCTGGACACGTGGGG CCGCGGATGATACACGGCTGACTCCCC CTTTTATTGACACTTTCCAGTAAATAAT TTTTCTTATTATGCATAAGATAACCAA
Extend primer
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion
747
Characteristics of the study population.
Characteristic
Age (years) Pregnancy loss n (%) T1 only T1 and T2 T1 and T3 T1, T2 and T3 ≥ 3 T1 losses
Controls
Recurrent spontaneous abortion
(n = 202)
(n = 202)
32.3 ± 0.33
31.9 ± 0.41
0 0 0 0 0
114 (56.4) 75 (37.1) 9 (4.5) 4 (2.0) 140 (69.3)
PCR = polymerase chain reaction.
ACGTTGGATGTGGTGCTATGTGCAGGTGG ACGTTGGATGACCTGAAATCCCCCTCTCTG ACGTTGGATGCACTCAGTAGGGACCCATAA ACGTTGGATGTTCCCTCATCCCTGCCATGT ACGTTGGATGGTTGTTGACACAAGAGAGCC ACGTTGGATGTCTCAGCTCTGCAATCAATG ACGTTGGATGAAAATCTGCCGAAAAATAA ACGTTGGATGAGTGATGCTCACCATCTGCG ACGTTGGATGAAGTCTGTAGGGCTGGGAG ACGTTGGATGGAAAGAACAGATAGAGTACTT ACGTTGGATGCACAGAGAGAGTCTGGACAC ACGTTGGATGCTCCGATGATACACGGCTGA ACGTTGGATGTCGCAGACTTCTCACCAAAC ACGTTGGATGACAGTTTGTGGCAGATCATC PLAU rs2227564 PLAUR rs4251923 PLG rs4252114 SERBP1 rs1799889 SERBP1 rs1799768 SERBP2 rs6098 SERBP2 rs6103
Second PCR primer First PCR primer Single single nucleotide polymorphisms
Table 1
Primer sequences for Sequenom MassArray system.
T1 = first trimester; T2 = second trimester; T3 = third trimester.
and 114 (56.4%) had experienced only first-trimester pregnancy losses (Table 2). All cases and controls were non smokers. All polymorphisms were in Hardy–Weinberg equilibrium in both cases and controls. PLAUR rs4251923 A allele (OR 95% CI 2.3 [1.3 to 4.0]; P = 0.003), SERBP2 rs6098 A allele (OR (95% CI 1.4 [1.1 to 1.9]; P = 0.01 and SERBP2 rs6103 C allele (OR 95% CI 1.4 [1.1 to 1.9]; P = 0.01) were increased in women in the RSA group compared with controls (Table 3). These results were significant after FDR correction for multiple testing. The other polymorphisms were not associated with RSA (Table 3). When the RSA was stratified in to those who had experienced only first-trimester pregnancy losses and those who had experienced first-trimester as well as second and third trimester pregnancy losses, PLAUR rs4251923 A allele (OR 95% CI 2.9 [1.6 to 5.4]; P = 0.002), SERBP2 rs6098 A allele (OR 95% CI 1.5 [1.1 to 2.2]; P = 0.02) and SERBP2 rs6103 C allele (OR 95% CI 1.6 [1.1 to 2.2]; P = 0.01) and SERBP1 rs1799768 5G allele (OR 95% CI 1.9 [1.4 to 2.7]; P = 0.0002) were increased among women who had experienced only firsttrimester spontaneous abortions compared with controls (Table 3). None of the polymorphisms were associated with RSA in women who had experienced first trimester as well as second and third trimester pregnancy losses (Table 3). As a posthoc analysis, RSA and control groups were stratified into genotype groups based on the significant associations. The combination of the reduced risk GG/GG/GG genotypes of the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 polymorphisms were used as the referent. The combinations of genotypes evident in the study population and the associations with RSA are detailed in Table 4. The prevalence of combinations of risk genotypes were increased in the RSA group compared with the control group.
Discussion As far as is known, this is the first study to investigate a combination of polymorphisms in the fibrinolytic system genes in Sinhalese women experiencing RSA. Our findings show that PLAUR rs4251923, SERBP2 rs6103 and SERBP2 rs6098 are individually associated with RSA and that genotype combinations of these polymorphisms increase the risk of RSA.
SNP genotype and allele
a
RSA All
OR (95% CI)
P
OR (95% CI)
n (%)
n (%)
73 103 25 249 153
(36.3) (51.3) (12.4) (61.9) (38.1)
88 84 29 260 142
(43.8) (41.8) (14.4) (64.7) (35.3)
1 NS NS 1 NS
1.0 0.7 0.9 1.0 0.9
(ref) (0.4–1.0) (0.5–1.8) (ref) (0.7–1.2)
54 46 14 154 74
(47.4) (40.3) (12.3) (67.5) (32.5)
1 0.04 NS 1 NS
1.0 0.6 1.2 1.0 0.8
182 19 0 383 19
(90.5) (9.5) (95.3) (4.7)
161 37 2 359 41
(80.5) (18.5) (1.0) (89.8) (10.2)
1 0.008 NS 1 0.003
1.0 2.2 5.7 1.0 2.3
(ref) (1.2–4.0) (0.3–118.6) (ref) (1.3–4.0)
86 25 2 197 29
(76.1) (22.1) (1.8) (87.2) (12.8)
1 0.002 NS 1 0.002
158 39 1 355 41
(79.8) (19.7) (0.5) (89.6) (10.4)
164 34 1 362 36
(82.4) (17.1) (0.5) (91.0) (9.0)
1 NS NS 1 NS
1.0 0.8 0.9 1.0 0.9
(ref) (0.5–1.4) (0.1–15.6) (ref) (0.5–1.4)
94 18 0 206 18
(83.9 (16.1)
96 43 60 235 163
(48.2) (21.6) (30.2) (59.0) (41.0)
92 34 73 218 180
(46.2) (17.1) (36.7) (54.8) (45.2)
1 NS NS 1 NS
1.0 0.8 1.3 1.0 1.2
(ref) (0.5–1.4) (0.8–1.9) (ref) (0.9–1.6)
47 99 54 193 207
(23.5) (49.5) (27.0) (48.2) (51.2)
42 92 67 176 226
(20.9) (45.8) (33.3) (43.8) (56.2)
1 NS NS 1 NS
1.0 1.0 1.4 1.0 1.2
28 96 77 152 250
(13.9) (47.8) (38.3) (37.8) (62.2)
20 79 102 119 283
(10.0) (39.3) (50.7) (29.6) (70.4)
1 NS NS 1 0.01
29 93 76 151 245
(14.6) (47.0) (38.4) (38.1) (61.9)
20 78 101 118 280
(10.0) (39.2) (50.8) (29.6) (70.4)
1 NS 0.04 1 0.01
n (%)
P
OR (95% CI)
n (%)
(ref) (0.4–0.9) (0.6–2.6) (ref) (0.6–1.1)
34 38 15 106 68
(39.1) (43.7) (17.2) (60.9) (39.1)
1 NS NS 1 NS
1.0 0.8 1.3 1.0 1.0
(ref) (0.5–1.4) (0.6–2.3) (ref) (0.7–1.5)
1.0 2.8 10.6 1.0 2.9
(ref) (1.4–5.3) (0.5–222.3) (ref) (1.6–5.4)
75 12 0 162 12
(86.2) (13.8) (93.1) (6.9)
1 NS NS 1 NS
1.0 1.5 2.4 1.0 1.5
(ref) (0.7–3.3) (0.05–123.1) (ref) (0.7–3.1)
(91.9) (8.1)
1 NS NS 1 NS
1.0 0.8 0.6 1.0 0.7
(ref) (0.4–1.4) (0.02–13.9) (ref) (0.4–1.2)
70 16 1 156 18
(80.5) (18.4) (1.1) (89.7) (10.3)
1 NS NS 1 NS
1.0 0.9 2.3 1.0 0.9
(ref) (0.5–1.8) (0.1–36.6) (ref) (0.6–1.8)
55 16 42 126 100
(48.7) (14.1) (37.2) (55.8) (44.2)
1 NS NS 1 NS
1.0 0.6 1.2 1.0 1.1
(ref) (0.3–1.3) (0.7–2.0) (ref) (0.8–1.6)
37 18 31 92 80
(43) (20.9) (36.1) (53.5) (46.5)
1 NS NS 1 NS
1.0 1.1 1.3 1.0 1.3
(ref) (0.6–2.1) (0.8–2.4) (ref) (0.9–1.8)
(ref) (0.6–1.7) (0.8–2.4) (ref) (0.9–1.6)
18 54 42 90 138
(15.8) (47.4) (36.8) (39.5) (60.5)
1 NS 0.04 1 0.0002
1.0 0.4 2.0 1.0 1.9
(ref) (0.8–2.7) (1.0–3.9) (ref) (1.4–2.7)
24 38 25 86 88
(27.6) (43.7) (28.7) (49.4) (50.6)
1 NS NS 1 NS
1.0 0.8 0.9 1.0 1.3
(ref) (0.4–1.4) (0.5–1.8) (ref) (0.9–1.8)
1.0 1.2 1.9 1.0 1.4
(ref) (0.6–2.2) (0.9–3.5) (ref) (1.1–1.9)
10 45 59 65 163
(8.8) (39.5) (51.7) (28.5) (71.5)
1 NS NS 1 0.02
1.0 1.3 2.1 1.0 1.5
(ref) (0.6–2.9) (0.9–4.8) (ref) (1.1–2.2)
10 34 43 54 120
(11.5) (39.1) (49.4) (31.0) (69.0)
1 NS NS 1 NS
1.0 0.9 1.6 1.0 1.3
(ref) (0.4–2.2) (0.7–3.5) (ref) (0.9–1.9)
1.0 1.2 1.9 1.0 1.5
(ref) (0.6–2.3) (1.0–3.7) (ref) (1.1–2.0)
10 44 59 64 162
(8.9) (38.9) (52.2) (28.3) (71.7)
1 NS 0.04 1 0.01
1.0 1.4 2.3 1.0 1.6
(ref) (0.6–3.1) (1.0–4.9) (ref) (1.1–2.2)
10 34 42 54 118
(11.6) (39.5) (48.8) (31.4) (68.6)
1 NS NS 1 NS
1.0 1.1 1.6 1.0 1.3
(ref) (0.5–2.4) (0.7–3.6) (ref) (0.9–1.9)
P values and OR (95% CI) in bold are significant. Women who have experienced only first-trimester miscarriages (two or more). c Women who have experienced at least two first trimester miscarriages and have experienced pregnancy losses in the second and/or third trimesters. NS = not significant; ref = reference genotype; RSA = recurrent spontaneous abortion; SNP = single nucleotide polymorphism. b
RSA (others)c
PH Andraweera et al.
PLAU rs2227564 CC CT TT C T PLAUR rs4251923 GG GA AA G A PLG rs4252114 TT CT CC T C SERBP1 rs1799889 5G/5G 5G/4G 4G/4G 5G 4G SERBP1 rs1799768 4G/4G 4G/5G 5G/5G 4G 5G SERBP2 rs6098 GG GA AA G A SERBP2 rs6103 GG GC CC G C
P
RSA (T1)b
Control
748
Table 3 Genotype and allele frequency distribution of polymorphisms in fibrinolytic pathway genes in women who have experienced recurrent spontaneous abortion and controls.a
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion
749
Table 4 Combined effects of PLAUR rs4251923/SERBP2 rs6098/SERBP2 rs6103 genotypes on the risk of recurrent spontaneous abortion. Genotype of PLAUR rs4251923/SERBP2 rs6098/SERBP2 rs6103 GG/GG/GG GG/GA/GC GG/AA/CC GA/GA/GC GA/AA/CC GA/GG/GG
Control
RSA
n (%)
n (%)
27 86 68 8 8 0
14 61 85 16 14 6
(13.7) (43.7) (34.5) (4.1) (4.1)
(7.1) (31.1) (43.4) (8.2) (7.1) (3.1)
P-value
OR (95% CI)
ref. NS 0.01 0.01 0.04 0.005
ref. 1.4 2.4 3.9 2.9 21.3
(0.7–2.8) (1.2–4.9) (1.3–11.2) (1.0–8.6) (1.1–410.3)
NS = not significant; ref = reference genotype; RSA = recurrent spontaneous abortion.
Many patients who have experienced RSA are known to be in a prothrombotic state even outside pregnancy, and hereditary thrombophilia is a recognized risk factor for spontaneous abortion (Quenby et al., 2005; Rey et al., 2003). The association between impaired fibrinolytic capacity and RSA was initially demonstrated by Gris et al. (1990), but research in this field is still limited. The fibrinolytic system includes a spectrum of proteolytic enzymes that are implicated in many physiological and pathophysiological processes, such as maintaining the haemostatic balance, tissue remodelling, tumour invasion, angiogenesis and reproduction (Zorio et al., 2008). The fibrinolytic system plays a key role in implantation as it regulates early human trophoblast migration and invasion. Plasmin is the main enzyme in the fibrinolytic system and cleaves fibrin into soluble degradation products. The activation of plasminogen to plasmin is mediated by two types of mediators, the uPA and the tissue-type plasminogen activator. Urokinase plasminogen activator is expressed by extravillous trophoblast cells and the catalytic domain of uPA converts the inactive proenzyme plasminogen to active plasmin. Plasmin promotes the degradation of the extracellular matrix by activating metalloproteinases (MMP), as well as by directly degrading certain extracellular matrix components (Lala and Chakraborty, 2003). In addition, the amino-terminal fragment of uPA is known to promote extravillous trophoblast cell migration independent of the catalytic domain, by binding to uPAR on the extravillous trophoblast cell surface (Lala and Chakraborty, 2003). The major antagonists of the plasminogen activators are the plasminogen activator inhibitors, PAI-1 and PAI-2. These proteins are expressed in invading human extravillous trophoblast cells and limit the depth of invasion (Lash et al., 2006; Xia et al., 2002). Therefore, abnormalities in the fibrinolytic system can lead to implantation failure and spontaneous abortion. The prevalence of the variant allele of the PLAUR rs4251923 polymorphism was found to be increased in women who had experienced RSA compared with controls. The PLAUR rs4251923 polymorphism is located in the 3′UTR of the PLAUR gene, and is a linkage disequilibrium tagging single nucleotide polymorphisms (Stewart et al., 2009). It has been shown that the concentration of uPA and its receptor uPAR, as well as MMP 9, are decreased in the uterine luminal fluid of women experiencing RSA (Skrzypczak et al., 2007). The above study has also shown that a positive correlation exists between the
concentration of uPA and MMP 9. Reduced expression of uPA and uPAR, resulting in the down regulation of the target MMPs, may alter extracellular matrix turnover and impair implantation. In the present study, the prevalence of the common alleles of the SERBP2 rs6103 and SERBP2 rs6098 polymorphisms were increased in women who had experienced RSA compared with controls. These polymorphisms are located in exon 4 and exon 8 of the SERBP2 gene, respectively, and have previously been shown to be associated with preterm birth among children with cerebral palsy (Gibson et al., 2007). The effects of these two polymorphisms on RSM were similar. Also, the SERBP1 rs1799768 5G allele, which is less active in transcription than the 4G allele (Ju et al., 2010) was increased among women who had experienced only first-trimester pregnancy losses compared with controls. Uncomplicated pregnancy is associated with a reduction of fibrinolytic activity leading to a hypercoagulable state compared with the non-pregnant state (Coolman et al., 2006). As the pregnancy advances, maternal plasma concentrations of fibrinolytic activators, uPA and tissue-type plasminogen activator, progressively increase, as well as the fibrinolytic inhibitors PAI-1 and PAI-2. The increase in fibrinolytic inhibitors is known to be greater than that of fibrinolytic activators, and the final result is a reduction in net fibrinolytic activity that helps to maintain a procoagulable environment (Gilabert et al., 1995). These changes are considered vital for normal placental function and help women meet the haemostatic challenges of delivery. These haemostatic changes may predispose women to thrombosis and placental vascular complications. Current literature suggests that an exaggerated haemostatic response during pregnancy resulting in thrombosis of the uteroplacental vasculature may be implicated in pregnancy losses occurring at 10 weeks gestation or more (Rai, 2003). It has been shown that women who have experienced RSA, as well as those experiencing recurrent implantation failure after embryo transfer, have reduced plasma fibrinolytic potential suggesting a causative role of the fibrinolytic system in recurrent reproductive failure (Bick and Hoppensteadt, 2005; Martinez-Zamora et al., 2010, 2011). The association of SERBP2 rs6103 and rs6098 polymorphisms with RSA in this study, and the previously reported association of these polymorphisms with preterm birth, demonstrate that they may be implicated in adverse pregnancy outcomes. The functionality of these polymorphisms has not yet been evaluated, and it would be important to study the
750 correlation between these variants and plasma PAI- 2 level. The PLAU rs2227564, PLG rs4252114 and SERBP1 rs1799889 polymorphisms were not associated with RSA in Sinhalese women. Of these, the SERBP1 rs1799889 polymorphism has previously been studied in RSA by many groups, with some reporting significant associations whereas others failed to show any association. A recent systematic review and metaanalysis showed that this polymorphism is not significantly associated with RSA (Sotiriadis et al., 2007). Our results also show that the association of polymorphisms in the fibrinolytic system genes with RSA is seen among women who have experienced only first-trimester spontaneous abortions. Our cohort of women who had experienced pregnancy losses in the second and third trimester, however, was small and therefore was not adequately powered to detect significant differences. A main limitation in candidate gene association studies is the heterogeneity of observed results. Many reported significant associations fail to show any significance when investigated in an independent cohort. Most individual polymorphisms have small effects on disease risk and it is important to investigate potential gene–gene and gene–environment interactions. In this study, the cumulative effects of risk genotypes of the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 were investigated on disease risk, taking the reduced risk genotypes as the referent. We were able to demonstrate significant associations of risk genotype combinations on the risk of RSM. These findings show that a woman who inherits a combination of risk genotypes in the fibrinolytic system genes is at risk of RSA. A possible mechanism would be the combined increased risk of impaired implantation. Buchholz et al. (2003) have previously studied the cumulative effect of polymorphisms in SERBP1 and ACE (angiotensin converting enzyme) genes in RSA, and have reported an increased risk. This provides further evidence on the potential role of polymorphisms in the fibrinolytic system genes in recurent spontaneous abortion. Spontaneous abortion is a multifactorial disorder and many genetic and environmental factors are implicated in its pathogenesis; however, it would be interesting to investigate potential gene–environmental interactions. The following limitations are acknowledged in this study: lack of prospective data on pregnancy outcome; no available data on environmental and life style factors; and hence, the inability to investigate gene–environment interactions. In conclucion, our findings demonstrate that the PLAUR rs4251923, SERBP2 rs6098 and SERBP2 rs6103 polymorphisms are individually associated with RSA in Sinhalese women and that genotype combinations of these polymorphisms further increase the risk of RSM. Functional studies are required to elucidate their cellular and molecular effects.
Acknowledgements We wish to thank the women who generously consented to participate in this study. This study was funded by the National Health and Medical Research Council Australia (NHMRC) Project Grant ID519225 awarded to CTR and GAD. CTR is supported by a NHMRC Senior Research Fellowship APP1020749.
PH Andraweera et al. The recruitment, characterisation and establishment of the RSM sample collection in Sri Lanka was funded by a grant from the National Science Foundation, Sri Lanka awarded to VHWD and RWJ (Grant No: SIDA/BT/2005/04). The study sponsors had no role in study design, data analyses, and interpretation or writing this report.
References Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., Golani, I., 2001. Controlling the false discovery rate in behavior genetics research. Behav. Brain Res. 125, 279–284. Bick, R.L., Hoppensteadt, D., 2005. Recurrent miscarriage syndrome and infertility due to blood coagulation protein/platelet defects: a review and update. Clin. Appl. Thromb. Hemost 11, 1–13. Buchholz, T., Lohse, P., Rogenhofer, N., Kosian, E., Pihusch, R., Thaler, C.J., 2003. Polymorphisms in the ACE and PAI-1 genes are associated with recurrent spontaneous miscarriages. Hum. Reprod. 18, 2473–2477. Coolman, M., de Groot, C.J., Steegers, E.A., Geurts-Moespot, A., Thomas, C.M., Steegers-Theunissen, R.P., Sweep, F.C., 2006. Concentrations of plasminogen activators and their inhibitors in blood preconceptionally, during and after pregnancy. Eur. J. Obstet. Gynecol. Reprod. Biol. 128, 22–28. Gibson, C.S., MacLennan, A.H., Dekker, G.A., Goldwater, P.N., Dambrosia, J.M., Munroe, D.J., Tsang, S., Stewart, C., Nelson, K.B., 2007. Genetic polymorphisms and spontaneous preterm birth. Obstet. Gynecol. 109, 384–391. Gilabert, J., Estelles, A., Grancha, S., Espana, F., Aznar, J., 1995. Fibrinolytic system and reproductive process with special reference to fibrinolytic failure in pre-eclampsia. Hum. Reprod. 10 (Suppl. 2), 121–131. Gris, J.C., Schved, J.F., Neveu, S., Mares, P., Aguilar-Martinez, P., Dupaigne, D., 1990. Impaired fibrinolytic capacity and early recurrent spontaneous abortion. BMJ 300, 1500. Ju, H., Lim, B., Kim, M., Noh, S.M., Kim, W.H., Ihm, C., Choi, B.Y., Kim, Y.S., Kang, C., 2010. SERPINE1 intron polymorphisms affecting gene expression are associated with diffuse-type gastric cancer susceptibility. Cancer 116, 4248–4255. Lala, P.K., Chakraborty, C., 2003. Factors regulating trophoblast migration and invasiveness: possible derangements contributing to pre-eclampsia and fetal injury. Placenta 24, 575–587. Lash, G.E., Otun, H.A., Innes, B.A., Bulmer, J.N., Searle, R.F., Robson, S.C., 2006. Low oxygen concentrations inhibit trophoblast cell invasion from early gestation placental explants via alterations in levels of the urokinase plasminogen activator system. Biol. Reprod. 74, 403–409. Martinez-Zamora, M.A., Creus, M., Tassies, D., Bove, A., Reverter, J.C., Carmona, F., Balasch, J., 2010. Thrombin activatable fibrinolysis inhibitor and clot lysis time in women with recurrent miscarriage associated with the antiphospholipid syndrome. Fertil. Steril. 94, 2437–2440. Martinez-Zamora, M.A., Creus, M., Tassies, D., Reverter, J.C., Civico, S., Carmona, F., Balasch, J., 2011. Reduced plasma fibrinolytic potential in patients with recurrent implantation failure after IVF and embryo transfer. Hum. Reprod. 26, 510–516. Naruse, K., Lash, G.E., Bulmer, J.N., Innes, B.A., Otun, H.A., Searle, R.F., Robson, S.C., 2009. The urokinase plasminogen activator (uPA) system in uterine natural killer cells in the placental bed during early pregnancy. Placenta 30, 398–404. Patnaik, M.M., Haddad, T., Morton, C.T., 2007. Pregnancy and thrombophilia. Expert Rev. Cardiovasc. Ther. 5, 753–765. Practice Committee of American Society for Reproductive Medicine, 2013. Definitions of infertility and recurrent pregnancy loss: a committee opinion. Fertil. Steril. 99, 63.
Fibrinolytic pathway gene polymorphisms and recurrent spontaneous abortion Quenby, S., Farquharson, R.G., Dawood, F., Hughes, A.M., Topping, J., 2005. Recurrent miscarriage and long-term thrombosis risk: a case-control study. Hum. Reprod. 20, 1729–1732. Rai, R., 2003. Is miscarriage a coagulopathy? Curr. Opin. Obstet. Gynecol. 15, 265–268. Rey, E., Kahn, S.R., David, M., Shrier, I., 2003. Thrombophilic disorders and fetal loss: a meta-analysis. Lancet 361, 901–908. Skrzypczak, J., Wirstlein, P., Mikolajczyk, M., 2007. Could the defects in the endometrial extracellular matrix during the implantation be a cause for impaired fertility? Am. J. Reprod. Immunol. 57, 40–48. Sotiriadis, A., Makrigiannakis, A., Stefos, T., Paraskevaidis, E., Kalantaridou, S.N., 2007. Fibrinolytic defects and recurrent miscarriage: a systematic review and meta-analysis. Obstet. Gynecol. 109, 1146–1155. Stewart, C.E., Hall, I.P., Parker, S.G., Moffat, M.F., Wardlaw, A.J., Connolly, M.J., Ruse, C., Sayers, I., 2009. PLAUR polymorphisms and lung function in UK smokers. BMC Med. Genet. 10, 112.
751
Xia, Y., Wen, H.Y., Kellems, R.E., 2002. Angiotensin II inhibits human trophoblast invasion through AT1 receptor activation. J. Biol. Chem. 277, 24601–24608. Zorio, E., Gilabert-Estelles, J., Espana, F., Ramon, L.A., Cosin, R., Estelles, A., 2008. Fibrinolysis: the key to new pathogenetic mechanisms. Curr. Med. Chem. 15, 923–929.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 1 March 2014; refereed 23 July 2014; accepted 7 August 2014.
